PTPRF Rabbit Polyclonal Antibody

PTPRF Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

PTPRF Polyclonal Antibody
ES11149-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PTPRF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
PTPRF Polyclonal Antibody
ABP60038-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PTPRF protein
  • Applications tips:
Description: A polyclonal antibody for detection of PTPRF from Human, Mouse, Rat. This PTPRF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRF protein
PTPRF Polyclonal Antibody
ABP60038-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PTPRF protein
  • Applications tips:
Description: A polyclonal antibody for detection of PTPRF from Human, Mouse, Rat. This PTPRF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRF protein
PTPRF Polyclonal Antibody
ABP60038-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PTPRF protein
  • Applications tips:
Description: A polyclonal antibody for detection of PTPRF from Human, Mouse, Rat. This PTPRF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRF protein
PTPRF Polyclonal Antibody
30653-100ul 100ul
EUR 252
PTPRF Polyclonal Antibody
30653-50ul 50ul
EUR 187
PTPRF Rabbit pAb
A5444-100ul 100 ul
EUR 308
PTPRF Rabbit pAb
A5444-200ul 200 ul
EUR 459
PTPRF Rabbit pAb
A5444-20ul 20 ul
EUR 183
PTPRF Rabbit pAb
A5444-50ul 50 ul
EUR 223
PTPRF Polyclonal Conjugated Antibody
C30653 100ul
EUR 397
PTPRF Antibody
1-CSB-PA019053LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPRF. Recognizes PTPRF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
PTPRF/LAR Antibody
48223-100ul 100ul
EUR 333
PTPRF/LAR Antibody
48223-50ul 50ul
EUR 239
Anti-PTPRF antibody
STJ27397 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains three Ig-like domains, and nine non-Ig like domains similar to that of neural-cell adhesion molecule. This PTP was shown to function in the regulation of epithelial cell-cell contacts at adherents junctions, as well as in the control of beta-catenin signaling. An increased expression level of this protein was found in the insulin-responsive tissue of obese, insulin-resistant individuals, and may contribute to the pathogenesis of insulin resistance. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported.
Anti-PTPRF antibody
STJ192307 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PTPRF
Ptprf/ Rat Ptprf ELISA Kit
ELI-35865r 96 Tests
EUR 886
PTPRF siRNA
20-abx904376
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PTPRF siRNA
20-abx930403
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PTPRF siRNA
20-abx930404
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-PTPRF
YF-PA14212 50 ug
EUR 363
Description: Mouse polyclonal to PTPRF
anti-PTPRF
YF-PA24523 50 ul
EUR 334
Description: Mouse polyclonal to PTPRF
PTPRF/LAR Conjugated Antibody
C48223 100ul
EUR 397
PTPRF Antibody, HRP conjugated
1-CSB-PA019053LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPRF. Recognizes PTPRF from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
PTPRF Antibody, FITC conjugated
1-CSB-PA019053LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPRF. Recognizes PTPRF from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
PTPRF Antibody, Biotin conjugated
1-CSB-PA019053LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPRF. Recognizes PTPRF from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Anti-LAR/PTPRF Antibody
PB9786 100ug/vial
EUR 334
PTPRF cloning plasmid
CSB-CL019053HU1-10ug 10ug
EUR 406
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1062
  • Sequence: atggcccctgagccagccccagggaggacgatggtgccccttgtgcctgcactggtgatgcttggtttggtggcaggcgcccatggtgacagcaaacctgtcttcattaaagtccctgaggaccagactgggctgtcaggaggggtagcctccttcgtgtgccaagctacaggag
  • Show more
Description: A cloning plasmid for the PTPRF gene.
PTPRF cloning plasmid
CSB-CL019053HU2-10ug 10ug
EUR 402
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1044
  • Sequence: atggcccctgagccagccccagggaggacgatggtgccccttgtgcctgcactggtgatgcttggtttggtggcaggcgcccatggtgacagcaaacctgtcttcattaaagtccctgaggaccagactgggctgtcaggaggggtagcctccttcgtgtgccaagctacaggag
  • Show more
Description: A cloning plasmid for the PTPRF gene.
Monoclonal antibody for LAR/PTPRF
SMC-443D 0.1mg
EUR 353
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is not conjugated.
Monoclonal antibody for LAR/PTPRF
SMC-443D-A390 0.1mg
EUR 400
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 390.
Monoclonal antibody for LAR/PTPRF
SMC-443D-A488 0.1mg
EUR 399
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 488.
Monoclonal antibody for LAR/PTPRF
SMC-443D-A565 0.1mg
EUR 399
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 565.
Monoclonal antibody for LAR/PTPRF
SMC-443D-A594 0.1mg
EUR 399
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 594.
Monoclonal antibody for LAR/PTPRF
SMC-443D-A633 0.1mg
EUR 399
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 633.
Monoclonal antibody for LAR/PTPRF
SMC-443D-A655 0.1mg
EUR 399
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 655.
Monoclonal antibody for LAR/PTPRF
SMC-443D-A680 0.1mg
EUR 399
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 680.
Monoclonal antibody for LAR/PTPRF
SMC-443D-A700 0.1mg
EUR 399
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 700.
Monoclonal antibody for LAR/PTPRF
SMC-443D-ALP 0.1mg
EUR 393
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Alkaline Phosphatase.
Monoclonal antibody for LAR/PTPRF
SMC-443D-APC 0.1mg
EUR 398
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with APC.
Monoclonal antibody for LAR/PTPRF
SMC-443D-APCCY7 0.1mg
EUR 470
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with APC/Cy7.
Monoclonal antibody for LAR/PTPRF
SMC-443D-BI 0.1mg
EUR 395
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Biotin.
Monoclonal antibody for LAR/PTPRF
SMC-443D-DY350 0.1mg
EUR 413
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Dylight 350.
Monoclonal antibody for LAR/PTPRF
SMC-443D-DY405 0.1mg
EUR 402
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Dylight 405.
Monoclonal antibody for LAR/PTPRF
SMC-443D-DY488 0.1mg
EUR 392
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Dylight 488.
Monoclonal antibody for LAR/PTPRF
SMC-443D-DY594 0.1mg
EUR 394
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Dylight 594.
Monoclonal antibody for LAR/PTPRF
SMC-443D-DY633 0.1mg
EUR 389
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Dylight 633.
Monoclonal antibody for LAR/PTPRF
SMC-443D-FITC 0.1mg
EUR 391
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with FITC.
Monoclonal antibody for LAR/PTPRF
SMC-443D-HRP 0.1mg
EUR 387
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with HRP.
Monoclonal antibody for LAR/PTPRF
SMC-443D-P594 0.1mg
EUR 406
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with PE/ATTO 594.
Monoclonal antibody for LAR/PTPRF
SMC-443D-PCP 0.1mg
EUR 398
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse | Rat LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with PerCP.
Monoclonal antibody for LAR/PTPRF
SMC-443D-RPE 0.1mg
EUR 396
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse | Rat LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with RPE.
Monoclonal antibody for LAR/PTPRF
SMC-443D-STR 0.1mg
EUR 397
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse | Rat LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Streptavidin.
Monoclonal antibody for LAR/PTPRF
SMC-443S 0.012mg
EUR 65
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse | Rat LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is not conjugated.
Protein tyrosine phosphatase receptor type F (PTPRF) polyclonal antibody
ABP-PAB-10764 100 ug Ask for price
    • Product line: Phosphatases
    • Brand:
Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human)
4-PAC261Hu01
  • EUR 261.00
  • EUR 2734.00
  • EUR 676.00
  • EUR 330.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRF (Asp30~Tyr224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF)
Rat PTPRF shRNA Plasmid
20-abx990034
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human PTPRF ELISA KIT
ELI-22167h 96 Tests
EUR 824
Human PTPRF ELISA Kit
ELA-E9599h 96 Tests
EUR 824
PTPRF ELISA KIT|Human
EF006526 96 Tests
EUR 689
Mouse Ptprf ELISA KIT
ELI-35908m 96 Tests
EUR 865
Bovine PTPRF ELISA KIT
ELI-30529b 96 Tests
EUR 928
Human PTPRF shRNA Plasmid
20-abx953914
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse PTPRF shRNA Plasmid
20-abx972304
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), APC
4-PAC261Hu01-APC
  • EUR 367.00
  • EUR 3581.00
  • EUR 989.00
  • EUR 470.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRF (Asp30~Tyr224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with APC.
Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), Biotinylated
4-PAC261Hu01-Biotin
  • EUR 327.00
  • EUR 2684.00
  • EUR 783.00
  • EUR 403.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRF (Asp30~Tyr224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with Biotin.
Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), Cy3
4-PAC261Hu01-Cy3
  • EUR 447.00
  • EUR 4733.00
  • EUR 1277.00
  • EUR 585.00
  • EUR 263.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRF (Asp30~Tyr224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with Cy3.
Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), FITC
4-PAC261Hu01-FITC
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRF (Asp30~Tyr224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with FITC.
Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), HRP
4-PAC261Hu01-HRP
  • EUR 334.00
  • EUR 3120.00
  • EUR 873.00
  • EUR 424.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRF (Asp30~Tyr224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with HRP.
Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), PE
4-PAC261Hu01-PE
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRF (Asp30~Tyr224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with PE.
PTPRF Interacting Protein Alpha 3 (PPFIA3) Antibody
20-abx124437
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
PTPRF Interacting Protein Alpha 3 (PPFIA3) Antibody
20-abx114880
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
PTPRF Interacting Protein Alpha 3 (PPFIA3) Antibody
abx236671-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
PTPRF ORF Vector (Human) (pORF)
ORF008410 1.0 ug DNA
EUR 95
PTPRF ORF Vector (Human) (pORF)
ORF008411 1.0 ug DNA
EUR 95
Ptprf ORF Vector (Rat) (pORF)
ORF074329 1.0 ug DNA
EUR 2080
Ptprf ORF Vector (Mouse) (pORF)
ORF055243 1.0 ug DNA
EUR 1572
PTPRF ELISA Kit (Human) (OKAN05983)
OKAN05983 96 Wells
EUR 792
Description: Description of target: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains three Ig-like domains, and nine non-Ig like domains similar to that of neural-cell adhesion molecule. This PTP was shown to function in the regulation of epithelial cell-cell contacts at adherents junctions, as well as in the control of beta-catenin signaling. An increased expression level of this protein was found in the insulin-responsive tissue of obese, insulin-resistant individuals, and may contribute to the pathogenesis of insulin resistance. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.31 ng/mL
PTPRF ELISA Kit (Human) (OKCD08060)
OKCD08060 96 Wells
EUR 975
Description: Description of target: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains three Ig-like domains, and nine non-Ig like domains similar to that of neural-cell adhesion molecule. This PTP was shown to function in the regulation of epithelial cell-cell contacts at adherents junctions, as well as in the control of beta-catenin signaling. An increased expression level of this protein was found in the insulin-responsive tissue of obese, insulin-resistant individuals, and may contribute to the pathogenesis of insulin resistance. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.31ng/mL
PTPRF ELISA Kit (Mouse) (OKEH04975)
OKEH04975 96 Wells
EUR 727
Description: Description of target: Possible cell adhesion receptor. It possesses an intrinsic protein tyrosine phosphatase activity (PTPase) and dephosphorylates EPHA2 regulating its activity.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.782 ng/mL
PTPRF ELISA Kit (Rat) (OKEH05941)
OKEH05941 96 Wells
EUR 727
Description: Description of target: Possible cell adhesion receptor. It possesses an intrinsic protein tyrosine phosphatase activity (PTPase) and dephosphorylates EPHA2 regulating its activity.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.783 ng/mL
Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), APC-Cy7
4-PAC261Hu01-APC-Cy7
  • EUR 614.00
  • EUR 7042.00
  • EUR 1858.00
  • EUR 821.00
  • EUR 337.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRF (Asp30~Tyr224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with APC-Cy7.
Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Antibody
20-abx131516
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody
20-abx006780
  • EUR 411.00
  • EUR 105.00
  • EUR 592.00
  • EUR 182.00
  • 100 ul
  • 10 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Antibody
20-abx334095
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody
abx445054-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.
PTPRF sgRNA CRISPR Lentivector set (Human)
K1757901 3 x 1.0 ug
EUR 339
Ptprf sgRNA CRISPR Lentivector set (Rat)
K7232801 3 x 1.0 ug
EUR 339
Ptprf sgRNA CRISPR Lentivector set (Mouse)
K3790301 3 x 1.0 ug
EUR 339
Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Antibody (HRP)
20-abx337450
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Antibody (FITC)
20-abx337451
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Antibody (Biotin)
20-abx337452
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ALP)
abx442451-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (APC)
abx442732-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (Biotin)
abx443012-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (FITC)
abx443292-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (HRP)
abx443573-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (PerCP)
abx444135-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (RPE)
abx444416-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (Streptavidin)
abx444697-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
PTPRF(His tagged) / LAR(His tagged)-100
AR09-P0002-100 100ug
EUR 718
PTPRF(His tagged) / LAR(His tagged)-25
AR09-P0002-25 25ug
EUR 289
PTPRF(His tagged) / LAR(His tagged)-50
AR09-P0002-50 50ug
EUR 431
PTPRF sgRNA CRISPR Lentivector (Human) (Target 1)
K1757902 1.0 ug DNA
EUR 154
PTPRF sgRNA CRISPR Lentivector (Human) (Target 2)
K1757903 1.0 ug DNA
EUR 154
PTPRF sgRNA CRISPR Lentivector (Human) (Target 3)
K1757904 1.0 ug DNA
EUR 154
Ptprf sgRNA CRISPR Lentivector (Rat) (Target 1)
K7232802 1.0 ug DNA
EUR 154
Ptprf sgRNA CRISPR Lentivector (Rat) (Target 2)
K7232803 1.0 ug DNA
EUR 154
Ptprf sgRNA CRISPR Lentivector (Rat) (Target 3)
K7232804 1.0 ug DNA
EUR 154
Ptprf sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3790302 1.0 ug DNA
EUR 154
Ptprf sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3790303 1.0 ug DNA
EUR 154
Ptprf sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3790304 1.0 ug DNA
EUR 154
PTPRF Protein Vector (Human) (pPB-C-His)
PV033637 500 ng
EUR 329
PTPRF Protein Vector (Human) (pPB-N-His)
PV033638 500 ng
EUR 329
PTPRF Protein Vector (Human) (pPM-C-HA)
PV033639 500 ng
EUR 329
PTPRF Protein Vector (Human) (pPM-C-His)
PV033640 500 ng
EUR 329
PTPRF Protein Vector (Human) (pPB-C-His)
PV033641 500 ng
EUR 329
PTPRF Protein Vector (Human) (pPB-N-His)
PV033642 500 ng
EUR 329
PTPRF Protein Vector (Human) (pPM-C-HA)
PV033643 500 ng
EUR 329
PTPRF Protein Vector (Human) (pPM-C-His)
PV033644 500 ng
EUR 329
PTPRF Protein Vector (Rat) (pPB-C-His)
PV297314 500 ng
EUR 3144
PTPRF Protein Vector (Rat) (pPB-N-His)
PV297315 500 ng
EUR 3144
PTPRF Protein Vector (Rat) (pPM-C-HA)
PV297316 500 ng
EUR 3144
PTPRF Protein Vector (Rat) (pPM-C-His)
PV297317 500 ng
EUR 3144
PTPRF Protein Vector (Mouse) (pPB-C-His)
PV220970 500 ng
EUR 3144
PTPRF Protein Vector (Mouse) (pPB-N-His)
PV220971 500 ng
EUR 3144
PTPRF Protein Vector (Mouse) (pPM-C-HA)
PV220972 500 ng
EUR 3144
PTPRF Protein Vector (Mouse) (pPM-C-His)
PV220973 500 ng
EUR 3144
Ptprf 3'UTR GFP Stable Cell Line
TU167291 1.0 ml Ask for price
PTPRF 3'UTR Luciferase Stable Cell Line
TU019224 1.0 ml
EUR 1521
Ptprf 3'UTR Luciferase Stable Cell Line
TU117291 1.0 ml Ask for price
PTPRF 3'UTR GFP Stable Cell Line
TU069224 1.0 ml
EUR 1521
Ptprf 3'UTR GFP Stable Cell Line
TU267084 1.0 ml Ask for price
Ptprf 3'UTR Luciferase Stable Cell Line
TU217084 1.0 ml Ask for price
PTPRF ELISA Kit (Human) : 96 Wells (OKEH01983)
OKEH01983 96 Wells
EUR 727
Description: Description of target: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains three Ig-like domains, and nine non-Ig like domains similar to that of neural-cell adhesion molecule. This PTP was shown to function in the regulation of epithelial cell-cell contacts at adherents junctions, as well as in the control of beta-catenin signaling. An increased expression level of this protein was found in the insulin-responsive tissue of obese, insulin-resistant individuals, and may contribute to the pathogenesis of insulin resistance. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.43 ng/mL
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ATTO 390)
abx440203-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ATTO 488)
abx440484-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ATTO 565)
abx440765-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ATTO 594)
abx441046-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ATTO 633)
abx441327-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ATTO 655)
abx441608-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ATTO 680)
abx441889-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ATTO 700)
abx442170-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ERK1 Rabbit Polyclonal Antibody
ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ERK1 Rabbit Polyclonal Antibody
ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
JAK1 Rabbit Polyclonal Antibody
ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
JAK2 Rabbit Polyclonal Antibody
ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

PTPRF Rabbit Polyclonal Antibody