FGGY Rabbit Polyclonal Antibody
FGGY Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
FGGY Polyclonal Antibody |
ES11426-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against FGGY from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
FGGY Polyclonal Antibody |
ABP58552-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human FGGY protein at amino acid sequence of 491-540
- Applications tips:
|
Description: A polyclonal antibody for detection of FGGY from Human. This FGGY antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FGGY protein at amino acid sequence of 491-540 |
FGGY Polyclonal Antibody |
ABP58552-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human FGGY protein at amino acid sequence of 491-540
- Applications tips:
|
Description: A polyclonal antibody for detection of FGGY from Human. This FGGY antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FGGY protein at amino acid sequence of 491-540 |
FGGY Polyclonal Antibody |
ABP58552-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human FGGY protein at amino acid sequence of 491-540
- Applications tips:
|
Description: A polyclonal antibody for detection of FGGY from Human. This FGGY antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FGGY protein at amino acid sequence of 491-540 |
FGGY Polyclonal Antibody |
28752-100ul |
SAB |
100ul |
EUR 252 |
FGGY Polyclonal Antibody |
28752-50ul |
SAB |
50ul |
EUR 187 |
FGGY Rabbit pAb |
A14904-100ul |
Abclonal |
100 ul |
EUR 308 |
FGGY Rabbit pAb |
A14904-200ul |
Abclonal |
200 ul |
EUR 459 |
FGGY Rabbit pAb |
A14904-20ul |
Abclonal |
20 ul |
EUR 183 |
FGGY Rabbit pAb |
A14904-50ul |
Abclonal |
50 ul |
EUR 223 |
FGGY Polyclonal Conjugated Antibody |
C28752 |
SAB |
100ul |
EUR 397 |
Fggy antibody |
70R-8778 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal Fggy antibody |
Polyclonal Fggy antibody - N-terminal region |
APR11909G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Fggy - N-terminal region. This antibody is tested and proven to work in the following applications: |
Anti-FGGY antibody |
STJ117104 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein that phosphorylates carbohydrates such as ribulose, ribitol, and L-arabinitol. Genome-wide association studies in some populations have found an association between polymorphisms in this gene and sporadic amyotrophic lateral sclerosis, but studies of other populations have not been able to replicate this association. Alternative splicing results in multiple transcript variants. |
Anti-FGGY antibody |
STJ192584 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to FGGY |
FGGY siRNA |
20-abx916860 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FGGY siRNA |
20-abx916861 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fggy Blocking Peptide |
33R-6678 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Fggy antibody, catalog no. 70R-8778 |
FGGY cloning plasmid |
CSB-CL853393HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1320
- Sequence: atgtggctggaccatcgagcagtcagtcaagttaacaggatcaatgagaccaagcacagtgtcctccagtacgtcgggggggtgatgtctgtggaaatgcaggccccgaaacttctgtggctgaaagagaacttgagagagatttgctgggataaggcgggacatttctttgatc
- Show more
|
Description: A cloning plasmid for the FGGY gene. |
FGGY cloning plasmid |
CSB-CL853393HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 759
- Sequence: atggggatcagcaaagacccgatttttgtaccaggcgtctgggggccttatttctcagccatggtacctgggttctggctgaatgaaggtggtcagagcgttactggaaaattgatagaccacatggtacaaggccatgctgcttttccagaactacaagtaaaggccacagccag
- Show more
|
Description: A cloning plasmid for the FGGY gene. |
Human FGGY Carbohydrate Kinase Domain Containing (FGGY) ELISA Kit |
abx384900-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse FGGY Carbohydrate Kinase Domain Containing (FGGY) ELISA Kit |
abx389281-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse FGGY shRNA Plasmid |
20-abx978434 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human FGGY shRNA Plasmid |
20-abx960616 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
FGGY Recombinant Protein (Human) |
RP012145 |
ABM |
100 ug |
Ask for price |
FGGY Recombinant Protein (Human) |
RP012148 |
ABM |
100 ug |
Ask for price |
FGGY Recombinant Protein (Rat) |
RP201371 |
ABM |
100 ug |
Ask for price |
FGGY Recombinant Protein (Mouse) |
RP134561 |
ABM |
100 ug |
Ask for price |
FGGY Recombinant Protein (Mouse) |
RP134564 |
ABM |
100 ug |
Ask for price |
FGGY ORF Vector (Human) (pORF) |
ORF004049 |
ABM |
1.0 ug DNA |
EUR 95 |
FGGY ORF Vector (Human) (pORF) |
ORF004050 |
ABM |
1.0 ug DNA |
EUR 95 |
Fggy ORF Vector (Rat) (pORF) |
ORF067125 |
ABM |
1.0 ug DNA |
EUR 506 |
Fggy ORF Vector (Mouse) (pORF) |
ORF044855 |
ABM |
1.0 ug DNA |
EUR 506 |
Fggy ORF Vector (Mouse) (pORF) |
ORF044856 |
ABM |
1.0 ug DNA |
EUR 506 |
FGGY sgRNA CRISPR Lentivector set (Human) |
K0780701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Fggy sgRNA CRISPR Lentivector set (Mouse) |
K4105601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Fggy sgRNA CRISPR Lentivector set (Rat) |
K7423001 |
ABM |
3 x 1.0 ug |
EUR 339 |
FGGY Rabbit Polyclonal Antibody