FGGY Rabbit Polyclonal Antibody

FGGY Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

FGGY Polyclonal Antibody
28752-50ul 50ul
EUR 187
FGGY Polyclonal Antibody
ABP58552-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human FGGY protein at amino acid sequence of 491-540
  • Applications tips:
Description: A polyclonal antibody for detection of FGGY from Human. This FGGY antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FGGY protein at amino acid sequence of 491-540
FGGY Polyclonal Antibody
ABP58552-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human FGGY protein at amino acid sequence of 491-540
  • Applications tips:
Description: A polyclonal antibody for detection of FGGY from Human. This FGGY antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FGGY protein at amino acid sequence of 491-540
FGGY Polyclonal Antibody
ABP58552-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FGGY protein at amino acid sequence of 491-540
  • Applications tips:
Description: A polyclonal antibody for detection of FGGY from Human. This FGGY antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FGGY protein at amino acid sequence of 491-540
FGGY Polyclonal Antibody
ES11426-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FGGY from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
FGGY Polyclonal Antibody
ES11426-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FGGY from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
FGGY Rabbit pAb
A14904-100ul 100 ul
EUR 308
FGGY Rabbit pAb
A14904-200ul 200 ul
EUR 459
FGGY Rabbit pAb
A14904-20ul 20 ul
EUR 183
FGGY Rabbit pAb
A14904-50ul 50 ul
EUR 223
FGGY Polyclonal Conjugated Antibody
C28752 100ul
EUR 397
Fggy antibody
70R-8778 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Fggy antibody
Polyclonal Fggy antibody - N-terminal region
APR11909G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Fggy - N-terminal region. This antibody is tested and proven to work in the following applications:
Anti-FGGY antibody
STJ117104 100 µl
EUR 277
Description: This gene encodes a protein that phosphorylates carbohydrates such as ribulose, ribitol, and L-arabinitol. Genome-wide association studies in some populations have found an association between polymorphisms in this gene and sporadic amyotrophic lateral sclerosis, but studies of other populations have not been able to replicate this association. Alternative splicing results in multiple transcript variants.
Anti-FGGY antibody
STJ192584 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FGGY
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PVT18905 2 ug
EUR 231
Fggy Blocking Peptide
33R-6678 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Fggy antibody, catalog no. 70R-8778
FGGY cloning plasmid
CSB-CL853393HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1320
  • Sequence: atgtggctggaccatcgagcagtcagtcaagttaacaggatcaatgagaccaagcacagtgtcctccagtacgtcgggggggtgatgtctgtggaaatgcaggccccgaaacttctgtggctgaaagagaacttgagagagatttgctgggataaggcgggacatttctttgatc
  • Show more
Description: A cloning plasmid for the FGGY gene.
FGGY cloning plasmid
CSB-CL853393HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 759
  • Sequence: atggggatcagcaaagacccgatttttgtaccaggcgtctgggggccttatttctcagccatggtacctgggttctggctgaatgaaggtggtcagagcgttactggaaaattgatagaccacatggtacaaggccatgctgcttttccagaactacaagtaaaggccacagccag
  • Show more
Description: A cloning plasmid for the FGGY gene.
Human FGGY Carbohydrate Kinase Domain Containing (FGGY) ELISA Kit
abx384900-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse FGGY Carbohydrate Kinase Domain Containing (FGGY) ELISA Kit
abx389281-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse Fggy ELISA KIT
ELI-26682m 96 Tests
EUR 865
EF004978 96 Tests
EUR 689
Mouse FGGY shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human FGGY shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ELI-47438h 96 Tests
EUR 824
FGGY Recombinant Protein (Human)
RP012145 100 ug Ask for price
FGGY Recombinant Protein (Human)
RP012148 100 ug Ask for price
FGGY Recombinant Protein (Rat)
RP201371 100 ug Ask for price
FGGY Recombinant Protein (Mouse)
RP134561 100 ug Ask for price
FGGY Recombinant Protein (Mouse)
RP134564 100 ug Ask for price
Fggy ORF Vector (Rat) (pORF)
ORF067125 1.0 ug DNA
EUR 506
FGGY ORF Vector (Human) (pORF)
ORF004049 1.0 ug DNA
EUR 95
FGGY ORF Vector (Human) (pORF)
ORF004050 1.0 ug DNA
EUR 95
Fggy ORF Vector (Mouse) (pORF)
ORF044855 1.0 ug DNA
EUR 506
Fggy ORF Vector (Mouse) (pORF)
ORF044856 1.0 ug DNA
EUR 506
Fggy sgRNA CRISPR Lentivector set (Rat)
K7423001 3 x 1.0 ug
EUR 339
FGGY sgRNA CRISPR Lentivector set (Human)
K0780701 3 x 1.0 ug
EUR 339
Fggy sgRNA CRISPR Lentivector set (Mouse)
K4105601 3 x 1.0 ug
EUR 339

FGGY Rabbit Polyclonal Antibody