FABP6 Rabbit Polyclonal Antibody

FABP6 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

FABP6 Polyclonal Antibody

ES11334-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FABP6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

FABP6 Rabbit pAb

A13491-100ul 100 ul
EUR 308

FABP6 Rabbit pAb

A13491-200ul 200 ul
EUR 459

FABP6 Rabbit pAb

A13491-20ul 20 ul
EUR 183

FABP6 Rabbit pAb

A13491-50ul 50 ul
EUR 223

FABP6 Rabbit pAb

A6906-100ul 100 ul
EUR 308

FABP6 Rabbit pAb

A6906-200ul 200 ul
EUR 459

FABP6 Rabbit pAb

A6906-20ul 20 ul
EUR 183

FABP6 Rabbit pAb

A6906-50ul 50 ul
EUR 223

Rabbit FABP6 ELISA Kit

ERTF0046 96Tests
EUR 521

Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit

DLR-FABP6-Hu-48T 48T
EUR 479
  • Should the Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fatty Acid Binding Protein 6, Ileal (FABP6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit

DLR-FABP6-Hu-96T 96T
EUR 621
  • Should the Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fatty Acid Binding Protein 6, Ileal (FABP6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit

DLR-FABP6-Mu-48T 48T
EUR 489
  • Should the Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit

DLR-FABP6-Mu-96T 96T
EUR 635
  • Should the Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit

RDR-FABP6-Hu-48Tests 48 Tests
EUR 500

Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit

RDR-FABP6-Hu-96Tests 96 Tests
EUR 692

Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit

RDR-FABP6-Mu-48Tests 48 Tests
EUR 511

Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit

RDR-FABP6-Mu-96Tests 96 Tests
EUR 709

Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit

RD-FABP6-Hu-48Tests 48 Tests
EUR 478

Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit

RD-FABP6-Hu-96Tests 96 Tests
EUR 662

Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit

RD-FABP6-Mu-48Tests 48 Tests
EUR 489

Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit

RD-FABP6-Mu-96Tests 96 Tests
EUR 677

FABP6 Antibody

36456-100ul 100ul
EUR 252

FABP6 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FABP6. Recognizes FABP6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

FABP6 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FABP6. Recognizes FABP6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

FABP6 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FABP6. Recognizes FABP6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

FABP6 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FABP6. Recognizes FABP6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

FABP6 Antibody

ABC6906 100 ug
EUR 386

Rabbit Gastrotropin(FABP6) ELISA kit

E04G0406-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Gastrotropin(FABP6) ELISA kit

E04G0406-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Gastrotropin(FABP6) ELISA kit

E04G0406-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Gastrotropin, FABP6 ELISA KIT

ELI-07189Ra 96 Tests
EUR 928

Rabbit Gastrotropin (FABP6) ELISA Kit

abx363471-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

FABP6 Conjugated Antibody

C36456 100ul
EUR 397

Anti-FABP6 Antibody

PA2158 100ug/vial
EUR 334

Anti-FABP6 antibody

STJ28986 100 µl
EUR 277
Description: This gene encodes the ileal fatty acid binding protein. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABP6 and FABP1 (the liver fatty acid binding protein) are also able to bind bile acids. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. Transcript variants generated by alternate transcription promoters and/or alternate splicing have been found for this gene.

Anti-FABP6 antibody

STJ115452 100 µl
EUR 277
Description: This gene encodes the ileal fatty acid binding protein. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABP6 and FABP1 (the liver fatty acid binding protein) are also able to bind bile acids. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. Transcript variants generated by alternate transcription promoters and/or alternate splicing have been found for this gene.

Anti-FABP6 antibody

STJ192492 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FABP6

Polyclonal I-BABP / FABP6 Antibody (aa1-142)

APR07907G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human I-BABP / FABP6 (aa1-142). This antibody is tested and proven to work in the following applications:


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA11689 50 ug
EUR 363
Description: Mouse polyclonal to FABP6


YF-PA11690 100 ug
EUR 403
Description: Rabbit polyclonal to FABP6

Human Gastrotropin (FABP6)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 41.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Gastrotropin(FABP6) expressed in E.coli

FABP6 cloning plasmid

CSB-CL007955HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 387
  • Sequence: atggctttcaccggcaagttcgagatggagagtgagaagaattatgatgagttcatgaagctccttgggatctccagcgatgtaatcgaaaaggcccacaacttcaagatcgtcacggaggtgcagcaggatgggcaggacttcacttggtcccagcactactacgggggccacac
  • Show more
Description: A cloning plasmid for the FABP6 gene.

Recombinant Human FABP6

P0126 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P51161
Description: Recombinant Human protein for FABP6

pBluescriptR-FABP6 Plasmid

PVT17004 2 ug
EUR 325

Anti-FABP6 (4A4)

YF-MA12949 100 ug
EUR 363
Description: Mouse monoclonal to FABP6

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Human)

  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fatty Acid Binding Protein 6, Ileal (FABP6)

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Mouse)

  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Glu10~Ala128)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fatty Acid Binding Protein 6, Ileal (FABP6)

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Pig)

  • EUR 259.00
  • EUR 2694.00
  • EUR 667.00
  • EUR 326.00
  • EUR 218.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Fatty Acid Binding Protein 6, Ileal (FABP6)

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Rat)

  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fatty Acid Binding Protein 6, Ileal (FABP6)

FABP6 protein (isoform 2)

30R-1189 100 ug
EUR 397
Description: Purified recombinant Human FABP6 protein (isoform 2)


EHF0046 96Tests
EUR 521


ELA-E2247h 96 Tests
EUR 824


EGTF0046 96Tests
EUR 521

Bovine FABP6 ELISA Kit

EBF0046 96Tests
EUR 521

Canine FABP6 ELISA Kit

ECF0046 96Tests
EUR 521

Chicken FABP6 ELISA Kit

ECKF0046 96Tests
EUR 521

Anserini FABP6 ELISA Kit

EAF0046 96Tests
EUR 521


EF006255 96 Tests
EUR 689

Rat FABP6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FABP6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse FABP6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EMF0046 96Tests
EUR 521


ERF0046 96Tests
EUR 521


ESF0046 96Tests
EUR 521

Monkey FABP6 ELISA Kit

EMKF0046 96Tests
EUR 521

Porcine FABP6 ELISA Kit

EPF0046 96Tests
EUR 521

FABP6 Recombinant Protein (Human)

RP011167 100 ug Ask for price

FABP6 Recombinant Protein (Rat)

RP200240 100 ug Ask for price

FABP6 Recombinant Protein (Mouse)

RP132698 100 ug Ask for price

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Rat), HRP

  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with HRP.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Rat), PE

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with PE.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Human), APC

  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with APC.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Human), Biotinylated

  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with Biotin.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Human), Cy3

  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with Cy3.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Human), FITC

  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with FITC.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Human), HRP

  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with HRP.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Human), PE

  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with PE.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Mouse), APC

  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Glu10~Ala128)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with APC.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Glu10~Ala128)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with Biotin.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Mouse), Cy3

  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Glu10~Ala128)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with Cy3.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Mouse), FITC

  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Glu10~Ala128)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with FITC.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Mouse), HRP

  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Glu10~Ala128)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with HRP.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Mouse), PE

  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Glu10~Ala128)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with PE.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Pig), APC

  • EUR 363.00
  • EUR 3527.00
  • EUR 975.00
  • EUR 465.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with APC.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Pig), Biotinylated

  • EUR 324.00
  • EUR 2644.00
  • EUR 773.00
  • EUR 399.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with Biotin.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Pig), Cy3

  • EUR 443.00
  • EUR 4661.00
  • EUR 1259.00
  • EUR 578.00
  • EUR 260.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with Cy3.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Pig), FITC

  • EUR 310.00
  • EUR 2841.00
  • EUR 800.00
  • EUR 392.00
  • EUR 201.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with FITC.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Pig), HRP

  • EUR 331.00
  • EUR 3073.00
  • EUR 862.00
  • EUR 419.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with HRP.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Pig), PE

  • EUR 310.00
  • EUR 2841.00
  • EUR 800.00
  • EUR 392.00
  • EUR 201.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with PE.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Rat), APC

  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with APC.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Rat), Biotinylated

  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with Biotin.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Rat), Cy3

  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with Cy3.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Rat), FITC

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with FITC.

Rat Gastrotropin(FABP6) ELISA kit

E02G0406-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Gastrotropin(FABP6) ELISA kit

E02G0406-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Gastrotropin(FABP6) ELISA kit

E02G0406-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Gastrotropin(FABP6) ELISA kit

E03G0406-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Gastrotropin(FABP6) ELISA kit

E03G0406-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Gastrotropin(FABP6) ELISA kit

E03G0406-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Fabp6/ Gastrotropin ELISA Kit

E0495Mo 1 Kit
EUR 571

Human Gastrotropin(FABP6) ELISA kit

E01G0406-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Gastrotropin(FABP6) ELISA kit

E01G0406-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Gastrotropin(FABP6) ELISA kit

E01G0406-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Gastrotropin(FABP6) ELISA kit

E06G0406-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Gastrotropin(FABP6) ELISA kit

E06G0406-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Gastrotropin(FABP6) ELISA kit

E06G0406-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Gastrotropin (FABP6) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Gastrotropin (FABP6) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Gastrotropin (FABP6) ELISA Kit

abx255094-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Rat Gastrotropin (FABP6) ELISA Kit

abx256451-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Gastrotropin (FABP6) ELISA Kit

abx251521-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Monkey Gastrotropin(FABP6) ELISA kit

E09G0406-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Gastrotropin(FABP6) ELISA kit

E09G0406-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Gastrotropin(FABP6) ELISA kit

E09G0406-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human FABP6(Gastrotropin) ELISA Kit

EH2181 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P51161
  • Alias: FABP6/Gastrotropin/I-15P/IBABP/I-BAP/ILBP/ILBP3/ILLBP/fatty acid binding protein 6, ileal/Fatty acid-binding protein 6/gastrotropin/I-15PIntestinal 15 kDa protein/I-BABPIntestinal bile acid-bi
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Guinea Pig FABP6 ELISA Kit

EGF0046 96Tests
EUR 521

Dog Gastrotropin(FABP6) ELISA kit

E08G0406-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Gastrotropin(FABP6) ELISA kit

E08G0406-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Gastrotropin(FABP6) ELISA kit

E08G0406-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human FABP6/ Gastrotropin ELISA Kit

E0849Hu 1 Kit
EUR 571

Porcine Gastrotropin, FABP6 ELISA KIT

ELI-07186p 96 Tests
EUR 928

Rat Gastrotropin, Fabp6 ELISA KIT

ELI-07187r 96 Tests
EUR 886

Human Gastrotropin, FABP6 ELISA KIT

ELI-07188h 96 Tests
EUR 824

Mouse Gastrotropin, Fabp6 ELISA KIT

ELI-07190m 96 Tests
EUR 865

Bovine Gastrotropin, FABP6 ELISA KIT

ELI-07191b 96 Tests
EUR 928

Pig Gastrotropin(FABP6) ELISA kit

E07G0406-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Gastrotropin(FABP6) ELISA kit

E07G0406-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Gastrotropin(FABP6) ELISA kit

E07G0406-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Gastrotropin(FABP6) ELISA kit

CSB-EL007955HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Gastrotropin (FABP6) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Gastrotropin(FABP6) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Gastrotropin(FABP6) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Pig Gastrotropin (FABP6) ELISA Kit

abx360697-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Gastrotropin (FABP6) ELISA Kit

abx358946-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Gastrotropin (FABP6) ELISA Kit

abx355853-96tests 96 tests
EUR 864
  • Shipped within 5-12 working days.

Human Gastrotropin (FABP6) ELISA Kit

abx570078-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Gastrotropin (FABP6) ELISA Kit

  • EUR 6971.00
  • EUR 3714.00
  • EUR 864.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Mouse Gastrotropin (FABP6) ELISA Kit

abx576386-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Cow Gastrotropin (FABP6) ELISA Kit

abx519847-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Fabp6(Gastrotropin) ELISA Kit

EM0746 96T
EUR 524.1
  • Detection range: 78.125-5000 pg/ml
  • Uniprot ID: P51162
  • Alias: Fabp6/FABP6/Gastrotropin/I-15P/IBABP/I-BAP/ILBP/ILBP3/ILLBP/fatty acid binding protein 6, ileal/Fatty acid-binding protein 6/gastrotropin/I-15PIntestinal 15 kDa protein/I-BABPIntestinal bil
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 46.875pg/ml

Fabp6 ORF Vector (Rat) (pORF)

ORF066748 1.0 ug DNA
EUR 506

FABP6 ORF Vector (Human) (pORF)

ORF003723 1.0 ug DNA
EUR 95

Fabp6 ORF Vector (Mouse) (pORF)

ORF044234 1.0 ug DNA
EUR 506

FABP6 ELISA Kit (Human) (OKAN06378)

OKAN06378 96 Wells
EUR 792
Description: Description of target: This gene encodes the ileal fatty acid binding protein. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABP6 and FABP1 (the liver fatty acid binding protein) are also able to bind bile acids. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. Transcript variants generated by alternate transcription promoters and/or alternate splicing have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 26.9 pg/mL

FABP6 ELISA Kit (Rat) (OKCD02427)

OKCD02427 96 Wells
EUR 818
Description: Description of target: Binds to bile acids and is involved in enterohepatic bile acid metabolism. Required for efficient apical to basolateral transport of conjugated bile acids in ileal enterocytes. Stimulates gastric acid and pepsinogen secretion.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 27 pg/mL

FABP6 ELISA Kit (Human) (OKCA02274)

OKCA02274 96 Wells
EUR 846
Description: Description of target: Binds to bile acids and is involved in enterohepatic bile acid metabolism. Required for efficient apical to basolateral transport of conjugated bile acids in ileal enterocytes. In vitro binds to bile acids in the order: deoxycholic acid > cholic acid > chenodeoxycholic acid and respective BA conjugation modifies affinities in the order taurine-conjugated > glycine-conjugated > unconjugated bile acids. Stimulates gastric acid and pepsinogen secretion.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 0.078 ng/mL

FABP6 ELISA Kit (Human) (OKCD06251)

OKCD06251 96 Wells
EUR 753
Description: Description of target: FABP6 also called ileal fatty acid binding protein, is part of the small family of highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABP6 cytosolic protein binds bile acid. FABP6 plays a role in fatty acid uptake, transport, and metabolism. FABP6 stimulates gastric acid and pepsinogen secretion. seems to be able to bind to bile salts and bilirubins. FABP6 expression is restricted in the small intestine to the ileum where it is involved in the enterohepatic circulation of bile acids. Alternate transcription promoters generate 2 transcript variants, encoding a 128 aa and a 177 aa residue protein. Human FABP6 isoform 2 contains 128 amino acid residues and is acetylated on Ala2. FABP6 binds together fatty acids and bile acids and is directly involved in fatty acid transport and metabolism.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 26.9pg/mL

FABP6 ELISA Kit (Rat) (OKEH06964)

OKEH06964 96 Wells
EUR 662
Description: Description of target: Binds to bile acids and is involved in enterohepatic bile acid metabolism. Required for efficient apical to basolateral transport of conjugated bile acids in ileal enterocytes. Stimulates gastric acid and pepsinogen secretion.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.089 ng/mL

FABP6 ELISA Kit (Mouse) (OKEH01593)

OKEH01593 96 Wells
EUR 662
Description: Description of target: The protein encoded by this gene is part of the fatty acid binding protein family (FABP). FABPs are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands and participate in fatty acid uptake, transport, and metabolism. This protein functions within the ileum, the distal 25-30% of the small intestine, and plays a role in enterohepatic circulation of bile acids and cholesterol homeostasis. In humans, it has been reported that polymorphisms in FABP6 confer a protective effect in obese individuals from developing type 2 diabetes. In mice deficiency of this gene affects bile acid metabolism in a gender-specific manner and was reported to be required for efficient apical to basolateral transport of conjugated bile acids.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.4 pg/mL

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Human), APC-Cy7

  • EUR 527.00
  • EUR 5818.00
  • EUR 1552.00
  • EUR 698.00
  • EUR 301.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with APC-Cy7.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Glu10~Ala128)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with APC-Cy7.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Pig), APC-Cy7

  • EUR 607.00
  • EUR 6934.00
  • EUR 1831.00
  • EUR 810.00
  • EUR 333.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with APC-Cy7.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with APC-Cy7.

Human Fatty Acid-Binding Protein 6 (FABP6) Antibody

32182-05111 150 ug
EUR 261

Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody

  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody

abx145937-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody

  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody

  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Guinea pig Gastrotropin(FABP6) ELISA kit

E05G0406-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Gastrotropin(FABP6) ELISA kit

E05G0406-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Gastrotropin(FABP6) ELISA kit

E05G0406-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Gastrotropin (FABP6) ELISA Kit

abx358016-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

FABP6 sgRNA CRISPR Lentivector set (Human)

K0710401 3 x 1.0 ug
EUR 339

ELISA kit for Human Gastrotropin (FABP6)

KTE62397-48T 48T
EUR 332
  • Ileal lipid-binding protein (symbolized ILBP by Birkenmeier et al., 1994) is a member of a family of intracellular fatty acid, retinoid, and bile acid-binding proteins. This protein, with 128 residues in the mouse, is expressed only in differentiated
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Gastrotropin (FABP6) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Gastrotropin (FABP6)

KTE62397-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Ileal lipid-binding protein (symbolized ILBP by Birkenmeier et al., 1994) is a member of a family of intracellular fatty acid, retinoid, and bile acid-binding proteins. This protein, with 128 residues in the mouse, is expressed only in differentiated
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Gastrotropin (FABP6) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Gastrotropin (FABP6)

KTE62397-96T 96T
EUR 539
  • Ileal lipid-binding protein (symbolized ILBP by Birkenmeier et al., 1994) is a member of a family of intracellular fatty acid, retinoid, and bile acid-binding proteins. This protein, with 128 residues in the mouse, is expressed only in differentiated
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Gastrotropin (FABP6) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Fabp6 sgRNA CRISPR Lentivector set (Rat)

K6890201 3 x 1.0 ug
EUR 339

Fabp6 sgRNA CRISPR Lentivector set (Mouse)

K3343701 3 x 1.0 ug
EUR 339

Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody (FITC)

  • EUR 467.00
  • EUR 244.00
  • EUR 1386.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody (Biotin)

  • EUR 453.00
  • EUR 244.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody Pair

  • EUR 1706.00
  • EUR 1094.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody Pair

  • EUR 1622.00
  • EUR 1038.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

FABP6 Rabbit Polyclonal Antibody