FABP6 Rabbit Polyclonal Antibody

FABP6 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

FABP6 Polyclonal Antibody
ES11334-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against FABP6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

FABP6 Rabbit pAb
A13491-100ul	Abclonal	100 ul	EUR 308

FABP6 Rabbit pAb
A13491-200ul	Abclonal	200 ul	EUR 459

FABP6 Rabbit pAb
A13491-20ul	Abclonal	20 ul	EUR 183

FABP6 Rabbit pAb
A13491-50ul	Abclonal	50 ul	EUR 223

FABP6 Rabbit pAb
A6906-100ul	Abclonal	100 ul	EUR 308

FABP6 Rabbit pAb
A6906-200ul	Abclonal	200 ul	EUR 459

FABP6 Rabbit pAb
A6906-20ul	Abclonal	20 ul	EUR 183

FABP6 Rabbit pAb
A6906-50ul	Abclonal	50 ul	EUR 223

Rabbit FABP6 ELISA Kit
ERTF0046	Abclonal	96Tests	EUR 521

Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit
DLR-FABP6-Hu-48T	DL Develop	48T	EUR 479
Should the Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fatty Acid Binding Protein 6, Ileal (FABP6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit
DLR-FABP6-Hu-96T	DL Develop	96T	EUR 621
Should the Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fatty Acid Binding Protein 6, Ileal (FABP6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit
DLR-FABP6-Mu-48T	DL Develop	48T	EUR 489
Should the Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit
DLR-FABP6-Mu-96T	DL Develop	96T	EUR 635
Should the Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit
RDR-FABP6-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit
RDR-FABP6-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit
RDR-FABP6-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit
RDR-FABP6-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit
RD-FABP6-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit
RD-FABP6-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit
RD-FABP6-Mu-48Tests	Reddot Biotech	48 Tests	EUR 489

Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit
RD-FABP6-Mu-96Tests	Reddot Biotech	96 Tests	EUR 677

FABP6 Antibody
36456-100ul	SAB	100ul	EUR 252

FABP6 Antibody
1-CSB-PA706521	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FABP6. Recognizes FABP6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

FABP6 Antibody
1-CSB-PA170264	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FABP6. Recognizes FABP6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

FABP6 Antibody
1-CSB-PA007955ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FABP6. Recognizes FABP6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

FABP6 Antibody
1-CSB-PA007955ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FABP6. Recognizes FABP6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

FABP6 Antibody
ABC6906	Lifescience Market	100 ug	EUR 386

Rabbit Gastrotropin(FABP6) ELISA kit
E04G0406-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Gastrotropin(FABP6) ELISA kit
E04G0406-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Gastrotropin(FABP6) ELISA kit
E04G0406-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Gastrotropin, FABP6 ELISA KIT
ELI-07189Ra	Lifescience Market	96 Tests	EUR 928

Rabbit Gastrotropin (FABP6) ELISA Kit
abx363471-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

FABP6 Conjugated Antibody
C36456	SAB	100ul	EUR 397

Anti-FABP6 Antibody
PA2158	BosterBio	100ug/vial	EUR 334

Anti-FABP6 antibody
STJ28986	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes the ileal fatty acid binding protein. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABP6 and FABP1 (the liver fatty acid binding protein) are also able to bind bile acids. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. Transcript variants generated by alternate transcription promoters and/or alternate splicing have been found for this gene.

Anti-FABP6 antibody
STJ115452	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes the ileal fatty acid binding protein. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABP6 and FABP1 (the liver fatty acid binding protein) are also able to bind bile acids. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. Transcript variants generated by alternate transcription promoters and/or alternate splicing have been found for this gene.

Anti-FABP6 antibody
STJ192492	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to FABP6

Polyclonal I-BABP / FABP6 Antibody (aa1-142)
APR07907G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human I-BABP / FABP6 (aa1-142). This antibody is tested and proven to work in the following applications:

FABP6 siRNA
20-abx901820	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FABP6 siRNA
20-abx915919	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FABP6 siRNA
20-abx915920	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-FABP6
YF-PA11689	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to FABP6

anti-FABP6
YF-PA11690	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to FABP6

Human Gastrotropin (FABP6)
1-CSB-EP007955HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 41.4 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Gastrotropin(FABP6) expressed in E.coli

FABP6 cloning plasmid
CSB-CL007955HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 387 Sequence: atggctttcaccggcaagttcgagatggagagtgagaagaattatgatgagttcatgaagctccttgggatctccagcgatgtaatcgaaaaggcccacaacttcaagatcgtcacggaggtgcagcaggatgggcaggacttcacttggtcccagcactactacgggggccacac Show more
Description: A cloning plasmid for the FABP6 gene.

Recombinant Human FABP6
P0126	FN Test	100ug	EUR 522.36
Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose Reconstitution: Sterile distilled water Purity: Greater than 95% by SDS-PAGE gel analyses Uniprot ID: P51161
Description: Recombinant Human protein for FABP6

pBluescriptR-FABP6 Plasmid
PVT17004	Lifescience Market	2 ug	EUR 325

Anti-FABP6 (4A4)
YF-MA12949	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to FABP6

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Human)
4-PAA344Hu01	Cloud-Clone	EUR 232.00 EUR 2285.00 EUR 574.00 EUR 289.00 EUR 208.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FABP6 (Met1~Ala128) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fatty Acid Binding Protein 6, Ileal (FABP6)

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Mouse)
4-PAA344Mu01	Cloud-Clone	EUR 236.00 EUR 2338.00 EUR 586.00 EUR 294.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FABP6 (Glu10~Ala128) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fatty Acid Binding Protein 6, Ileal (FABP6)

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Pig)
4-PAA344Po01	Cloud-Clone	EUR 259.00 EUR 2694.00 EUR 667.00 EUR 326.00 EUR 218.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FABP6 (Met1~Ala128) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Fatty Acid Binding Protein 6, Ileal (FABP6)

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Rat)
4-PAA344Ra01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FABP6 (Met1~Ala128) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fatty Acid Binding Protein 6, Ileal (FABP6)

FABP6 protein (isoform 2)
30R-1189	Fitzgerald	100 ug	EUR 397
Description: Purified recombinant Human FABP6 protein (isoform 2)

Human FABP6 ELISA Kit
EHF0046	Abclonal	96Tests	EUR 521

Human FABP6 ELISA Kit
ELA-E2247h	Lifescience Market	96 Tests	EUR 824

Goat FABP6 ELISA Kit
EGTF0046	Abclonal	96Tests	EUR 521

Bovine FABP6 ELISA Kit
EBF0046	Abclonal	96Tests	EUR 521

Canine FABP6 ELISA Kit
ECF0046	Abclonal	96Tests	EUR 521

Chicken FABP6 ELISA Kit
ECKF0046	Abclonal	96Tests	EUR 521

Anserini FABP6 ELISA Kit
EAF0046	Abclonal	96Tests	EUR 521

FABP6 ELISA KIT|Human
EF006255	Lifescience Market	96 Tests	EUR 689

Rat FABP6 shRNA Plasmid
20-abx985027	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human FABP6 shRNA Plasmid
20-abx951512	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse FABP6 shRNA Plasmid
20-abx971050	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse FABP6 ELISA Kit
EMF0046	Abclonal	96Tests	EUR 521

Rat FABP6 ELISA Kit
ERF0046	Abclonal	96Tests	EUR 521

Sheep FABP6 ELISA Kit
ESF0046	Abclonal	96Tests	EUR 521

Monkey FABP6 ELISA Kit
EMKF0046	Abclonal	96Tests	EUR 521

Porcine FABP6 ELISA Kit
EPF0046	Abclonal	96Tests	EUR 521

FABP6 Recombinant Protein (Human)
RP011167	ABM	100 ug	Ask for price

FABP6 Recombinant Protein (Rat)
RP200240	ABM	100 ug	Ask for price

FABP6 Recombinant Protein (Mouse)
RP132698	ABM	100 ug	Ask for price

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Rat), HRP
4-PAA344Ra01-HRP	Cloud-Clone	EUR 311.00 EUR 2792.00 EUR 791.00 EUR 391.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FABP6 (Met1~Ala128) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with HRP.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Rat), PE
4-PAA344Ra01-PE	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FABP6 (Met1~Ala128) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with PE.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Human), APC
4-PAA344Hu01-APC	Cloud-Clone	EUR 323.00 EUR 2969.00 EUR 836.00 EUR 409.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FABP6 (Met1~Ala128) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with APC.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Human), Biotinylated
4-PAA344Hu01-Biotin	Cloud-Clone	EUR 295.00 EUR 2235.00 EUR 671.00 EUR 358.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FABP6 (Met1~Ala128) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with Biotin.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Human), Cy3
4-PAA344Hu01-Cy3	Cloud-Clone	EUR 390.00 EUR 3917.00 EUR 1073.00 EUR 504.00 EUR 239.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FABP6 (Met1~Ala128) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with Cy3.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Human), FITC
4-PAA344Hu01-FITC	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FABP6 (Met1~Ala128) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with FITC.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Human), HRP
4-PAA344Hu01-HRP	Cloud-Clone	EUR 297.00 EUR 2589.00 EUR 741.00 EUR 371.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FABP6 (Met1~Ala128) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with HRP.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Human), PE
4-PAA344Hu01-PE	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FABP6 (Met1~Ala128) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with PE.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Mouse), APC
4-PAA344Mu01-APC	Cloud-Clone	EUR 329.00 EUR 3041.00 EUR 854.00 EUR 416.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FABP6 (Glu10~Ala128) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with APC.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Mouse), Biotinylated
4-PAA344Mu01-Biotin	Cloud-Clone	EUR 299.00 EUR 2288.00 EUR 684.00 EUR 363.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FABP6 (Glu10~Ala128) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with Biotin.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Mouse), Cy3
4-PAA344Mu01-Cy3	Cloud-Clone	EUR 397.00 EUR 4013.00 EUR 1097.00 EUR 513.00 EUR 241.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FABP6 (Glu10~Ala128) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with Cy3.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Mouse), FITC
4-PAA344Mu01-FITC	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FABP6 (Glu10~Ala128) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with FITC.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Mouse), HRP
4-PAA344Mu01-HRP	Cloud-Clone	EUR 302.00 EUR 2652.00 EUR 756.00 EUR 377.00 EUR 200.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FABP6 (Glu10~Ala128) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with HRP.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Mouse), PE
4-PAA344Mu01-PE	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FABP6 (Glu10~Ala128) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with PE.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Pig), APC
4-PAA344Po01-APC	Cloud-Clone	EUR 363.00 EUR 3527.00 EUR 975.00 EUR 465.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FABP6 (Met1~Ala128) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with APC.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Pig), Biotinylated
4-PAA344Po01-Biotin	Cloud-Clone	EUR 324.00 EUR 2644.00 EUR 773.00 EUR 399.00 EUR 224.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FABP6 (Met1~Ala128) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with Biotin.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Pig), Cy3
4-PAA344Po01-Cy3	Cloud-Clone	EUR 443.00 EUR 4661.00 EUR 1259.00 EUR 578.00 EUR 260.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FABP6 (Met1~Ala128) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with Cy3.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Pig), FITC
4-PAA344Po01-FITC	Cloud-Clone	EUR 310.00 EUR 2841.00 EUR 800.00 EUR 392.00 EUR 201.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FABP6 (Met1~Ala128) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with FITC.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Pig), HRP
4-PAA344Po01-HRP	Cloud-Clone	EUR 331.00 EUR 3073.00 EUR 862.00 EUR 419.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FABP6 (Met1~Ala128) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with HRP.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Pig), PE
4-PAA344Po01-PE	Cloud-Clone	EUR 310.00 EUR 2841.00 EUR 800.00 EUR 392.00 EUR 201.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FABP6 (Met1~Ala128) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with PE.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Rat), APC
4-PAA344Ra01-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FABP6 (Met1~Ala128) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with APC.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Rat), Biotinylated
4-PAA344Ra01-Biotin	Cloud-Clone	EUR 307.00 EUR 2407.00 EUR 714.00 EUR 375.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FABP6 (Met1~Ala128) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with Biotin.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Rat), Cy3
4-PAA344Ra01-Cy3	Cloud-Clone	EUR 411.00 EUR 4229.00 EUR 1151.00 EUR 535.00 EUR 248.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FABP6 (Met1~Ala128) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with Cy3.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Rat), FITC
4-PAA344Ra01-FITC	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FABP6 (Met1~Ala128) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with FITC.

Rat Gastrotropin(FABP6) ELISA kit
E02G0406-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Gastrotropin(FABP6) ELISA kit
E02G0406-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Gastrotropin(FABP6) ELISA kit
E02G0406-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Gastrotropin(FABP6) ELISA kit
E03G0406-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Gastrotropin(FABP6) ELISA kit
E03G0406-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Gastrotropin(FABP6) ELISA kit
E03G0406-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Fabp6/ Gastrotropin ELISA Kit
E0495Mo	Sunlong	1 Kit	EUR 571

Human Gastrotropin(FABP6) ELISA kit
E01G0406-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Gastrotropin(FABP6) ELISA kit
E01G0406-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Gastrotropin(FABP6) ELISA kit
E01G0406-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Gastrotropin(FABP6) ELISA kit
E06G0406-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Gastrotropin(FABP6) ELISA kit
E06G0406-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Gastrotropin(FABP6) ELISA kit
E06G0406-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Gastrotropin (FABP6) ELISA Kit
20-abx155495	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Gastrotropin (FABP6) ELISA Kit
20-abx151476	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Gastrotropin (FABP6) ELISA Kit
abx255094-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Rat Gastrotropin (FABP6) ELISA Kit
abx256451-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Gastrotropin (FABP6) ELISA Kit
abx251521-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Monkey Gastrotropin(FABP6) ELISA kit
E09G0406-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Gastrotropin(FABP6) ELISA kit
E09G0406-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Gastrotropin(FABP6) ELISA kit
E09G0406-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human FABP6(Gastrotropin) ELISA Kit
EH2181	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: P51161 Alias: FABP6/Gastrotropin/I-15P/IBABP/I-BAP/ILBP/ILBP3/ILLBP/fatty acid binding protein 6, ileal/Fatty acid-binding protein 6/gastrotropin/I-15PIntestinal 15 kDa protein/I-BABPIntestinal bile acid-bi Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Guinea Pig FABP6 ELISA Kit
EGF0046	Abclonal	96Tests	EUR 521

Dog Gastrotropin(FABP6) ELISA kit
E08G0406-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Gastrotropin(FABP6) ELISA kit
E08G0406-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Gastrotropin(FABP6) ELISA kit
E08G0406-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human FABP6/ Gastrotropin ELISA Kit
E0849Hu	Sunlong	1 Kit	EUR 571

Porcine Gastrotropin, FABP6 ELISA KIT
ELI-07186p	Lifescience Market	96 Tests	EUR 928

Rat Gastrotropin, Fabp6 ELISA KIT
ELI-07187r	Lifescience Market	96 Tests	EUR 886

Human Gastrotropin, FABP6 ELISA KIT
ELI-07188h	Lifescience Market	96 Tests	EUR 824

Mouse Gastrotropin, Fabp6 ELISA KIT
ELI-07190m	Lifescience Market	96 Tests	EUR 865

Bovine Gastrotropin, FABP6 ELISA KIT
ELI-07191b	Lifescience Market	96 Tests	EUR 928

Pig Gastrotropin(FABP6) ELISA kit
E07G0406-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Gastrotropin(FABP6) ELISA kit
E07G0406-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Gastrotropin(FABP6) ELISA kit
E07G0406-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Gastrotropin(FABP6) ELISA kit
CSB-EL007955HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Gastrotropin (FABP6) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Gastrotropin(FABP6) ELISA kit
1-CSB-EL007955HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Gastrotropin(FABP6) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Pig Gastrotropin (FABP6) ELISA Kit
abx360697-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Monkey Gastrotropin (FABP6) ELISA Kit
abx358946-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Gastrotropin (FABP6) ELISA Kit
abx355853-96tests	Abbexa	96 tests	EUR 864
Shipped within 5-12 working days.

Human Gastrotropin (FABP6) ELISA Kit
abx570078-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Gastrotropin (FABP6) ELISA Kit
20-abx585318	Abbexa	EUR 6971.00 EUR 3714.00 EUR 864.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Mouse Gastrotropin (FABP6) ELISA Kit
abx576386-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Cow Gastrotropin (FABP6) ELISA Kit
abx519847-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Fabp6(Gastrotropin) ELISA Kit
EM0746	FN Test	96T	EUR 524.1
Detection range: 78.125-5000 pg/ml Uniprot ID: P51162 Alias: Fabp6/FABP6/Gastrotropin/I-15P/IBABP/I-BAP/ILBP/ILBP3/ILLBP/fatty acid binding protein 6, ileal/Fatty acid-binding protein 6/gastrotropin/I-15PIntestinal 15 kDa protein/I-BABPIntestinal bil Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 46.875pg/ml

Fabp6 ORF Vector (Rat) (pORF)
ORF066748	ABM	1.0 ug DNA	EUR 506

FABP6 ORF Vector (Human) (pORF)
ORF003723	ABM	1.0 ug DNA	EUR 95

Fabp6 ORF Vector (Mouse) (pORF)
ORF044234	ABM	1.0 ug DNA	EUR 506

FABP6 ELISA Kit (Human) (OKAN06378)
OKAN06378	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes the ileal fatty acid binding protein. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABP6 and FABP1 (the liver fatty acid binding protein) are also able to bind bile acids. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. Transcript variants generated by alternate transcription promoters and/or alternate splicing have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 26.9 pg/mL

FABP6 ELISA Kit (Rat) (OKCD02427)
OKCD02427	Aviva Systems Biology	96 Wells	EUR 818
Description: Description of target: Binds to bile acids and is involved in enterohepatic bile acid metabolism. Required for efficient apical to basolateral transport of conjugated bile acids in ileal enterocytes. Stimulates gastric acid and pepsinogen secretion.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 27 pg/mL

FABP6 ELISA Kit (Human) (OKCA02274)
OKCA02274	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: Binds to bile acids and is involved in enterohepatic bile acid metabolism. Required for efficient apical to basolateral transport of conjugated bile acids in ileal enterocytes. In vitro binds to bile acids in the order: deoxycholic acid > cholic acid > chenodeoxycholic acid and respective BA conjugation modifies affinities in the order taurine-conjugated > glycine-conjugated > unconjugated bile acids. Stimulates gastric acid and pepsinogen secretion.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 0.078 ng/mL

FABP6 ELISA Kit (Human) (OKCD06251)
OKCD06251	Aviva Systems Biology	96 Wells	EUR 753
Description: Description of target: FABP6 also called ileal fatty acid binding protein, is part of the small family of highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABP6 cytosolic protein binds bile acid. FABP6 plays a role in fatty acid uptake, transport, and metabolism. FABP6 stimulates gastric acid and pepsinogen secretion. seems to be able to bind to bile salts and bilirubins. FABP6 expression is restricted in the small intestine to the ileum where it is involved in the enterohepatic circulation of bile acids. Alternate transcription promoters generate 2 transcript variants, encoding a 128 aa and a 177 aa residue protein. Human FABP6 isoform 2 contains 128 amino acid residues and is acetylated on Ala2. FABP6 binds together fatty acids and bile acids and is directly involved in fatty acid transport and metabolism.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 26.9pg/mL

FABP6 ELISA Kit (Rat) (OKEH06964)
OKEH06964	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Binds to bile acids and is involved in enterohepatic bile acid metabolism. Required for efficient apical to basolateral transport of conjugated bile acids in ileal enterocytes. Stimulates gastric acid and pepsinogen secretion.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.089 ng/mL

FABP6 ELISA Kit (Mouse) (OKEH01593)
OKEH01593	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: The protein encoded by this gene is part of the fatty acid binding protein family (FABP). FABPs are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands and participate in fatty acid uptake, transport, and metabolism. This protein functions within the ileum, the distal 25-30% of the small intestine, and plays a role in enterohepatic circulation of bile acids and cholesterol homeostasis. In humans, it has been reported that polymorphisms in FABP6 confer a protective effect in obese individuals from developing type 2 diabetes. In mice deficiency of this gene affects bile acid metabolism in a gender-specific manner and was reported to be required for efficient apical to basolateral transport of conjugated bile acids.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.4 pg/mL

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Human), APC-Cy7
4-PAA344Hu01-APC-Cy7	Cloud-Clone	EUR 527.00 EUR 5818.00 EUR 1552.00 EUR 698.00 EUR 301.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FABP6 (Met1~Ala128) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with APC-Cy7.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Mouse), APC-Cy7
4-PAA344Mu01-APC-Cy7	Cloud-Clone	EUR 538.00 EUR 5962.00 EUR 1588.00 EUR 713.00 EUR 304.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FABP6 (Glu10~Ala128) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with APC-Cy7.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Pig), APC-Cy7
4-PAA344Po01-APC-Cy7	Cloud-Clone	EUR 607.00 EUR 6934.00 EUR 1831.00 EUR 810.00 EUR 333.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FABP6 (Met1~Ala128) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with APC-Cy7.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Rat), APC-Cy7
4-PAA344Ra01-APC-Cy7	Cloud-Clone	EUR 560.00 EUR 6286.00 EUR 1669.00 EUR 745.00 EUR 315.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FABP6 (Met1~Ala128) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with APC-Cy7.

Human Fatty Acid-Binding Protein 6 (FABP6) Antibody
32182-05111	AssayPro	150 ug	EUR 261

Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody
20-abx005249	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody
20-abx210827	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody
20-abx213315	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody
20-abx103821	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody
20-abx129074	Abbexa	EUR 398.00 EUR 133.00 EUR 1107.00 EUR 537.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody
20-abx129843	Abbexa	EUR 411.00 EUR 133.00 EUR 1135.00 EUR 551.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody
20-abx131116	Abbexa	EUR 453.00 EUR 133.00 EUR 1288.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody
abx145937-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody
20-abx172339	Abbexa	EUR 787.00 EUR 411.00	1 mg 200 ug
Please enquire.

Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody
20-abx172340	Abbexa	EUR 843.00 EUR 439.00	1 mg 200 ug
Please enquire.

Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody
20-abx320083	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody
20-abx322678	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Guinea pig Gastrotropin(FABP6) ELISA kit
E05G0406-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Gastrotropin(FABP6) ELISA kit
E05G0406-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Gastrotropin(FABP6) ELISA kit
E05G0406-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Gastrotropin (FABP6) ELISA Kit
abx358016-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

FABP6 sgRNA CRISPR Lentivector set (Human)
K0710401	ABM	3 x 1.0 ug	EUR 339

ELISA kit for Human Gastrotropin (FABP6)
KTE62397-48T	Abbkine	48T	EUR 332
Ileal lipid-binding protein (symbolized ILBP by Birkenmeier et al., 1994) is a member of a family of intracellular fatty acid, retinoid, and bile acid-binding proteins. This protein, with 128 residues in the mouse, is expressed only in differentiated Show more
Description: Quantitative sandwich ELISA for measuring Human Gastrotropin (FABP6) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Gastrotropin (FABP6)
KTE62397-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Ileal lipid-binding protein (symbolized ILBP by Birkenmeier et al., 1994) is a member of a family of intracellular fatty acid, retinoid, and bile acid-binding proteins. This protein, with 128 residues in the mouse, is expressed only in differentiated Show more
Description: Quantitative sandwich ELISA for measuring Human Gastrotropin (FABP6) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Gastrotropin (FABP6)
KTE62397-96T	Abbkine	96T	EUR 539
Ileal lipid-binding protein (symbolized ILBP by Birkenmeier et al., 1994) is a member of a family of intracellular fatty acid, retinoid, and bile acid-binding proteins. This protein, with 128 residues in the mouse, is expressed only in differentiated Show more
Description: Quantitative sandwich ELISA for measuring Human Gastrotropin (FABP6) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Fabp6 sgRNA CRISPR Lentivector set (Rat)
K6890201	ABM	3 x 1.0 ug	EUR 339

Fabp6 sgRNA CRISPR Lentivector set (Mouse)
K3343701	ABM	3 x 1.0 ug	EUR 339

Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody (FITC)
20-abx271092	Abbexa	EUR 467.00 EUR 244.00 EUR 1386.00 EUR 648.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody (Biotin)
20-abx271357	Abbexa	EUR 453.00 EUR 244.00 EUR 1288.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody Pair
20-abx370684	Abbexa	EUR 1706.00 EUR 1094.00	10 × 96 tests 5 × 96 tests
Shipped within 5-15 working days.

Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody Pair
20-abx370777	Abbexa	EUR 1622.00 EUR 1038.00	10 × 96 tests 5 × 96 tests
Shipped within 5-15 working days.

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

FABP6 Rabbit Polyclonal Antibody