FABP6 Rabbit Polyclonal Antibody
FABP6 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
FABP6 Polyclonal Antibody |
ABP58520-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human FABP6 protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of FABP6 from Human, Mouse, Rat. This FABP6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FABP6 protein at amino acid sequence of 30-110 |
FABP6 Rabbit pAb |
A13491-100ul |
Abclonal |
100 ul |
EUR 308 |
FABP6 Rabbit pAb |
A13491-200ul |
Abclonal |
200 ul |
EUR 459 |
FABP6 Rabbit pAb |
A13491-20ul |
Abclonal |
20 ul |
EUR 183 |
FABP6 Rabbit pAb |
A13491-50ul |
Abclonal |
50 ul |
EUR 223 |
FABP6 Rabbit pAb |
A6906-100ul |
Abclonal |
100 ul |
EUR 308 |
FABP6 Rabbit pAb |
A6906-200ul |
Abclonal |
200 ul |
EUR 459 |
FABP6 Rabbit pAb |
A6906-20ul |
Abclonal |
20 ul |
EUR 183 |
FABP6 Rabbit pAb |
A6906-50ul |
Abclonal |
50 ul |
EUR 223 |
Rabbit FABP6 ELISA Kit |
ERTF0046 |
Abclonal |
96Tests |
EUR 521 |
Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit |
DLR-FABP6-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Fatty Acid Binding Protein 6, Ileal (FABP6) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit |
DLR-FABP6-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Fatty Acid Binding Protein 6, Ileal (FABP6) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit |
DLR-FABP6-Mu-48T |
DL Develop |
48T |
EUR 489 |
- Should the Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit |
DLR-FABP6-Mu-96T |
DL Develop |
96T |
EUR 635 |
- Should the Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit |
RD-FABP6-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit |
RD-FABP6-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit |
RD-FABP6-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 489 |
Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit |
RD-FABP6-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 677 |
Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit |
RDR-FABP6-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit |
RDR-FABP6-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit |
RDR-FABP6-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit |
RDR-FABP6-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
FABP6 Antibody |
36456-100ul |
SAB |
100ul |
EUR 252 |
FABP6 Antibody |
1-CSB-PA007955ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against FABP6. Recognizes FABP6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
FABP6 Antibody |
1-CSB-PA007955ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against FABP6. Recognizes FABP6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200 |
FABP6 Antibody |
1-CSB-PA706521 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against FABP6. Recognizes FABP6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
FABP6 Antibody |
1-CSB-PA170264 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against FABP6. Recognizes FABP6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
Rabbit Gastrotropin (FABP6) ELISA Kit |
abx363471-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Gastrotropin(FABP6) ELISA kit |
E04G0406-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Gastrotropin(FABP6) ELISA kit |
E04G0406-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Gastrotropin(FABP6) ELISA kit |
E04G0406-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
FABP6 Conjugated Antibody |
C36456 |
SAB |
100ul |
EUR 397 |
Anti-FABP6 Antibody |
PA2158 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-FABP6 antibody |
STJ28986 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes the ileal fatty acid binding protein. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABP6 and FABP1 (the liver fatty acid binding protein) are also able to bind bile acids. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. Transcript variants generated by alternate transcription promoters and/or alternate splicing have been found for this gene. |
Anti-FABP6 antibody |
STJ115452 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes the ileal fatty acid binding protein. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABP6 and FABP1 (the liver fatty acid binding protein) are also able to bind bile acids. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. Transcript variants generated by alternate transcription promoters and/or alternate splicing have been found for this gene. |
Anti-FABP6 antibody |
STJ192492 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to FABP6 |
Polyclonal I-BABP / FABP6 Antibody (aa1-142) |
APR07907G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human I-BABP / FABP6 (aa1-142). This antibody is tested and proven to work in the following applications: |
FABP6 siRNA |
20-abx901820 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FABP6 siRNA |
20-abx915919 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FABP6 siRNA |
20-abx915920 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-FABP6 |
YF-PA11689 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to FABP6 |
anti-FABP6 |
YF-PA11690 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to FABP6 |
FABP6 cloning plasmid |
CSB-CL007955HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 387
- Sequence: atggctttcaccggcaagttcgagatggagagtgagaagaattatgatgagttcatgaagctccttgggatctccagcgatgtaatcgaaaaggcccacaacttcaagatcgtcacggaggtgcagcaggatgggcaggacttcacttggtcccagcactactacgggggccacac
- Show more
|
Description: A cloning plasmid for the FABP6 gene. |
Human Gastrotropin (FABP6) |
1-CSB-EP007955HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 41.4 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Gastrotropin(FABP6) expressed in E.coli |
Recombinant Human FABP6 |
P0126 |
FN Test |
100ug |
EUR 522.36 |
- Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
- Reconstitution: Sterile distilled water
- Purity: Greater than 95% by SDS-PAGE gel analyses
- Uniprot ID: P51161
|
Description: Recombinant Human protein for FABP6 |
Anti-FABP6 (4A4) |
YF-MA12949 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to FABP6 |
Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Human) |
4-PAA344Hu01 |
Cloud-Clone |
-
EUR 232.00
-
EUR 2285.00
-
EUR 574.00
-
EUR 289.00
-
EUR 208.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Met1~Ala128)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Fatty Acid Binding Protein 6, Ileal (FABP6) |
Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Mouse) |
4-PAA344Mu01 |
Cloud-Clone |
-
EUR 236.00
-
EUR 2338.00
-
EUR 586.00
-
EUR 294.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Glu10~Ala128)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) |
Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Pig) |
4-PAA344Po01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2694.00
-
EUR 667.00
-
EUR 326.00
-
EUR 218.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Met1~Ala128)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Pig Fatty Acid Binding Protein 6, Ileal (FABP6) |
Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Rat) |
4-PAA344Ra01 |
Cloud-Clone |
-
EUR 243.00
-
EUR 2457.00
-
EUR 613.00
-
EUR 305.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Met1~Ala128)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Fatty Acid Binding Protein 6, Ileal (FABP6) |
Rat FABP6 shRNA Plasmid |
20-abx985027 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human FABP6 ELISA Kit |
EHF0046 |
Abclonal |
96Tests |
EUR 521 |
Goat FABP6 ELISA Kit |
EGTF0046 |
Abclonal |
96Tests |
EUR 521 |
Canine FABP6 ELISA Kit |
ECF0046 |
Abclonal |
96Tests |
EUR 521 |
Chicken FABP6 ELISA Kit |
ECKF0046 |
Abclonal |
96Tests |
EUR 521 |
Bovine FABP6 ELISA Kit |
EBF0046 |
Abclonal |
96Tests |
EUR 521 |
Anserini FABP6 ELISA Kit |
EAF0046 |
Abclonal |
96Tests |
EUR 521 |
Porcine FABP6 ELISA Kit |
EPF0046 |
Abclonal |
96Tests |
EUR 521 |
Rat FABP6 ELISA Kit |
ERF0046 |
Abclonal |
96Tests |
EUR 521 |
Sheep FABP6 ELISA Kit |
ESF0046 |
Abclonal |
96Tests |
EUR 521 |
Mouse FABP6 ELISA Kit |
EMF0046 |
Abclonal |
96Tests |
EUR 521 |
Monkey FABP6 ELISA Kit |
EMKF0046 |
Abclonal |
96Tests |
EUR 521 |
Human FABP6 shRNA Plasmid |
20-abx951512 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
FABP6 protein (isoform 2) |
30R-1189 |
Fitzgerald |
100 ug |
EUR 397 |
Description: Purified recombinant Human FABP6 protein (isoform 2) |
Mouse FABP6 shRNA Plasmid |
20-abx971050 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
FABP6 Recombinant Protein (Human) |
RP011167 |
ABM |
100 ug |
Ask for price |
FABP6 Recombinant Protein (Rat) |
RP200240 |
ABM |
100 ug |
Ask for price |
FABP6 Recombinant Protein (Mouse) |
RP132698 |
ABM |
100 ug |
Ask for price |
Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Human), APC |
4-PAA344Hu01-APC |
Cloud-Clone |
-
EUR 323.00
-
EUR 2969.00
-
EUR 836.00
-
EUR 409.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Met1~Ala128)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with APC. |
Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Human), Biotinylated |
4-PAA344Hu01-Biotin |
Cloud-Clone |
-
EUR 295.00
-
EUR 2235.00
-
EUR 671.00
-
EUR 358.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Met1~Ala128)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with Biotin. |
Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Human), Cy3 |
4-PAA344Hu01-Cy3 |
Cloud-Clone |
-
EUR 390.00
-
EUR 3917.00
-
EUR 1073.00
-
EUR 504.00
-
EUR 239.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Met1~Ala128)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with Cy3. |
Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Human), FITC |
4-PAA344Hu01-FITC |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Met1~Ala128)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with FITC. |
Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Human), HRP |
4-PAA344Hu01-HRP |
Cloud-Clone |
-
EUR 297.00
-
EUR 2589.00
-
EUR 741.00
-
EUR 371.00
-
EUR 199.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Met1~Ala128)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with HRP. |
Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Human), PE |
4-PAA344Hu01-PE |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Met1~Ala128)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with PE. |
Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Mouse), APC |
4-PAA344Mu01-APC |
Cloud-Clone |
-
EUR 329.00
-
EUR 3041.00
-
EUR 854.00
-
EUR 416.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Glu10~Ala128)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with APC. |
Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Mouse), Biotinylated |
4-PAA344Mu01-Biotin |
Cloud-Clone |
-
EUR 299.00
-
EUR 2288.00
-
EUR 684.00
-
EUR 363.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Glu10~Ala128)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with Biotin. |
Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Mouse), Cy3 |
4-PAA344Mu01-Cy3 |
Cloud-Clone |
-
EUR 397.00
-
EUR 4013.00
-
EUR 1097.00
-
EUR 513.00
-
EUR 241.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Glu10~Ala128)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with Cy3. |
Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Mouse), FITC |
4-PAA344Mu01-FITC |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Glu10~Ala128)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with FITC. |
Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Mouse), HRP |
4-PAA344Mu01-HRP |
Cloud-Clone |
-
EUR 302.00
-
EUR 2652.00
-
EUR 756.00
-
EUR 377.00
-
EUR 200.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Glu10~Ala128)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with HRP. |
Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Mouse), PE |
4-PAA344Mu01-PE |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Glu10~Ala128)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with PE. |
Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Pig), APC |
4-PAA344Po01-APC |
Cloud-Clone |
-
EUR 363.00
-
EUR 3527.00
-
EUR 975.00
-
EUR 465.00
-
EUR 226.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Met1~Ala128)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Pig Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with APC. |
Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Pig), Biotinylated |
4-PAA344Po01-Biotin |
Cloud-Clone |
-
EUR 324.00
-
EUR 2644.00
-
EUR 773.00
-
EUR 399.00
-
EUR 224.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Met1~Ala128)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Pig Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with Biotin. |
Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Pig), Cy3 |
4-PAA344Po01-Cy3 |
Cloud-Clone |
-
EUR 443.00
-
EUR 4661.00
-
EUR 1259.00
-
EUR 578.00
-
EUR 260.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Met1~Ala128)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Pig Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with Cy3. |
Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Pig), FITC |
4-PAA344Po01-FITC |
Cloud-Clone |
-
EUR 310.00
-
EUR 2841.00
-
EUR 800.00
-
EUR 392.00
-
EUR 201.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Met1~Ala128)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Pig Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with FITC. |
Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Pig), HRP |
4-PAA344Po01-HRP |
Cloud-Clone |
-
EUR 331.00
-
EUR 3073.00
-
EUR 862.00
-
EUR 419.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Met1~Ala128)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Pig Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with HRP. |
Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Pig), PE |
4-PAA344Po01-PE |
Cloud-Clone |
-
EUR 310.00
-
EUR 2841.00
-
EUR 800.00
-
EUR 392.00
-
EUR 201.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Met1~Ala128)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Pig Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with PE. |
Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Rat), APC |
4-PAA344Ra01-APC |
Cloud-Clone |
-
EUR 340.00
-
EUR 3203.00
-
EUR 894.00
-
EUR 432.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Met1~Ala128)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with APC. |
Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Rat), Biotinylated |
4-PAA344Ra01-Biotin |
Cloud-Clone |
-
EUR 307.00
-
EUR 2407.00
-
EUR 714.00
-
EUR 375.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Met1~Ala128)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with Biotin. |
Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Rat), Cy3 |
4-PAA344Ra01-Cy3 |
Cloud-Clone |
-
EUR 411.00
-
EUR 4229.00
-
EUR 1151.00
-
EUR 535.00
-
EUR 248.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Met1~Ala128)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with Cy3. |
Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Rat), FITC |
4-PAA344Ra01-FITC |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Met1~Ala128)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with FITC. |
Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Rat), HRP |
4-PAA344Ra01-HRP |
Cloud-Clone |
-
EUR 311.00
-
EUR 2792.00
-
EUR 791.00
-
EUR 391.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Met1~Ala128)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with HRP. |
Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Rat), PE |
4-PAA344Ra01-PE |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Met1~Ala128)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with PE. |
Cow Gastrotropin (FABP6) ELISA Kit |
abx519847-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Gastrotropin (FABP6) ELISA Kit |
abx570078-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Pig Gastrotropin (FABP6) ELISA Kit |
abx360697-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Mouse Gastrotropin (FABP6) ELISA Kit |
20-abx585318 |
Abbexa |
-
EUR 6971.00
-
EUR 3714.00
-
EUR 864.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
Mouse Gastrotropin (FABP6) ELISA Kit |
abx576386-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Mouse Fabp6/ Gastrotropin ELISA Kit |
E0495Mo |
Sunlong |
1 Kit |
EUR 571 |
Goat Gastrotropin(FABP6) ELISA kit |
E06G0406-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Gastrotropin(FABP6) ELISA kit |
E06G0406-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Gastrotropin(FABP6) ELISA kit |
E06G0406-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Gastrotropin(FABP6) ELISA kit |
E02G0406-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Gastrotropin(FABP6) ELISA kit |
E02G0406-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Gastrotropin(FABP6) ELISA kit |
E02G0406-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Gastrotropin(FABP6) ELISA kit |
E03G0406-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Gastrotropin(FABP6) ELISA kit |
E03G0406-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Gastrotropin(FABP6) ELISA kit |
E03G0406-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Gastrotropin(FABP6) ELISA kit |
E01G0406-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Gastrotropin(FABP6) ELISA kit |
E01G0406-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Gastrotropin(FABP6) ELISA kit |
E01G0406-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human FABP6/ Gastrotropin ELISA Kit |
E0849Hu |
Sunlong |
1 Kit |
EUR 571 |
Guinea Pig FABP6 ELISA Kit |
EGF0046 |
Abclonal |
96Tests |
EUR 521 |
Dog Gastrotropin(FABP6) ELISA kit |
E08G0406-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Gastrotropin(FABP6) ELISA kit |
E08G0406-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Gastrotropin(FABP6) ELISA kit |
E08G0406-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Gastrotropin(FABP6) ELISA kit |
E07G0406-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Gastrotropin(FABP6) ELISA kit |
E07G0406-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Gastrotropin(FABP6) ELISA kit |
E07G0406-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Gastrotropin(FABP6) ELISA kit |
E09G0406-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Gastrotropin(FABP6) ELISA kit |
E09G0406-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Gastrotropin(FABP6) ELISA kit |
E09G0406-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human FABP6(Gastrotropin) ELISA Kit |
EH2181 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P51161
- Alias: FABP6/Gastrotropin/I-15P/IBABP/I-BAP/ILBP/ILBP3/ILLBP/fatty acid binding protein 6, ileal/Fatty acid-binding protein 6/gastrotropin/I-15PIntestinal 15 kDa protein/I-BABPIntestinal bile acid-bi
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Mouse Fabp6(Gastrotropin) ELISA Kit |
EM0746 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 78.125-5000 pg/ml
- Uniprot ID: P51162
- Alias: Fabp6/FABP6/Gastrotropin/I-15P/IBABP/I-BAP/ILBP/ILBP3/ILLBP/fatty acid binding protein 6, ileal/Fatty acid-binding protein 6/gastrotropin/I-15PIntestinal 15 kDa protein/I-BABPIntestinal bil
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 46.875pg/ml |
Rat Gastrotropin (FABP6) ELISA Kit |
20-abx155495 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Gastrotropin (FABP6) ELISA Kit |
20-abx151476 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Monkey Gastrotropin (FABP6) ELISA Kit |
abx358946-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Chicken Gastrotropin (FABP6) ELISA Kit |
abx355853-96tests |
Abbexa |
96 tests |
EUR 864 |
- Shipped within 5-12 working days.
|
Mouse Gastrotropin (FABP6) ELISA Kit |
abx255094-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Rat Gastrotropin (FABP6) ELISA Kit |
abx256451-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Gastrotropin (FABP6) ELISA Kit |
abx251521-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Gastrotropin(FABP6) ELISA kit |
CSB-EL007955HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Gastrotropin (FABP6) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Gastrotropin(FABP6) ELISA kit |
1-CSB-EL007955HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Gastrotropin(FABP6) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
FABP6 ORF Vector (Human) (pORF) |
ORF003723 |
ABM |
1.0 ug DNA |
EUR 95 |
Fabp6 ORF Vector (Rat) (pORF) |
ORF066748 |
ABM |
1.0 ug DNA |
EUR 506 |
Fabp6 ORF Vector (Mouse) (pORF) |
ORF044234 |
ABM |
1.0 ug DNA |
EUR 506 |
FABP6 ELISA Kit (Human) (OKAN06378) |
OKAN06378 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes the ileal fatty acid binding protein. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABP6 and FABP1 (the liver fatty acid binding protein) are also able to bind bile acids. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. Transcript variants generated by alternate transcription promoters and/or alternate splicing have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 26.9 pg/mL |
FABP6 ELISA Kit (Human) (OKCD06251) |
OKCD06251 |
Aviva Systems Biology |
96 Wells |
EUR 753 |
Description: Description of target: FABP6 also called ileal fatty acid binding protein, is part of the small family of highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABP6 cytosolic protein binds bile acid. FABP6 plays a role in fatty acid uptake, transport, and metabolism. FABP6 stimulates gastric acid and pepsinogen secretion. seems to be able to bind to bile salts and bilirubins. FABP6 expression is restricted in the small intestine to the ileum where it is involved in the enterohepatic circulation of bile acids. Alternate transcription promoters generate 2 transcript variants, encoding a 128 aa and a 177 aa residue protein. Human FABP6 isoform 2 contains 128 amino acid residues and is acetylated on Ala2. FABP6 binds together fatty acids and bile acids and is directly involved in fatty acid transport and metabolism.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 26.9pg/mL |
FABP6 ELISA Kit (Rat) (OKCD02427) |
OKCD02427 |
Aviva Systems Biology |
96 Wells |
EUR 818 |
Description: Description of target: Binds to bile acids and is involved in enterohepatic bile acid metabolism. Required for efficient apical to basolateral transport of conjugated bile acids in ileal enterocytes. Stimulates gastric acid and pepsinogen secretion.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 27 pg/mL |
FABP6 ELISA Kit (Human) (OKCA02274) |
OKCA02274 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: Binds to bile acids and is involved in enterohepatic bile acid metabolism. Required for efficient apical to basolateral transport of conjugated bile acids in ileal enterocytes. In vitro binds to bile acids in the order: deoxycholic acid > cholic acid > chenodeoxycholic acid and respective BA conjugation modifies affinities in the order taurine-conjugated > glycine-conjugated > unconjugated bile acids. Stimulates gastric acid and pepsinogen secretion.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 0.078 ng/mL |
FABP6 ELISA Kit (Mouse) (OKEH01593) |
OKEH01593 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: The protein encoded by this gene is part of the fatty acid binding protein family (FABP). FABPs are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands and participate in fatty acid uptake, transport, and metabolism. This protein functions within the ileum, the distal 25-30% of the small intestine, and plays a role in enterohepatic circulation of bile acids and cholesterol homeostasis. In humans, it has been reported that polymorphisms in FABP6 confer a protective effect in obese individuals from developing type 2 diabetes. In mice deficiency of this gene affects bile acid metabolism in a gender-specific manner and was reported to be required for efficient apical to basolateral transport of conjugated bile acids.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.4 pg/mL |
FABP6 ELISA Kit (Rat) (OKEH06964) |
OKEH06964 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Binds to bile acids and is involved in enterohepatic bile acid metabolism. Required for efficient apical to basolateral transport of conjugated bile acids in ileal enterocytes. Stimulates gastric acid and pepsinogen secretion.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.089 ng/mL |
Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Human), APC-Cy7 |
4-PAA344Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 527.00
-
EUR 5818.00
-
EUR 1552.00
-
EUR 698.00
-
EUR 301.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Met1~Ala128)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with APC-Cy7. |
Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAA344Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 538.00
-
EUR 5962.00
-
EUR 1588.00
-
EUR 713.00
-
EUR 304.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Glu10~Ala128)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with APC-Cy7. |
Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Pig), APC-Cy7 |
4-PAA344Po01-APC-Cy7 |
Cloud-Clone |
-
EUR 607.00
-
EUR 6934.00
-
EUR 1831.00
-
EUR 810.00
-
EUR 333.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Met1~Ala128)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Pig Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with APC-Cy7. |
Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAA344Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 560.00
-
EUR 6286.00
-
EUR 1669.00
-
EUR 745.00
-
EUR 315.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Met1~Ala128)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with APC-Cy7. |
Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody |
20-abx129074 |
Abbexa |
-
EUR 398.00
-
EUR 133.00
-
EUR 1107.00
-
EUR 537.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody |
20-abx129843 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1135.00
-
EUR 551.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody |
20-abx131116 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1288.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody |
abx145937-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody |
20-abx103821 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody |
20-abx005249 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody |
20-abx172339 |
Abbexa |
|
|
|
Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody |
20-abx172340 |
Abbexa |
|
|
|
Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody |
20-abx320083 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody |
20-abx322678 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody |
20-abx210827 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody |
20-abx213315 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human Fatty Acid-Binding Protein 6 (FABP6) Antibody |
32182-05111 |
AssayPro |
150 ug |
EUR 261 |
Guinea pig Gastrotropin(FABP6) ELISA kit |
E05G0406-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Gastrotropin(FABP6) ELISA kit |
E05G0406-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Gastrotropin(FABP6) ELISA kit |
E05G0406-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Gastrotropin (FABP6) ELISA Kit |
abx358016-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
FABP6 sgRNA CRISPR Lentivector set (Human) |
K0710401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Fabp6 sgRNA CRISPR Lentivector set (Mouse) |
K3343701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Fabp6 sgRNA CRISPR Lentivector set (Rat) |
K6890201 |
ABM |
3 x 1.0 ug |
EUR 339 |
ELISA kit for Human Gastrotropin (FABP6) |
KTE62397-48T |
Abbkine |
48T |
EUR 332 |
- Ileal lipid-binding protein (symbolized ILBP by Birkenmeier et al., 1994) is a member of a family of intracellular fatty acid, retinoid, and bile acid-binding proteins. This protein, with 128 residues in the mouse, is expressed only in differentiated
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Gastrotropin (FABP6) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Gastrotropin (FABP6) |
KTE62397-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Ileal lipid-binding protein (symbolized ILBP by Birkenmeier et al., 1994) is a member of a family of intracellular fatty acid, retinoid, and bile acid-binding proteins. This protein, with 128 residues in the mouse, is expressed only in differentiated
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Gastrotropin (FABP6) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Gastrotropin (FABP6) |
KTE62397-96T |
Abbkine |
96T |
EUR 539 |
- Ileal lipid-binding protein (symbolized ILBP by Birkenmeier et al., 1994) is a member of a family of intracellular fatty acid, retinoid, and bile acid-binding proteins. This protein, with 128 residues in the mouse, is expressed only in differentiated
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Gastrotropin (FABP6) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody Pair |
20-abx370684 |
Abbexa |
|
-
10 × 96 tests
-
5 × 96 tests
|
- Shipped within 5-15 working days.
|
Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody Pair |
20-abx370777 |
Abbexa |
|
-
10 × 96 tests
-
5 × 96 tests
|
- Shipped within 5-15 working days.
|
Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody (FITC) |
20-abx271092 |
Abbexa |
-
EUR 467.00
-
EUR 244.00
-
EUR 1386.00
-
EUR 648.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Fatty Acid Binding Protein 6, Ileal (FABP6) Antibody (Biotin) |
20-abx271357 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1288.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
FABP6 Rabbit Polyclonal Antibody