GFRA2 Rabbit Polyclonal Antibody

GFRA2 Rabbit Polyclonal Antibody

To Order Now:

GFRA2 Polyclonal Antibody
ABP58634-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human GFRA2 protein at amino acid sequence of 320-400
  • Applications tips:
Description: A polyclonal antibody for detection of GFRA2 from Human, Mouse. This GFRA2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GFRA2 protein at amino acid sequence of 320-400
GFRA2 Polyclonal Antibody
ABP58634-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GFRA2 protein at amino acid sequence of 320-400
  • Applications tips:
Description: A polyclonal antibody for detection of GFRA2 from Human, Mouse. This GFRA2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GFRA2 protein at amino acid sequence of 320-400
GFRA2 Polyclonal Antibody
ES11190-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GFRA2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
GFRA2 Polyclonal Antibody
ES11190-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GFRA2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
GFRA2 Rabbit pAb
A2954-100ul 100 ul
EUR 308
GFRA2 Rabbit pAb
A2954-200ul 200 ul
EUR 459
GFRA2 Rabbit pAb
A2954-20ul 20 ul
EUR 183
GFRA2 Rabbit pAb
A2954-50ul 50 ul
EUR 223
GFRA2 Antibody
31206-100ul 100ul
EUR 252
GFRA2 Antibody
31206-50ul 50ul
EUR 187
GFRA2 antibody
70R-17467 50 ul
EUR 435
Description: Rabbit polyclonal GFRA2 antibody
GFRA2 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000
GFRA2 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000
GFRA2 antibody
70R-5332 50 ug
EUR 467
Description: Rabbit polyclonal GFRA2 antibody raised against the C terminal of GFRA2
GFRA2 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: 0.1M NaHCO3, 0.1M Glycine, 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
GFRA2 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200
GFRA2 Conjugated Antibody
C31206 100ul
EUR 397
anti- GFRA2 antibody
FNab03438 100µg
EUR 585
  • Immunogen: GDNF family receptor alpha 2
  • Uniprot ID: O00451
  • Gene ID: 2675
  • Research Area: Neuroscience
Description: Antibody raised against GFRA2
anti- GFRA2 antibody
FNab03439 100µg
EUR 548.75
  • Immunogen: GDNF family receptor alpha 2
  • Uniprot ID: O00451
  • Gene ID: 2675
  • Research Area: Neuroscience
Description: Antibody raised against GFRA2
Anti-GFRA2 antibody
PAab03438 100 ug
EUR 412
Anti-GFRA2 antibody
PAab03439 100 ug
EUR 386
Anti-GFRA2 antibody
STJ23776 100 µl
EUR 277
Description: Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. The protein encoded by this gene is a member of the GDNF receptor family. It is a glycosylphosphatidylinositol(GPI)-linked cell surface receptor for both GDNF and NTN, and mediates activation of the RET tyrosine kinase receptor. This encoded protein acts preferentially as a receptor for NTN compared to its other family member, GDNF family receptor alpha 1. This gene is a candidate gene for RET-associated diseases. Multiple transcript variants encoding different isoforms have been found for this gene.
Anti-GFRA2 antibody
STJ192348 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GFRA2
Anti-GFRA2 Antibody
STJ60017 100 µg
EUR 424
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GFRA2 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
GFRA2 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
GFRA2 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
GFRA2 Blocking Peptide
33R-6924 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GFRA2 antibody, catalog no. 70R-5332
GFRA2 cloning plasmid
CSB-CL009380HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1395
  • Sequence: atgatcttggcaaacgtcttctgcctcttcttctttctagacgagaccctccgctctttggccagcccttcctccctgcagggccccgagctccacggctggcgccccccagtggactgtgtccgggccaatgagctgtgtgccgccgaatccaactgcagctctcgctaccgca
  • Show more
Description: A cloning plasmid for the GFRA2 gene.
EF009840 96 Tests
EUR 689
Mouse GFRA2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human GFRA2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PVT16798 2 ug
EUR 325
GFRA2 Recombinant Protein (Human)
RP013135 100 ug Ask for price
GFRA2 Recombinant Protein (Rat)
RP202517 100 ug Ask for price
GFRA2 Recombinant Protein (Mouse)
RP136337 100 ug Ask for price
GDNF Family Receptor Alpha 2 (GFRA2) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

GFRA2 Rabbit Polyclonal Antibody