EXTL3 Rabbit Polyclonal Antibody

EXTL3 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

EXTL3 Polyclonal Antibody

ES10967-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against EXTL3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

EXTL3 Polyclonal Antibody

ES10967-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against EXTL3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

EXTL3 Rabbit pAb

A3857-100ul 100 ul
EUR 308

EXTL3 Rabbit pAb

A3857-200ul 200 ul
EUR 459

EXTL3 Rabbit pAb

A3857-20ul 20 ul
EUR 183

EXTL3 Rabbit pAb

A3857-50ul 50 ul
EUR 223

EXTL3 antibody

70R-17181 50 ul
EUR 435
Description: Rabbit polyclonal EXTL3 antibody

EXTL3 antibody

70R-15308 100 ug
EUR 327
Description: Rabbit polyclonal EXTL3 antibody

EXTL3 Antibody

36453-100ul 100ul
EUR 252

EXTL3 Antibody

1-CSB-PA794242
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EXTL3. Recognizes EXTL3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

EXTL3 Antibody

DF12993 200ul
EUR 304
Description: EXTL3 Antibody detects endogenous levels of EXTL3.

EXTL3 Antibody

1-CSB-PA399518
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EXTL3. Recognizes EXTL3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

EXTL3 Antibody

1-CSB-PA03075A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EXTL3. Recognizes EXTL3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

EXTL3 Antibody

1-CSB-PA007905GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EXTL3. Recognizes EXTL3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

EXTL3 Polyclonal Antibody, HRP Conjugated

A51670 100 µg
EUR 570.55
Description: reagents widely cited

EXTL3 Polyclonal Antibody, FITC Conjugated

A51671 100 µg
EUR 570.55
Description: Ask the seller for details

EXTL3 Polyclonal Antibody, Biotin Conjugated

A51672 100 µg
EUR 570.55
Description: The best epigenetics products

EXTL3 antibody (HRP)

60R-1754 100 ug
EUR 327
Description: Rabbit polyclonal EXTL3 antibody (HRP)

EXTL3 antibody (FITC)

60R-1755 100 ug
EUR 327
Description: Rabbit polyclonal EXTL3 antibody (FITC)

EXTL3 antibody (biotin)

60R-1756 100 ug
EUR 327
Description: Rabbit polyclonal EXTL3 antibody (biotin)

EXTL3 Conjugated Antibody

C36453 100ul
EUR 397

anti- EXTL3 antibody

FNab02912 100µg
EUR 505.25
  • Immunogen: exostoses(multiple)-like 3
  • Uniprot ID: O43909
  • Gene ID: 2137
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against EXTL3

Anti-EXTL3 antibody

PAab02912 100 ug
EUR 355

Anti-EXTL3 antibody

STJ23590 100 µl
EUR 277
Description: This gene encodes a single-pass membrane protein which functions as a glycosyltransferase. The encoded protein catalyzes the transfer of N-acetylglucosamine to glycosaminoglycan chains. This reaction is important in heparin and heparan sulfate synthesis. Alternative splicing results in the multiple transcript variants.

Anti-EXTL3 antibody

STJ192125 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to EXTL3

EXTL3 siRNA

20-abx915845
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EXTL3 Antibody, HRP conjugated

1-CSB-PA03075B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EXTL3. Recognizes EXTL3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EXTL3 Antibody, FITC conjugated

1-CSB-PA03075C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EXTL3. Recognizes EXTL3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EXTL3 Antibody, Biotin conjugated

1-CSB-PA03075D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EXTL3. Recognizes EXTL3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

EXTL3 Blocking Peptide

DF12993-BP 1mg
EUR 195

EXTL3 cloning plasmid

CSB-CL007905HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2760
  • Sequence: atgacaggctataccatgctgcggaatgggggcgcggggaacggaggtcagacctgcatgctgcgctggtccaaccgcatccgcctcacgtggctcagcttcacgctctttgtcatcctggtcttcttcccgctcatcgcccactattacctcaccactctggatgaggctgatg
  • Show more
Description: A cloning plasmid for the EXTL3 gene.

EXTL3 ELISA KIT|Human

EF009489 96 Tests
EUR 689

Human EXTL3 shRNA Plasmid

20-abx951486
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Exostoses (Multiple)-Like 3 (EXTL3) Antibody

20-abx002804
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exostoses (Multiple)-Like 3 (EXTL3) Antibody

20-abx212396
  • EUR 411.00