LYVE1 Rabbit Polyclonal Antibody
LYVE1 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
LYVE1 Polyclonal Antibody |
ES11131-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against LYVE1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
LYVE1 Polyclonal Antibody |
ES11131-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against LYVE1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
LYVE1 Rabbit mAb |
A4352-100ul |
Abclonal |
100 ul |
EUR 410 |
LYVE1 Rabbit mAb |
A4352-200ul |
Abclonal |
200 ul |
EUR 571 |
LYVE1 Rabbit mAb |
A4352-20ul |
Abclonal |
20 ul |
EUR 221 |
LYVE1 Rabbit mAb |
A4352-50ul |
Abclonal |
50 ul |
EUR 287 |
LYVE1 Rabbit pAb |
A6452-100ul |
Abclonal |
100 ul |
EUR 308 |
LYVE1 Rabbit pAb |
A6452-200ul |
Abclonal |
200 ul |
EUR 459 |
LYVE1 Rabbit pAb |
A6452-20ul |
Abclonal |
20 ul |
EUR 183 |
LYVE1 Rabbit pAb |
A6452-50ul |
Abclonal |
50 ul |
EUR 223 |
Anti-LYVE1 Rabbit Monoclonal Antibody |
M04027 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal LYVE1 Antibody. Validated in WB and tested in Human, Mouse, Rat. |
LYVE1 antibody |
20R-2482 |
Fitzgerald |
50 ug |
EUR 281 |
Description: Rabbit polyclonal LYVE1 antibody |
LYVE1 antibody |
70R-18338 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal LYVE1 antibody |
LYVE1 antibody |
70R-11548 |
Fitzgerald |
100 ug |
EUR 527 |
Description: Rabbit polyclonal LYVE1 antibody |
LYVE1 antibody |
70R-11549 |
Fitzgerald |
100 ug |
EUR 527 |
Description: Rabbit polyclonal LYVE1 antibody |
LYVE1 Antibody |
35806-100ul |
SAB |
100ul |
EUR 252 |
LYVE1 antibody |
10R-1025 |
Fitzgerald |
100 ul |
EUR 316 |
Description: Mouse monoclonal LYVE1 antibody |
LYVE1 antibody |
10R-6400 |
Fitzgerald |
100 ug |
EUR 343 |
Description: Rat monoclonal LYVE1 antibody |
LYVE1 Antibody |
49343-100ul |
SAB |
100ul |
EUR 333 |
LYVE1 Antibody |
49343-50ul |
SAB |
50ul |
EUR 239 |
LYVE1 Antibody |
1-CSB-PA915341 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50 |
LYVE1 Antibody |
1-CSB-PA897574EA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200 |
LYVE1 Antibody |
1-CSB-PA897574ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
LYVE1 Antibody |
1-CSB-PA897574ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
LYVE1 Antibody |
1-CSB-PA561582 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:100-1:500, IHC:1:25-1:100 |
LYVE1 Antibody |
CSB-PA566878- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
- Show more
|
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000 |
LYVE1 Antibody |
CSB-PA566878-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
- Show more
|
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000 |
LYVE1 antibody |
70R-LR003 |
Fitzgerald |
50 ug |
EUR 507 |
Description: Affinity purified Rabbit polyclonal LYVE1 antibody |
LYVE1 antibody |
70R-LR004 |
Fitzgerald |
100 ug |
EUR 422 |
Description: Affinity purified Rabbit polyclonal LYVE1 antibody |
LYVE1 antibody |
70R-LR005 |
Fitzgerald |
100 ug |
EUR 422 |
Description: Affinity purified Rabbit polyclonal LYVE1 antibody |
LYVE1 antibody |
70R-LR006 |
Fitzgerald |
200 ug |
EUR 497 |
Description: Affinity purified Rabbit polyclonal LYVE1 antibody |
LYVE1 antibody |
70R-6181 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal LYVE1 antibody raised against the N terminal of LYVE1 |
LYVE1 Antibody |
AF4202 |
Affbiotech |
200ul |
EUR 376 |
Description: The antibody detects endogenous level of total Lymphatic vessel endothelial hyaluronic acid receptor 1 protein. |
LYVE1 Antibody |
1-CSB-PA013282GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Rabbit Anti-Human LYVE1 (aa 271-275) Polyclonal Antibody |
CPB-1205RH |
Creative Diagnostics |
100 ul |
EUR 460 |
Polyclonal LYVE1 (XLKD1) Antibody (C-term) |
APR04522G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LYVE1 (XLKD1) (C-term). This antibody is tested and proven to work in the following applications: |
LYVE1 antibody (biotin) |
61R-1501 |
Fitzgerald |
100 ug |
EUR 457 |
Description: Rat monoclonal LYVE1 antibody (biotin) |
LYVE1 Conjugated Antibody |
C35806 |
SAB |
100ul |
EUR 397 |
anti- LYVE1 antibody |
FNab04911 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:500 - 1:2000
- Immunogen: LYVE1
- Uniprot ID: Q9Y5Y7
- Gene ID: 10894
- Research Area: Cardiovascular
|
Description: Antibody raised against LYVE1 |
Anti-LYVE1 antibody |
STJ28535 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a type I integral membrane glycoprotein. The encoded protein acts as a receptor and binds to both soluble and immobilized hyaluronan. This protein may function in lymphatic hyaluronan transport and have a role in tumor metastasis. |
Anti-LYVE1 antibody |
STJ192289 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to LYVE1 |
Polyclonal Goat Anti-LYVE1 Antibody (internal region) |
APG00978G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-LYVE1 (internal region). This antibody is tested and proven to work in the following applications: |
LYVE1 protein |
30R-AL010 |
Fitzgerald |
20 ug |
EUR 242 |
Description: Purified recombinant Human LYVE1 protein |
LYVE1 siRNA |
20-abx923216 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LYVE1 siRNA |
20-abx923217 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-LYVE1 |
YF-PA17283 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to LYVE1 |
LYVE1 Antibody, HRP conjugated |
1-CSB-PA897574EB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
LYVE1 Antibody, FITC conjugated |
1-CSB-PA897574EC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
LYVE1 Antibody, Biotin conjugated |
1-CSB-PA897574ED01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
LYVE1 recombinant monoclonal antibody |
A5450 |
Bimake |
100ul X 3 |
EUR 595 |
- Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
- Show more
|
Description: A recombinant monoclonal antibody from rabbit against human LYVE1 for WB,ELISA |
LYVE1 protein (Mouse) |
30R-AL009 |
Fitzgerald |
20 ug |
EUR 242 |
Description: Purified recombinant Mouse LYVE1 protein |
LYVE1 Blocking Peptide |
33R-1461 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LYVE1 antibody, catalog no. 70R-6181 |
LYVE1 cloning plasmid |
CSB-CL897574HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 969
- Sequence: atggccaggtgcttcagcctggtgttgcttctcacttccatctggaccacgaggctcctggtccaaggctctttgcgtgcagaagagctttccatccaggtgtcatgcagaattatggggatcacccttgtgagcaaaaaggcgaaccagcagctgaatttcacagaagctaagga
- Show more
|
Description: A cloning plasmid for the LYVE1 gene. |
LYVE1 Blocking Peptide |
AF4202-BP |
Affbiotech |
1mg |
EUR 195 |
LYVE1 protein (His tag) |
80R-1071 |
Fitzgerald |
50 ug |
EUR 586 |
Description: Purified recombinant Human LYVE1 protein |
Human LYVE1 shRNA Plasmid |
20-abx957424 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse LYVE1 shRNA Plasmid |
20-abx980157 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
LYVE1 Recombinant Protein (Human) |
RP018505 |
ABM |
100 ug |
Ask for price |
LYVE1 Recombinant Protein (Mouse) |
RP148823 |
ABM |
100 ug |
Ask for price |
LYVE1 Recombinant Protein (Rat) |
RP210452 |
ABM |
100 ug |
Ask for price |
Lyve1 ORF Vector (Rat) (pORF) |
ORF070152 |
ABM |
1.0 ug DNA |
EUR 506 |
LYVE1 ORF Vector (Human) (pORF) |
ORF006169 |
ABM |
1.0 ug DNA |
EUR 95 |
Lyve1 ORF Vector (Mouse) (pORF) |
ORF049609 |
ABM |
1.0 ug DNA |
EUR 506 |
LYVE1 ELISA Kit (Mouse) (OKCD09112) |
OKCD09112 |
Aviva Systems Biology |
96 Wells |
EUR 1001 |
Description: Description of target: Recombinant Mouse Lymphatic Vessel Endothelial Hyaluronic Acid Receptor 1, Sf9;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 6.1pg/mL |
LYVE1 ELISA Kit (Mouse) (OKEH03641) |
OKEH03641 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: Ligand-specific transporter trafficking between intracellular organelles (TGN) and the plasma membrane. Plays a role in autocrine regulation of cell growth mediated by growth regulators containing cell surface retention sequence binding (CRS). May act as a hyaluronan (HA) transporter, either mediating its uptake for catabolism within lymphatic endothelial cells themselves, or its transport into the lumen of afferent lymphatic vessels for subsequent re-uptake and degradation in lymph nodes.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 40 pg/mL |
LYVE1 ELISA Kit (Human) (OKEH07052) |
OKEH07052 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Ligand-specific transporter trafficking between intracellular organelles (TGN) and the plasma membrane. Plays a role in autocrine regulation of cell growth mediated by growth regulators containing cell surface retention sequence binding (CRS). May act as a hyaluronan (HA) transporter, either mediating its uptake for catabolism within lymphatic endothelial cells themselves, or its transport into the lumen of afferent lymphatic vessels for subsequent re-uptake and degradation in lymph nodes.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.9 pg/mL |
Lymphatic Vessel Endothelial Hyaluronan Receptor 1 (LYVE1) Antibody |
20-abx007134 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Lymphatic Vessel Endothelial Hyaluronan Receptor 1 (LYVE1) Antibody |
20-abx177390 |
Abbexa |
|
|
|
Lymphatic Vessel Endothelial Hyaluronan Receptor 1 (LYVE1) Antibody |
20-abx211063 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Lymphatic Vessel Endothelial Hyaluronan Receptor 1 (LYVE1) Antibody |
20-abx211706 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Lymphatic Vessel Endothelial Hyaluronan Receptor 1 (LYVE1) Antibody |
20-abx113543 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Lymphatic Vessel Endothelial Hyaluronan Receptor 1 (LYVE1) Antibody |
abx146196-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Lymphatic Vessel Endothelial Hyaluronan Receptor 1 (LYVE1) Antibody |
abx031414-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Lymphatic Vessel Endothelial Hyaluronan Receptor 1 (LYVE1) Antibody |
abx031414-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Lymphatic Vessel Endothelial Hyaluronan Receptor 1 (LYVE1) Antibody |
20-abx320232 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Lymphatic Vessel Endothelial Hyaluronan Receptor 1 (LYVE1) Antibody |
abx234911-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Lymphatic Vessel Endothelial Hyaluronan Receptor 1 (LYVE1) Antibody |
abx332164-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Lymphatic Vessel Endothelial Hyaluronan Receptor 1 (LYVE1) Antibody |
20-abx318264 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Lymphatic Vessel Endothelial Hyaluronan Receptor 1 (LYVE1) Antibody |
20-abx322254 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Lymphatic Vessel Endothelial Hyaluronan Receptor 1 (LYVE1) Antibody |
abx432944-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Lyve1 sgRNA CRISPR Lentivector set (Rat) |
K6588901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Lyve1 sgRNA CRISPR Lentivector set (Mouse) |
K4410801 |
ABM |
3 x 1.0 ug |
EUR 339 |
LYVE1 sgRNA CRISPR Lentivector set (Human) |
K1249101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Lymphatic Vessel Endothelial Hyaluronan Receptor 1 (LYVE1) Antibody (HRP) |
20-abx316715 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Lymphatic Vessel Endothelial Hyaluronan Receptor 1 (LYVE1) Antibody (FITC) |
20-abx316716 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Lymphatic Vessel Endothelial Hyaluronan Receptor 1 (LYVE1) Antibody (Biotin) |
20-abx316717 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Lyve1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6588902 |
ABM |
1.0 ug DNA |
EUR 154 |
Lyve1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6588903 |
ABM |
1.0 ug DNA |
EUR 154 |
Lyve1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6588904 |
ABM |
1.0 ug DNA |
EUR 154 |
Lyve1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4410802 |
ABM |
1.0 ug DNA |
EUR 154 |
Lyve1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4410803 |
ABM |
1.0 ug DNA |
EUR 154 |
Lyve1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4410804 |
ABM |
1.0 ug DNA |
EUR 154 |
LYVE1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1249102 |
ABM |
1.0 ug DNA |
EUR 154 |
LYVE1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1249103 |
ABM |
1.0 ug DNA |
EUR 154 |
LYVE1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1249104 |
ABM |
1.0 ug DNA |
EUR 154 |
LYVE1 Protein Vector (Human) (pPB-C-His) |
PV024673 |
ABM |
500 ng |
EUR 329 |
LYVE1 Protein Vector (Human) (pPB-N-His) |
PV024674 |
ABM |
500 ng |
EUR 329 |
LYVE1 Protein Vector (Human) (pPM-C-HA) |
PV024675 |
ABM |
500 ng |
EUR 329 |
LYVE1 Protein Vector (Human) (pPM-C-His) |
PV024676 |
ABM |
500 ng |
EUR 329 |
LYVE1 Protein Vector (Rat) (pPB-C-His) |
PV280606 |
ABM |
500 ng |
EUR 603 |
LYVE1 Protein Vector (Rat) (pPB-N-His) |
PV280607 |
ABM |
500 ng |
EUR 603 |
LYVE1 Protein Vector (Rat) (pPM-C-HA) |
PV280608 |
ABM |
500 ng |
EUR 603 |
LYVE1 Protein Vector (Rat) (pPM-C-His) |
PV280609 |
ABM |
500 ng |
EUR 603 |
LYVE1 Protein Vector (Mouse) (pPB-C-His) |
PV198434 |
ABM |
500 ng |
EUR 603 |
LYVE1 Protein Vector (Mouse) (pPB-N-His) |
PV198435 |
ABM |
500 ng |
EUR 603 |
LYVE1 Protein Vector (Mouse) (pPM-C-HA) |
PV198436 |
ABM |
500 ng |
EUR 603 |
LYVE1 Protein Vector (Mouse) (pPM-C-His) |
PV198437 |
ABM |
500 ng |
EUR 603 |
Recombinant Human LYVE1 Protein, Untagged, Insect-100ug |
QP12609-0.1mg |
EnQuireBio |
100ug |
EUR 1161 |
Recombinant Human LYVE1 Protein, Untagged, Insect-10ug |
QP12609-10ug |
EnQuireBio |
10ug |
EUR 201 |
Recombinant Human LYVE1 Protein, Untagged, Insect-2ug |
QP12609-2ug |
EnQuireBio |
2ug |
EUR 155 |
Recombinant Human LYVE1 Protein, GST, E.coli-10ug |
QP12609-GST-10ug |
EnQuireBio |
10ug |
EUR 553 |
Recombinant Human LYVE1 Protein, GST, E.coli-2ug |
QP12609-GST-2ug |
EnQuireBio |
2ug |
EUR 245 |
Recombinant Human LYVE1 Protein, GST, E.coli-5ug |
QP12609-GST-5ug |
EnQuireBio |
5ug |
EUR 336 |
Recombinant Human LYVE1 Protein, His, E.coli-1mg |
QP12609-HIS-1mg |
EnQuireBio |
1mg |
EUR 5251 |
Recombinant Mouse LYVE1 Protein, His, Insect-10ug |
QP12610-10ug |
EnQuireBio |
10ug |
EUR 201 |
Recombinant Mouse LYVE1 Protein, His, Insect-1mg |
QP12610-1mg |
EnQuireBio |
1mg |
EUR 5251 |
Recombinant Mouse LYVE1 Protein, His, Insect-2ug |
QP12610-2ug |
EnQuireBio |
2ug |
EUR 155 |
Lyve1 3'UTR Luciferase Stable Cell Line |
TU112758 |
ABM |
1.0 ml |
Ask for price |
Lyve1 3'UTR GFP Stable Cell Line |
TU162758 |
ABM |
1.0 ml |
Ask for price |
Lyve1 3'UTR Luciferase Stable Cell Line |
TU212724 |
ABM |
1.0 ml |
Ask for price |
Lyve1 3'UTR GFP Stable Cell Line |
TU262724 |
ABM |
1.0 ml |
Ask for price |
LYVE1 3'UTR GFP Stable Cell Line |
TU062810 |
ABM |
1.0 ml |
EUR 1394 |
LYVE1 3'UTR Luciferase Stable Cell Line |
TU012810 |
ABM |
1.0 ml |
EUR 1394 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK3 Rabbit Polyclonal Antibody |
ABP57574-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
MEK3 Rabbit Polyclonal Antibody |
ABP57574-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
MEK3 Rabbit Polyclonal Antibody |
ABP57574-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
Nrf2 Rabbit Polyclonal Antibody |
ABP57575-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Nrf2
- Applications tips:
|
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2 |
Nrf2 Rabbit Polyclonal Antibody |
ABP57575-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Nrf2
- Applications tips:
|
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2 |
Nrf2 Rabbit Polyclonal Antibody |
ABP57575-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Nrf2
- Applications tips:
|
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2 |
ATG4a Rabbit Polyclonal Antibody |
ABP57576-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATG4a
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a |
ATG4a Rabbit Polyclonal Antibody |
ABP57576-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATG4a
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a |
ATG4a Rabbit Polyclonal Antibody |
ABP57576-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATG4a
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a |
ATG4b Rabbit Polyclonal Antibody |
ABP57577-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATG4b
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b |
ATG4b Rabbit Polyclonal Antibody |
ABP57577-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATG4b
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b |
ATG4b Rabbit Polyclonal Antibody |
ABP57577-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATG4b
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b |
ATG4c Rabbit Polyclonal Antibody |
ABP57578-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATG4c
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c |
ATG4c Rabbit Polyclonal Antibody |
ABP57578-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATG4c
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c |
ATG4c Rabbit Polyclonal Antibody |
ABP57578-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATG4c
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c |
LYVE1 Rabbit Polyclonal Antibody