VASN Rabbit Polyclonal Antibody

VASN Rabbit Polyclonal Antibody

To Order Now:

Human Vasorin (VASN) ELISA Kit
EUR 673
  • Should the Human Vasorin (VASN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Vasorin (VASN) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse Vasorin (VASN) ELISA Kit
EUR 527
  • Should the Mouse Vasorin (VASN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Vasorin (VASN) in samples from tissue homogenates or other biological fluids.
Mouse Vasorin (VASN) ELISA Kit
EUR 688
  • Should the Mouse Vasorin (VASN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Vasorin (VASN) in samples from tissue homogenates or other biological fluids.
Human Vasorin (VASN) ELISA Kit
RDR-VASN-Hu-48Tests 48 Tests
EUR 544
Human Vasorin (VASN) ELISA Kit
RDR-VASN-Hu-96Tests 96 Tests
EUR 756
Mouse Vasorin (VASN) ELISA Kit
RDR-VASN-Mu-48Tests 48 Tests
EUR 557
Mouse Vasorin (VASN) ELISA Kit
RDR-VASN-Mu-96Tests 96 Tests
EUR 774
Human Vasorin (VASN) ELISA Kit
RD-VASN-Hu-48Tests 48 Tests
EUR 521
Human Vasorin (VASN) ELISA Kit
RD-VASN-Hu-96Tests 96 Tests
EUR 723
Mouse Vasorin (VASN) ELISA Kit
RD-VASN-Mu-48Tests 48 Tests
EUR 533
Mouse Vasorin (VASN) ELISA Kit
RD-VASN-Mu-96Tests 96 Tests
EUR 740
VASN Polyclonal Antibody
ES10988-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VASN from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
VASN Polyclonal Antibody
ES10988-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VASN from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
VASN Polyclonal Antibody
ABP60871-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human VASN protein
  • Applications tips:
Description: A polyclonal antibody for detection of VASN from Human, Mouse. This VASN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VASN protein
VASN Polyclonal Antibody
ABP60871-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human VASN protein
  • Applications tips:
Description: A polyclonal antibody for detection of VASN from Human, Mouse. This VASN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VASN protein
VASN Polyclonal Antibody
ABP60871-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human VASN protein
  • Applications tips:
Description: A polyclonal antibody for detection of VASN from Human, Mouse. This VASN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VASN protein
VASN Polyclonal Antibody
29780-100ul 100ul
EUR 252
VASN Polyclonal Antibody
29780-50ul 50ul
EUR 187
VASN Rabbit pAb
A16215-100ul 100 ul
EUR 308
VASN Rabbit pAb
A16215-200ul 200 ul
EUR 459
VASN Rabbit pAb
A16215-20ul 20 ul
EUR 183
VASN Rabbit pAb
A16215-50ul 50 ul
EUR 223
VASN Polyclonal Conjugated Antibody
C29780 100ul
EUR 397
VASN Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VASN. Recognizes VASN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:500-1:1000, IF:1:200-1:500
Vasorin (VASN) Polyclonal Antibody (Mouse)
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn299~Ala559)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN)
Vasorin (VASN) Polyclonal Antibody (Human, Mouse)
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn298~Gly539)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN)
Vasorin (VASN) Polyclonal Antibody (Mouse), APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn299~Ala559)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with APC.
Vasorin (VASN) Polyclonal Antibody (Mouse), Biotinylated
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn299~Ala559)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with Biotin.
Vasorin (VASN) Polyclonal Antibody (Mouse), Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn299~Ala559)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with Cy3.
Vasorin (VASN) Polyclonal Antibody (Mouse), FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn299~Ala559)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with FITC.
Vasorin (VASN) Polyclonal Antibody (Mouse), HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn299~Ala559)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with HRP.
Vasorin (VASN) Polyclonal Antibody (Mouse), PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn299~Ala559)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with PE.
Vasorin (VASN) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Vasorin (VASN) Antibody
  • EUR 314.00
  • EUR 133.00
  • EUR 829.00
  • EUR 439.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Vasorin (VASN) Antibody
abx029986-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Vasorin (VASN) Antibody
abx029986-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Vasorin (VASN) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Vasorin (VASN) Antibody
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.
Anti-VASN antibody
STJ118668 100 µl
EUR 277
Anti-VASN antibody
STJ192146 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to VASN
Vasorin (VASN) Polyclonal Antibody (Human, Mouse), APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn298~Gly539)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with APC.
Vasorin (VASN) Polyclonal Antibody (Human, Mouse), Biotinylated
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn298~Gly539)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with Biotin.
Vasorin (VASN) Polyclonal Antibody (Human, Mouse), Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn298~Gly539)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with Cy3.
Vasorin (VASN) Polyclonal Antibody (Human, Mouse), FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn298~Gly539)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with FITC.
Vasorin (VASN) Polyclonal Antibody (Human, Mouse), HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn298~Gly539)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with HRP.
Vasorin (VASN) Polyclonal Antibody (Human, Mouse), PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn298~Gly539)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with PE.
Vasorin (VASN) Polyclonal Antibody (Mouse), APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn299~Ala559)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with APC-Cy7.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
VASN Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VASN. Recognizes VASN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
VASN Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VASN. Recognizes VASN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
VASN Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VASN. Recognizes VASN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Vasorin (VASN) Polyclonal Antibody (Human, Mouse), APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn298~Gly539)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with APC-Cy7.
VASN cloning plasmid
CSB-CL025796HU-10ug 10ug
EUR 675
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2022
  • Sequence: atgtgctccagggtccctctgctgctgccgctgctcctgctactggccctggggcctggggtgcagggctgcccatccggctgccagtgcagccagccacagacagtcttctgcactgcccgccaggggaccacggtgccccgagacgtgccacccgacacggtggggctgtacg
  • Show more
Description: A cloning plasmid for the VASN gene.
Recombinant human VASN
P1430 100ug Ask for price
  • Uniprot ID: Q6EMK4
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human VASN
Recombinant Vasorin (VASN)
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q6EMK4
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.8kDa
  • Isoelectric Point: 8.7
Description: Recombinant Human Vasorin expressed in: E.coli
Recombinant Vasorin (VASN)
  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9CZT5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Vasorin expressed in: E.coli
Mouse VASN shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human VASN shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse Vasorin (VASN) Protein
  • EUR 690.00
  • EUR 286.00
  • EUR 2110.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Vasorin (VASN) Protein
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
VASN Recombinant Protein (Human)
RP034255 100 ug Ask for price
VASN Recombinant Protein (Rat)
RP236282 100 ug Ask for price
VASN Recombinant Protein (Mouse)
RP183656 100 ug Ask for price
Mouse Vasorin (VASN) ELISA Kit
abx571795-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Vasorin (VASN) ELISA Kit
abx572543-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Mouse Vasn/ Vasorin ELISA Kit
E1569Mo 1 Kit
EUR 571
Human VASN/ Vasorin ELISA Kit
E2651Hu 1 Kit
EUR 571
Human Vasorin, VASN ELISA KIT
ELI-05447h 96 Tests
EUR 824
Mouse Vasorin, Vasn ELISA KIT
ELI-05448m 96 Tests
EUR 865
Mouse Vasn(Vasorin) ELISA Kit
EM0665 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9CZT5
  • Alias: Vasn/Protein slit-like 2/Atia/Slitl2/VASN/Protein slit-like 2/SLITL2/slit-like 2/slit-like 2(Drosophila)/vasorin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

VASN Rabbit Polyclonal Antibody