PIP Rabbit Polyclonal Antibody
PIP Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
PIP Polyclonal Antibody |
ABP59918-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PIP protein at amino acid sequence of 11-60
- Applications tips:
|
Description: A polyclonal antibody for detection of PIP from Human, Mouse, Rat. This PIP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PIP protein at amino acid sequence of 11-60 |
PIP Polyclonal Antibody |
A55387 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Human Prolactin Induced Protein (PIP) ELISA Kit |
DLR-PIP-Hu-48T |
DL Develop |
48T |
EUR 554 |
- Should the Human Prolactin Induced Protein (PIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Prolactin Induced Protein (PIP) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Prolactin Induced Protein (PIP) ELISA Kit |
DLR-PIP-Hu-96T |
DL Develop |
96T |
EUR 725 |
- Should the Human Prolactin Induced Protein (PIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Prolactin Induced Protein (PIP) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Rat Prolactin Induced Protein (PIP) ELISA Kit |
DLR-PIP-Ra-48T |
DL Develop |
48T |
EUR 590 |
- Should the Rat Prolactin Induced Protein (PIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Prolactin Induced Protein (PIP) in samples from serum, plasma or other biological fluids. |
Rat Prolactin Induced Protein (PIP) ELISA Kit |
DLR-PIP-Ra-96T |
DL Develop |
96T |
EUR 774 |
- Should the Rat Prolactin Induced Protein (PIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Prolactin Induced Protein (PIP) in samples from serum, plasma or other biological fluids. |
Human Prolactin Induced Protein (PIP) ELISA Kit |
RD-PIP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 563 |
Human Prolactin Induced Protein (PIP) ELISA Kit |
RD-PIP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 783 |
Rat Prolactin Induced Protein (PIP) ELISA Kit |
RD-PIP-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 603 |
Rat Prolactin Induced Protein (PIP) ELISA Kit |
RD-PIP-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 840 |
Human Prolactin Induced Protein (PIP) ELISA Kit |
RDR-PIP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 589 |
Human Prolactin Induced Protein (PIP) ELISA Kit |
RDR-PIP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 820 |
Rat Prolactin Induced Protein (PIP) ELISA Kit |
RDR-PIP-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 631 |
Rat Prolactin Induced Protein (PIP) ELISA Kit |
RDR-PIP-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 880 |
PIP Rabbit pAb |
A6394-100ul |
Abclonal |
100 ul |
EUR 308 |
PIP Rabbit pAb |
A6394-200ul |
Abclonal |
200 ul |
EUR 459 |
PIP Rabbit pAb |
A6394-20ul |
Abclonal |
20 ul |
EUR 183 |
PIP Rabbit pAb |
A6394-50ul |
Abclonal |
50 ul |
EUR 223 |
PIP Polyclonal Antibody, HRP Conjugated |
A55388 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
PIP Polyclonal Antibody, FITC Conjugated |
A55389 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
PIP Polyclonal Antibody, Biotin Conjugated |
A55390 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
Rabbit PIP ELISA Kit |
ERTP0017 |
Abclonal |
96Tests |
EUR 521 |
PIP Antibody |
36498-100ul |
SAB |
100ul |
EUR 252 |
PIP antibody |
38874-100ul |
SAB |
100ul |
EUR 252 |
PIP Antibody |
DF7933 |
Affbiotech |
200ul |
EUR 304 |
Description: PIP Antibody detects endogenous levels of total PIP. |
PIP Antibody |
1-CSB-PA697513 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against PIP. Recognizes PIP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300 |
PIP Antibody |
1-CSB-PA131180 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against PIP. Recognizes PIP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300 |
PIP Antibody |
1-CSB-PA018020GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against PIP. Recognizes PIP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC |
PIP Antibody |
1-CSB-PA018020LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PIP. Recognizes PIP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Polyclonal Goat Anti-GCDFP15 / PIP Antibody |
APG00145G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-GCDFP15 / PIP . This antibody is tested and proven to work in the following applications: |
Polyclonal PIP / GCDFP-15 Antibody (Internal) |
APG01019G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PIP / GCDFP-15 (Internal). This antibody is tested and proven to work in the following applications: |
PIP Conjugated Antibody |
C36498 |
SAB |
100ul |
EUR 397 |
Os-PIP Antibody |
abx018466-100ul |
Abbexa |
100 ul |
EUR 384 |
- Shipped within 5-10 working days.
|
Aquaporin PIP antibody |
70R-33257 |
Fitzgerald |
100 ug |
EUR 435 |
Description: Rabbit polyclonal Aquaporin PIP antibody |
Aquaporin PIP antibody |
70R-33258 |
Fitzgerald |
100 ug |
EUR 349 |
Description: Rabbit polyclonal Aquaporin PIP antibody |
Human PIP Antibody |
32081-05111 |
AssayPro |
150 ug |
EUR 261 |
Anti-PIP antibody |
STJ192547 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PIP |
Prolactin Induced Protein (PIP) Polyclonal Antibody (Human) |
4-PAM035Hu01 |
Cloud-Clone |
-
EUR 262.00
-
EUR 2747.00
-
EUR 679.00
-
EUR 331.00
-
EUR 220.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PIP (Met1~Glu146)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Prolactin Induced Protein (PIP) |
Prolactin Induced Protein (PIP) Polyclonal Antibody (Mouse) |
4-PAM035Mu01 |
Cloud-Clone |
-
EUR 266.00
-
EUR 2813.00
-
EUR 694.00
-
EUR 337.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PIP (Met1~Asn146)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Prolactin Induced Protein (PIP) |
Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat) |
4-PAM035Ra01 |
Cloud-Clone |
-
EUR 275.00
-
EUR 2958.00
-
EUR 727.00
-
EUR 350.00
-
EUR 226.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PIP (Met1-Asn146)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP) |
Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat) |
4-PAM035Ra02 |
Cloud-Clone |
-
EUR 275.00
-
EUR 2958.00
-
EUR 727.00
-
EUR 350.00
-
EUR 226.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PIP (Asn41~Thr139)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP) |
PIP siRNA |
20-abx904034 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PIP siRNA |
20-abx928673 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PIP siRNA |
20-abx928674 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GCDFP-15 / PIP Antibody |
abx233381-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
PIP Antibody, HRP conjugated |
1-CSB-PA018020LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PIP. Recognizes PIP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PIP Antibody, FITC conjugated |
1-CSB-PA018020LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PIP. Recognizes PIP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PIP Antibody, Biotin conjugated |
1-CSB-PA018020LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PIP. Recognizes PIP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Prolactin Induced Protein (PIP) Polyclonal Antibody (Human), APC |
4-PAM035Hu01-APC |
Cloud-Clone |
-
EUR 368.00
-
EUR 3599.00
-
EUR 993.00
-
EUR 472.00
-
EUR 229.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PIP (Met1~Glu146)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Prolactin Induced Protein (PIP). This antibody is labeled with APC. |
Prolactin Induced Protein (PIP) Polyclonal Antibody (Human), Biotinylated |
4-PAM035Hu01-Biotin |
Cloud-Clone |
-
EUR 328.00
-
EUR 2697.00
-
EUR 786.00
-
EUR 404.00
-
EUR 226.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PIP (Met1~Glu146)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Prolactin Induced Protein (PIP). This antibody is labeled with Biotin. |
Prolactin Induced Protein (PIP) Polyclonal Antibody (Human), Cy3 |
4-PAM035Hu01-Cy3 |
Cloud-Clone |
-
EUR 449.00
-
EUR 4757.00
-
EUR 1283.00
-
EUR 588.00
-
EUR 264.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PIP (Met1~Glu146)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Prolactin Induced Protein (PIP). This antibody is labeled with Cy3. |
Prolactin Induced Protein (PIP) Polyclonal Antibody (Human), FITC |
4-PAM035Hu01-FITC |
Cloud-Clone |
-
EUR 314.00
-
EUR 2899.00
-
EUR 814.00
-
EUR 397.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PIP (Met1~Glu146)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Prolactin Induced Protein (PIP). This antibody is labeled with FITC. |
Prolactin Induced Protein (PIP) Polyclonal Antibody (Human), HRP |
4-PAM035Hu01-HRP |
Cloud-Clone |
-
EUR 335.00
-
EUR 3135.00
-
EUR 877.00
-
EUR 426.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PIP (Met1~Glu146)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Prolactin Induced Protein (PIP). This antibody is labeled with HRP. |
Prolactin Induced Protein (PIP) Polyclonal Antibody (Human), PE |
4-PAM035Hu01-PE |
Cloud-Clone |
-
EUR 314.00
-
EUR 2899.00
-
EUR 814.00
-
EUR 397.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PIP (Met1~Glu146)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Prolactin Induced Protein (PIP). This antibody is labeled with PE. |
Prolactin Induced Protein (PIP) Polyclonal Antibody (Mouse), APC |
4-PAM035Mu01-APC |
Cloud-Clone |
-
EUR 374.00
-
EUR 3689.00
-
EUR 1016.00
-
EUR 481.00
-
EUR 232.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PIP (Met1~Asn146)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Prolactin Induced Protein (PIP). This antibody is labeled with APC. |
Prolactin Induced Protein (PIP) Polyclonal Antibody (Mouse), Biotinylated |
4-PAM035Mu01-Biotin |
Cloud-Clone |
-
EUR 332.00
-
EUR 2763.00
-
EUR 803.00
-
EUR 411.00
-
EUR 228.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PIP (Met1~Asn146)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Prolactin Induced Protein (PIP). This antibody is labeled with Biotin. |
Prolactin Induced Protein (PIP) Polyclonal Antibody (Mouse), Cy3 |
4-PAM035Mu01-Cy3 |
Cloud-Clone |
-
EUR 457.00
-
EUR 4877.00
-
EUR 1313.00
-
EUR 600.00
-
EUR 267.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PIP (Met1~Asn146)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Prolactin Induced Protein (PIP). This antibody is labeled with Cy3. |
Prolactin Induced Protein (PIP) Polyclonal Antibody (Mouse), FITC |
4-PAM035Mu01-FITC |
Cloud-Clone |
-
EUR 319.00
-
EUR 2971.00
-
EUR 832.00
-
EUR 405.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PIP (Met1~Asn146)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Prolactin Induced Protein (PIP). This antibody is labeled with FITC. |
Prolactin Induced Protein (PIP) Polyclonal Antibody (Mouse), HRP |
4-PAM035Mu01-HRP |
Cloud-Clone |
-
EUR 341.00
-
EUR 3213.00
-
EUR 897.00
-
EUR 433.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PIP (Met1~Asn146)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Prolactin Induced Protein (PIP). This antibody is labeled with HRP. |
Prolactin Induced Protein (PIP) Polyclonal Antibody (Mouse), PE |
4-PAM035Mu01-PE |
Cloud-Clone |
-
EUR 319.00
-
EUR 2971.00
-
EUR 832.00
-
EUR 405.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PIP (Met1~Asn146)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Prolactin Induced Protein (PIP). This antibody is labeled with PE. |
Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), APC |
4-PAM035Ra01-APC |
Cloud-Clone |
-
EUR 388.00
-
EUR 3887.00
-
EUR 1065.00
-
EUR 501.00
-
EUR 237.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PIP (Met1-Asn146)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with APC. |
Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), Biotinylated |
4-PAM035Ra01-Biotin |
Cloud-Clone |
-
EUR 343.00
-
EUR 2908.00
-
EUR 839.00
-
EUR 425.00
-
EUR 232.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PIP (Met1-Asn146)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with Biotin. |
Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), Cy3 |
4-PAM035Ra01-Cy3 |
Cloud-Clone |
-
EUR 476.00
-
EUR 5141.00
-
EUR 1379.00
-
EUR 626.00
-
EUR 275.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PIP (Met1-Asn146)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with Cy3. |
Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), FITC |
4-PAM035Ra01-FITC |
Cloud-Clone |
-
EUR 330.00
-
EUR 3129.00
-
EUR 872.00
-
EUR 420.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PIP (Met1-Asn146)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with FITC. |
Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), HRP |
4-PAM035Ra01-HRP |
Cloud-Clone |
-
EUR 353.00
-
EUR 3385.00
-
EUR 940.00
-
EUR 451.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PIP (Met1-Asn146)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with HRP. |
Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), PE |
4-PAM035Ra01-PE |
Cloud-Clone |
-
EUR 330.00
-
EUR 3129.00
-
EUR 872.00
-
EUR 420.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PIP (Met1-Asn146)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with PE. |
Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), APC |
4-PAM035Ra02-APC |
Cloud-Clone |
-
EUR 388.00
-
EUR 3887.00
-
EUR 1065.00
-
EUR 501.00
-
EUR 237.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PIP (Asn41~Thr139)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with APC. |
Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), Biotinylated |
4-PAM035Ra02-Biotin |
Cloud-Clone |
-
EUR 343.00
-
EUR 2908.00
-
EUR 839.00
-
EUR 425.00
-
EUR 232.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PIP (Asn41~Thr139)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with Biotin. |
Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), Cy3 |
4-PAM035Ra02-Cy3 |
Cloud-Clone |
-
EUR 476.00
-
EUR 5141.00
-
EUR 1379.00
-
EUR 626.00
-
EUR 275.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PIP (Asn41~Thr139)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with Cy3. |
Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), FITC |
4-PAM035Ra02-FITC |
Cloud-Clone |
-
EUR 330.00
-
EUR 3129.00
-
EUR 872.00
-
EUR 420.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PIP (Asn41~Thr139)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with FITC. |
Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), HRP |
4-PAM035Ra02-HRP |
Cloud-Clone |
-
EUR 353.00
-
EUR 3385.00
-
EUR 940.00
-
EUR 451.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PIP (Asn41~Thr139)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with HRP. |
Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), PE |
4-PAM035Ra02-PE |
Cloud-Clone |
-
EUR 330.00
-
EUR 3129.00
-
EUR 872.00
-
EUR 420.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PIP (Asn41~Thr139)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with PE. |
anti- GCDFP-15/PIP antibody |
FNab03381 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: IHC: 1:20-1:200
- Immunogen: prolactin-induced protein
- Uniprot ID: P12273
- Research Area: Cancer, Immunology
|
Description: Antibody raised against GCDFP-15/PIP |
Prolactin Induced Protein (PIP) Antibody |
20-abx128887 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Prolactin Induced Protein (PIP) Antibody |
20-abx131067 |
Abbexa |
-
EUR 481.00
-
EUR 133.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Prolactin Induced Protein (PIP) Antibody |
20-abx102473 |
Abbexa |
-
EUR 467.00
-
EUR 133.00
-
EUR 1344.00
-
EUR 634.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Prolactin Induced Protein (PIP) Antibody |
20-abx102474 |
Abbexa |
-
EUR 481.00
-
EUR 133.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Prolactin-Inducible Protein (PIP) Antibody |
20-abx103058 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Prolactin-Inducible Protein (PIP) Antibody |
20-abx004889 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Prolactin Induced Protein (PIP) Antibody |
20-abx174185 |
Abbexa |
|
|
|
Prolactin Induced Protein (PIP) Antibody |
20-abx174186 |
Abbexa |
|
|
|
Prolactin-Inducible Protein (PIP) Antibody |
abx217780-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Prolactin Induced Protein (PIP) Antibody |
20-abx210246 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Prolactin Induced Protein (PIP) Antibody |
20-abx210247 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human PIP Antibody (Biotin Conjugate) |
32081-05121 |
AssayPro |
150 ug |
EUR 369 |
PIP cloning plasmid |
CSB-CL018020HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 441
- Sequence: atgcgcttgctccagctcctgttcagggccagccctgccaccctgctcctggttctctgcctgcagttgggggccaacaaagctcaggacaacactcggaagatcataataaagaattttgacattcccaagtcagtacgtccaaatgacgaagtcactgcagtgcttgcagttca
- Show more
|
Description: A cloning plasmid for the PIP gene. |
PIP cloning plasmid |
CSB-CL018020HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 441
- Sequence: atgcgcttgctccagctcctgttcagggccagccctgccaccctgctcctggttctctgcctgcagttgggggccaacaaagctcaggacaacactcggaagatcataataaagaattttgacattcccaagtcagtacgtccaaatgacgaagtcactgcagtgcttgcagttca
- Show more
|
Description: A cloning plasmid for the PIP gene. |
PIP Blocking Peptide |
DF7933-BP |
Affbiotech |
1mg |
EUR 195 |
Prolactin Induced Protein (PIP) Polyclonal Antibody (Human), APC-Cy7 |
4-PAM035Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 616.00
-
EUR 7078.00
-
EUR 1867.00
-
EUR 824.00
-
EUR 338.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PIP (Met1~Glu146)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Prolactin Induced Protein (PIP). This antibody is labeled with APC-Cy7. |
Prolactin Induced Protein (PIP) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAM035Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 628.00
-
EUR 7258.00
-
EUR 1912.00
-
EUR 842.00
-
EUR 344.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PIP (Met1~Asn146)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Prolactin Induced Protein (PIP). This antibody is labeled with APC-Cy7. |
Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAM035Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 657.00
-
EUR 7654.00
-
EUR 2011.00
-
EUR 882.00
-
EUR 355.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PIP (Met1-Asn146)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with APC-Cy7. |
Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAM035Ra02-APC-Cy7 |
Cloud-Clone |
-
EUR 657.00
-
EUR 7654.00
-
EUR 2011.00
-
EUR 882.00
-
EUR 355.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PIP (Asn41~Thr139)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with APC-Cy7. |
Rabbit Prolactin- inducible protein homolog, PIP ELISA KIT |
ELI-06874Ra |
Lifescience Market |
96 Tests |
EUR 928 |
ELISA kit for Rabbit Prolactin-inducible protein (PIP) |
KTE90066-48T |
Abbkine |
48T |
EUR 354 |
- The hormonally responsive prolactin-inducible protein gene is expressed in benign and malignant breast tumor tissues and in some normal exocrine organs such as sweat, salivary, and lacrimal glands.The PIP gene is 7 kb long with 4 exons ranging from 1
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rabbit Prolactin-inducible protein (PIP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rabbit Prolactin-inducible protein (PIP) |
KTE90066-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- The hormonally responsive prolactin-inducible protein gene is expressed in benign and malignant breast tumor tissues and in some normal exocrine organs such as sweat, salivary, and lacrimal glands.The PIP gene is 7 kb long with 4 exons ranging from 1
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rabbit Prolactin-inducible protein (PIP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rabbit Prolactin-inducible protein (PIP) |
KTE90066-96T |
Abbkine |
96T |
EUR 572 |
- The hormonally responsive prolactin-inducible protein gene is expressed in benign and malignant breast tumor tissues and in some normal exocrine organs such as sweat, salivary, and lacrimal glands.The PIP gene is 7 kb long with 4 exons ranging from 1
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rabbit Prolactin-inducible protein (PIP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Prolactin Induced Protein (PIP) Antibody (FITC) |
20-abx271198 |
Abbexa |
-
EUR 537.00
-
EUR 272.00
-
EUR 1664.00
-
EUR 759.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Prolactin Induced Protein (PIP) Antibody (FITC) |
20-abx271240 |
Abbexa |
-
EUR 523.00
-
EUR 258.00
-
EUR 1581.00
-
EUR 732.00
-
EUR 411.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Prolactin Induced Protein (PIP) Antibody (Biotin) |
20-abx271464 |
Abbexa |
-
EUR 509.00
-
EUR 258.00
-
EUR 1539.00
-
EUR 718.00
-
EUR 411.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Prolactin Induced Protein (PIP) Antibody (Biotin) |
20-abx271506 |
Abbexa |
-
EUR 495.00
-
EUR 258.00
-
EUR 1469.00
-
EUR 690.00
-
EUR 398.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human PIP AssayLite Antibody (FITC Conjugate) |
32081-05141 |
AssayPro |
150 ug |
EUR 428 |
Human PIP AssayLite Antibody (RPE Conjugate) |
32081-05151 |
AssayPro |
150 ug |
EUR 428 |
Human PIP AssayLite Antibody (APC Conjugate) |
32081-05161 |
AssayPro |
150 ug |
EUR 428 |
Human PIP AssayLite Antibody (PerCP Conjugate) |
32081-05171 |
AssayPro |
150 ug |
EUR 471 |
Rat PIP shRNA Plasmid |
20-abx986335 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PIP ELISA Kit |
EHP0017 |
Abclonal |
96Tests |
EUR 521 |
Goat PIP ELISA Kit |
EGTP0017 |
Abclonal |
96Tests |
EUR 521 |
Bovine PIP ELISA Kit |
EBP0017 |
Abclonal |
96Tests |
EUR 521 |
Chicken PIP ELISA Kit |
ECKP0017 |
Abclonal |
96Tests |
EUR 521 |
Canine PIP ELISA Kit |
ECP0017 |
Abclonal |
96Tests |
EUR 521 |
Anserini PIP ELISA Kit |
EAP0017 |
Abclonal |
96Tests |
EUR 521 |
Porcine PIP ELISA Kit |
EPP0017 |
Abclonal |
96Tests |
EUR 521 |
Rat PIP ELISA Kit |
ERP0017 |
Abclonal |
96Tests |
EUR 521 |
Sheep PIP ELISA Kit |
ESP0017 |
Abclonal |
96Tests |
EUR 521 |
Monkey PIP ELISA Kit |
EMKP0017 |
Abclonal |
96Tests |
EUR 521 |
Mouse PIP ELISA Kit |
EMP0017 |
Abclonal |
96Tests |
EUR 521 |
Human PIP shRNA Plasmid |
20-abx953546 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PIP protein (His tag) |
80R-3014 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Purified recombinant PIP protein (His tag) |
Mouse PIP shRNA Plasmid |
20-abx972041 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PIP Recombinant Protein (Human) |
RP023539 |
ABM |
100 ug |
Ask for price |
PIP Recombinant Protein (Human) |
RP023542 |
ABM |
100 ug |
Ask for price |
PIP Recombinant Protein (Rat) |
RP220592 |
ABM |
100 ug |
Ask for price |
PIP Recombinant Protein (Mouse) |
RP162239 |
ABM |
100 ug |
Ask for price |
Human PIP AssayMax ELISA Kit |
EP1505-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Prolactin-inducible protein (PIP) |
1-CSB-YP018020HU |
Cusabio |
-
EUR 430.00
-
EUR 234.00
-
EUR 1508.00
-
EUR 642.00
-
EUR 1009.00
-
EUR 291.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 16 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Prolactin-inducible protein(PIP) expressed in Yeast |
Human Prolactin-inducible protein (PIP) |
1-CSB-EP018020HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 17.5 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Prolactin-inducible protein(PIP) expressed in E.coli |
PIP ORF Vector (Human) (pORF) |
ORF007847 |
ABM |
1.0 ug DNA |
EUR 95 |
PIP ORF Vector (Human) (pORF) |
ORF007848 |
ABM |
1.0 ug DNA |
EUR 95 |
PIP Prolactin-Induced Protein Human |
PROTP12273 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: The Prolactin-Induced Protein produced from Human Seminal Plasma has a molecular mass of 13.52kDa (calculated without glycosylation) containing 118 amino acid residues. |
Pip ORF Vector (Rat) (pORF) |
ORF073532 |
ABM |
1.0 ug DNA |
EUR 506 |
Pip ORF Vector (Mouse) (pORF) |
ORF054081 |
ABM |
1.0 ug DNA |
EUR 506 |
Recombinant Prolactin Induced Protein (PIP) |
4-RPM035Hu01 |
Cloud-Clone |
-
EUR 485.28
-
EUR 233.00
-
EUR 1544.80
-
EUR 581.60
-
EUR 1063.20
-
EUR 388.00
-
EUR 3712.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P12273
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 20.4kDa
- Isoelectric Point: 8.6
|
Description: Recombinant Human Prolactin Induced Protein expressed in: E.coli |
Recombinant Prolactin Induced Protein (PIP) |
4-RPM035Mu01 |
Cloud-Clone |
-
EUR 485.28
-
EUR 233.00
-
EUR 1544.80
-
EUR 581.60
-
EUR 1063.20
-
EUR 388.00
-
EUR 3712.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P02816
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 48.8kDa
- Isoelectric Point: 5.7
|
Description: Recombinant Mouse Prolactin Induced Protein expressed in: E.coli |
Recombinant Prolactin Induced Protein (PIP) |
4-RPM035Ra01 |
Cloud-Clone |
-
EUR 513.95
-
EUR 241.00
-
EUR 1652.32
-
EUR 617.44
-
EUR 1134.88
-
EUR 407.00
-
EUR 3980.80
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O70417
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 43.5kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Prolactin Induced Protein expressed in: E.coli |
Recombinant Prolactin Induced Protein (PIP) |
4-RPM035Ra02 |
Cloud-Clone |
-
EUR 508.58
-
EUR 239.00
-
EUR 1632.16
-
EUR 610.72
-
EUR 1121.44
-
EUR 403.00
-
EUR 3930.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O70417
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 12.7kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Prolactin Induced Protein expressed in: E.coli |
PIP ELISA Kit (Rat) (OKCD02771) |
OKCD02771 |
Aviva Systems Biology |
96 Wells |
EUR 988 |
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 16.23 pg/mL |
PIP ELISA Kit (Human) (OKCD09351) |
OKCD09351 |
Aviva Systems Biology |
96 Wells |
EUR 909 |
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.255ng/mL |
PIP ELISA Kit (Mouse) (OKEH03461) |
OKEH03461 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL |
PIP ELISA Kit (Bovine) (OKEH03940) |
OKEH03940 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: ;Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.17 ng/mL |
Rat Prolactin Induced Protein (PIP) Protein |
20-abx068687 |
Abbexa |
-
EUR 718.00
-
EUR 286.00
-
EUR 2221.00
-
EUR 857.00
-
EUR 509.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Mouse Prolactin Induced Protein (PIP) Protein |
20-abx068688 |
Abbexa |
-
EUR 676.00
-
EUR 286.00
-
EUR 2082.00
-
EUR 801.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Human Prolactin Induced Protein (PIP) Protein |
20-abx167865 |
Abbexa |
-
EUR 676.00
-
EUR 286.00
-
EUR 2082.00
-
EUR 801.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Rat Prolactin Induced Protein (PIP) Protein |
20-abx165970 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2193.00
-
EUR 843.00
-
EUR 509.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Prolactin Induced Protein (PIP) Protein |
20-abx260765 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Human Prolactin Induced Protein (PIP) Protein |
20-abx263247 |
Abbexa |
-
EUR 1609.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
PIP sgRNA CRISPR Lentivector set (Human) |
K1652201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pip sgRNA CRISPR Lentivector set (Mouse) |
K3407801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rat Prolactin-inducible protein homolog (Pip) |
1-CSB-YP530344RA |
Cusabio |
-
EUR 504.00
-
EUR 265.00
-
EUR 1832.00
-
EUR 763.00
-
EUR 1216.00
-
EUR 334.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 15.7 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Rat Prolactin-inducible protein homolog(Pip) expressed in Yeast |
Mycoplasma pneumoniae Putative proline iminopeptidase (pip) |
1-CSB-EP305049MLW |
Cusabio |
-
EUR 611.00
-
EUR 309.00
-
EUR 1827.00
-
EUR 939.00
-
EUR 1218.00
-
EUR 397.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 50.7 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mycoplasma pneumoniae Putative proline iminopeptidase(pip) expressed in E.coli |
Pip sgRNA CRISPR Lentivector set (Rat) |
K6992201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Anti-GCDFP-15 Antibody Clone PIP/1571, Unconjugated-20ug |
5304-MSM1-P0 |
EnQuireBio |
20ug |
EUR 233 |
Anti-GCDFP-15 Antibody Clone PIP/1571, Unconjugated-100ug |
5304-MSM1-P1 |
EnQuireBio |
100ug |
EUR 428 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
PIP Rabbit Polyclonal Antibody