PIP Rabbit Polyclonal Antibody

PIP Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

PIP Polyclonal Antibody
ES11389-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against PIP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PIP Polyclonal Antibody
ES11389-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PIP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Prolactin Induced Protein (PIP) ELISA Kit
DLR-PIP-Hu-48T	DL Develop	48T	EUR 554
Should the Human Prolactin Induced Protein (PIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Prolactin Induced Protein (PIP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Prolactin Induced Protein (PIP) ELISA Kit
DLR-PIP-Hu-96T	DL Develop	96T	EUR 725
Should the Human Prolactin Induced Protein (PIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Prolactin Induced Protein (PIP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Prolactin Induced Protein (PIP) ELISA Kit
DLR-PIP-Ra-48T	DL Develop	48T	EUR 590
Should the Rat Prolactin Induced Protein (PIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Prolactin Induced Protein (PIP) in samples from serum, plasma or other biological fluids.

Rat Prolactin Induced Protein (PIP) ELISA Kit
DLR-PIP-Ra-96T	DL Develop	96T	EUR 774
Should the Rat Prolactin Induced Protein (PIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Prolactin Induced Protein (PIP) in samples from serum, plasma or other biological fluids.

Human Prolactin Induced Protein (PIP) ELISA Kit
RDR-PIP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 589

Human Prolactin Induced Protein (PIP) ELISA Kit
RDR-PIP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 820

Rat Prolactin Induced Protein (PIP) ELISA Kit
RDR-PIP-Ra-48Tests	Reddot Biotech	48 Tests	EUR 631

Rat Prolactin Induced Protein (PIP) ELISA Kit
RDR-PIP-Ra-96Tests	Reddot Biotech	96 Tests	EUR 880

Human Prolactin Induced Protein (PIP) ELISA Kit
RD-PIP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 563

Human Prolactin Induced Protein (PIP) ELISA Kit
RD-PIP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

Rat Prolactin Induced Protein (PIP) ELISA Kit
RD-PIP-Ra-48Tests	Reddot Biotech	48 Tests	EUR 603

Rat Prolactin Induced Protein (PIP) ELISA Kit
RD-PIP-Ra-96Tests	Reddot Biotech	96 Tests	EUR 840

PIP Rabbit pAb
A6394-100ul	Abclonal	100 ul	EUR 308

PIP Rabbit pAb
A6394-200ul	Abclonal	200 ul	EUR 459

PIP Rabbit pAb
A6394-20ul	Abclonal	20 ul	EUR 183

PIP Rabbit pAb
A6394-50ul	Abclonal	50 ul	EUR 223

PIP Polyclonal Antibody, HRP Conjugated
A55388	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

PIP Polyclonal Antibody, FITC Conjugated
A55389	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

PIP Polyclonal Antibody, Biotin Conjugated
A55390	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Rabbit PIP ELISA Kit
ERTP0017	Abclonal	96Tests	EUR 521

PIP Antibody
36498-100ul	SAB	100ul	EUR 252

PIP antibody
38874-100ul	SAB	100ul	EUR 252

PIP Antibody
1-CSB-PA131180	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PIP. Recognizes PIP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

PIP Antibody
1-CSB-PA697513	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PIP. Recognizes PIP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

PIP Antibody
DF7933	Affbiotech	200ul	EUR 304
Description: PIP Antibody detects endogenous levels of total PIP.

PIP Antibody
1-CSB-PA018020GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PIP. Recognizes PIP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

PIP Antibody
1-CSB-PA018020LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIP. Recognizes PIP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PIP Antibody
ABD7933	Lifescience Market	100 ug	EUR 438

PIP Antibody
ABD8001	Lifescience Market	100 ug	EUR 438

Polyclonal Goat Anti-GCDFP15 / PIP Antibody
APG00145G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-GCDFP15 / PIP . This antibody is tested and proven to work in the following applications:

Polyclonal PIP / GCDFP-15 Antibody (Internal)
APG01019G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PIP / GCDFP-15 (Internal). This antibody is tested and proven to work in the following applications:

Human PIP Antibody
32081-05111	AssayPro	150 ug	EUR 261

Aquaporin PIP antibody
70R-33257	Fitzgerald	100 ug	EUR 435
Description: Rabbit polyclonal Aquaporin PIP antibody

Aquaporin PIP antibody
70R-33258	Fitzgerald	100 ug	EUR 349
Description: Rabbit polyclonal Aquaporin PIP antibody

Os-PIP Antibody
abx018466-100ul	Abbexa	100 ul	EUR 384
Shipped within 5-10 working days.

PIP Conjugated Antibody
C36498	SAB	100ul	EUR 397

Anti-PIP antibody
STJ28477	St John's Laboratory	100 µl	EUR 277

Anti-PIP antibody
STJ192547	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to PIP

Prolactin Induced Protein (PIP) Polyclonal Antibody (Human)
4-PAM035Hu01	Cloud-Clone	EUR 262.00 EUR 2747.00 EUR 679.00 EUR 331.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1~Glu146) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prolactin Induced Protein (PIP)

Prolactin Induced Protein (PIP) Polyclonal Antibody (Mouse)
4-PAM035Mu01	Cloud-Clone	EUR 266.00 EUR 2813.00 EUR 694.00 EUR 337.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1~Asn146) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolactin Induced Protein (PIP)

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat)
4-PAM035Ra01	Cloud-Clone	EUR 275.00 EUR 2958.00 EUR 727.00 EUR 350.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1-Asn146) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP)

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat)
4-PAM035Ra02	Cloud-Clone	EUR 275.00 EUR 2958.00 EUR 727.00 EUR 350.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Asn41~Thr139) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP)

PIP siRNA
20-abx904034	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PIP siRNA
20-abx928673	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PIP siRNA
20-abx928674	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PIP Antibody, HRP conjugated
1-CSB-PA018020LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIP. Recognizes PIP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PIP Antibody, FITC conjugated
1-CSB-PA018020LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIP. Recognizes PIP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PIP Antibody, Biotin conjugated
1-CSB-PA018020LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIP. Recognizes PIP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GCDFP-15 / PIP Antibody
abx233381-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Anti-GCDFP15 / PIP antibody
STJ70914	St John's Laboratory	100 µg	EUR 359

Prolactin Induced Protein (PIP) Polyclonal Antibody (Human), APC
4-PAM035Hu01-APC	Cloud-Clone	EUR 368.00 EUR 3599.00 EUR 993.00 EUR 472.00 EUR 229.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1~Glu146) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prolactin Induced Protein (PIP). This antibody is labeled with APC.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Human), Biotinylated
4-PAM035Hu01-Biotin	Cloud-Clone	EUR 328.00 EUR 2697.00 EUR 786.00 EUR 404.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1~Glu146) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prolactin Induced Protein (PIP). This antibody is labeled with Biotin.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Human), Cy3
4-PAM035Hu01-Cy3	Cloud-Clone	EUR 449.00 EUR 4757.00 EUR 1283.00 EUR 588.00 EUR 264.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1~Glu146) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prolactin Induced Protein (PIP). This antibody is labeled with Cy3.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Human), FITC
4-PAM035Hu01-FITC	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1~Glu146) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prolactin Induced Protein (PIP). This antibody is labeled with FITC.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Human), HRP
4-PAM035Hu01-HRP	Cloud-Clone	EUR 335.00 EUR 3135.00 EUR 877.00 EUR 426.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1~Glu146) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prolactin Induced Protein (PIP). This antibody is labeled with HRP.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Human), PE
4-PAM035Hu01-PE	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1~Glu146) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prolactin Induced Protein (PIP). This antibody is labeled with PE.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Mouse), APC
4-PAM035Mu01-APC	Cloud-Clone	EUR 374.00 EUR 3689.00 EUR 1016.00 EUR 481.00 EUR 232.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1~Asn146) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolactin Induced Protein (PIP). This antibody is labeled with APC.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Mouse), Biotinylated
4-PAM035Mu01-Biotin	Cloud-Clone	EUR 332.00 EUR 2763.00 EUR 803.00 EUR 411.00 EUR 228.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1~Asn146) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolactin Induced Protein (PIP). This antibody is labeled with Biotin.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Mouse), Cy3
4-PAM035Mu01-Cy3	Cloud-Clone	EUR 457.00 EUR 4877.00 EUR 1313.00 EUR 600.00 EUR 267.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1~Asn146) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolactin Induced Protein (PIP). This antibody is labeled with Cy3.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Mouse), FITC
4-PAM035Mu01-FITC	Cloud-Clone	EUR 319.00 EUR 2971.00 EUR 832.00 EUR 405.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1~Asn146) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolactin Induced Protein (PIP). This antibody is labeled with FITC.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Mouse), HRP
4-PAM035Mu01-HRP	Cloud-Clone	EUR 341.00 EUR 3213.00 EUR 897.00 EUR 433.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1~Asn146) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolactin Induced Protein (PIP). This antibody is labeled with HRP.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Mouse), PE
4-PAM035Mu01-PE	Cloud-Clone	EUR 319.00 EUR 2971.00 EUR 832.00 EUR 405.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1~Asn146) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolactin Induced Protein (PIP). This antibody is labeled with PE.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), APC
4-PAM035Ra01-APC	Cloud-Clone	EUR 388.00 EUR 3887.00 EUR 1065.00 EUR 501.00 EUR 237.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1-Asn146) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with APC.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), Biotinylated
4-PAM035Ra01-Biotin	Cloud-Clone	EUR 343.00 EUR 2908.00 EUR 839.00 EUR 425.00 EUR 232.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1-Asn146) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with Biotin.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), Cy3
4-PAM035Ra01-Cy3	Cloud-Clone	EUR 476.00 EUR 5141.00 EUR 1379.00 EUR 626.00 EUR 275.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1-Asn146) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with Cy3.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), FITC
4-PAM035Ra01-FITC	Cloud-Clone	EUR 330.00 EUR 3129.00 EUR 872.00 EUR 420.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1-Asn146) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with FITC.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), HRP
4-PAM035Ra01-HRP	Cloud-Clone	EUR 353.00 EUR 3385.00 EUR 940.00 EUR 451.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1-Asn146) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with HRP.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), PE
4-PAM035Ra01-PE	Cloud-Clone	EUR 330.00 EUR 3129.00 EUR 872.00 EUR 420.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1-Asn146) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with PE.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), APC
4-PAM035Ra02-APC	Cloud-Clone	EUR 388.00 EUR 3887.00 EUR 1065.00 EUR 501.00 EUR 237.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Asn41~Thr139) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with APC.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), Biotinylated
4-PAM035Ra02-Biotin	Cloud-Clone	EUR 343.00 EUR 2908.00 EUR 839.00 EUR 425.00 EUR 232.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Asn41~Thr139) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with Biotin.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), Cy3
4-PAM035Ra02-Cy3	Cloud-Clone	EUR 476.00 EUR 5141.00 EUR 1379.00 EUR 626.00 EUR 275.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Asn41~Thr139) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with Cy3.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), FITC
4-PAM035Ra02-FITC	Cloud-Clone	EUR 330.00 EUR 3129.00 EUR 872.00 EUR 420.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Asn41~Thr139) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with FITC.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), HRP
4-PAM035Ra02-HRP	Cloud-Clone	EUR 353.00 EUR 3385.00 EUR 940.00 EUR 451.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Asn41~Thr139) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with HRP.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), PE
4-PAM035Ra02-PE	Cloud-Clone	EUR 330.00 EUR 3129.00 EUR 872.00 EUR 420.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Asn41~Thr139) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with PE.

Human PIP Antibody (Biotin Conjugate)
32081-05121	AssayPro	150 ug	EUR 369

Prolactin-Inducible Protein (PIP) Antibody
20-abx004889	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Prolactin-Inducible Protein (PIP) Antibody
abx217780-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Prolactin Induced Protein (PIP) Antibody
20-abx210246	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Prolactin Induced Protein (PIP) Antibody
20-abx210247	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Prolactin Induced Protein (PIP) Antibody
20-abx102473	Abbexa	EUR 467.00 EUR 133.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Prolactin Induced Protein (PIP) Antibody
20-abx102474	Abbexa	EUR 481.00 EUR 133.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Prolactin-Inducible Protein (PIP) Antibody
20-abx103058	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Prolactin Induced Protein (PIP) Antibody
20-abx128887	Abbexa	EUR 453.00 EUR 133.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Prolactin Induced Protein (PIP) Antibody
20-abx131067	Abbexa	EUR 481.00 EUR 133.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Prolactin Induced Protein (PIP) Antibody
20-abx174185	Abbexa	EUR 926.00 EUR 467.00	1 mg 200 ug
Please enquire.

Prolactin Induced Protein (PIP) Antibody
20-abx174186	Abbexa	EUR 982.00 EUR 495.00	1 mg 200 ug
Please enquire.

anti- GCDFP-15/PIP antibody
FNab03381	FN Test	100µg	EUR 585
Recommended dilution: IHC: 1:20-1:200 Immunogen: prolactin-induced protein Uniprot ID: P12273 Research Area: Cancer, Immunology
Description: Antibody raised against GCDFP-15/PIP

Anti-GCDFP-15/PIP antibody
PAab03381	Lifescience Market	100 ug	EUR 412

PIP Blocking Peptide
DF7933-BP	Affbiotech	1mg	EUR 195

PIP cloning plasmid
CSB-CL018020HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 441 Sequence: atgcgcttgctccagctcctgttcagggccagccctgccaccctgctcctggttctctgcctgcagttgggggccaacaaagctcaggacaacactcggaagatcataataaagaattttgacattcccaagtcagtacgtccaaatgacgaagtcactgcagtgcttgcagttca Show more
Description: A cloning plasmid for the PIP gene.

PIP cloning plasmid
CSB-CL018020HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 441 Sequence: atgcgcttgctccagctcctgttcagggccagccctgccaccctgctcctggttctctgcctgcagttgggggccaacaaagctcaggacaacactcggaagatcataataaagaattttgacattcccaagtcagtacgtccaaatgacgaagtcactgcagtgcttgcagttca Show more
Description: A cloning plasmid for the PIP gene.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Human), APC-Cy7
4-PAM035Hu01-APC-Cy7	Cloud-Clone	EUR 616.00 EUR 7078.00 EUR 1867.00 EUR 824.00 EUR 338.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1~Glu146) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prolactin Induced Protein (PIP). This antibody is labeled with APC-Cy7.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Mouse), APC-Cy7
4-PAM035Mu01-APC-Cy7	Cloud-Clone	EUR 628.00 EUR 7258.00 EUR 1912.00 EUR 842.00 EUR 344.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1~Asn146) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolactin Induced Protein (PIP). This antibody is labeled with APC-Cy7.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), APC-Cy7
4-PAM035Ra01-APC-Cy7	Cloud-Clone	EUR 657.00 EUR 7654.00 EUR 2011.00 EUR 882.00 EUR 355.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1-Asn146) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with APC-Cy7.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), APC-Cy7
4-PAM035Ra02-APC-Cy7	Cloud-Clone	EUR 657.00 EUR 7654.00 EUR 2011.00 EUR 882.00 EUR 355.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Asn41~Thr139) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with APC-Cy7.

Rabbit Prolactin- inducible protein homolog, PIP ELISA KIT
ELI-06874Ra	Lifescience Market	96 Tests	EUR 928

ELISA kit for Rabbit Prolactin-inducible protein (PIP)
KTE90066-48T	Abbkine	48T	EUR 354
The hormonally responsive prolactin-inducible protein gene is expressed in benign and malignant breast tumor tissues and in some normal exocrine organs such as sweat, salivary, and lacrimal glands.The PIP gene is 7 kb long with 4 exons ranging from 1 Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Prolactin-inducible protein (PIP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Prolactin-inducible protein (PIP)
KTE90066-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
The hormonally responsive prolactin-inducible protein gene is expressed in benign and malignant breast tumor tissues and in some normal exocrine organs such as sweat, salivary, and lacrimal glands.The PIP gene is 7 kb long with 4 exons ranging from 1 Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Prolactin-inducible protein (PIP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Prolactin-inducible protein (PIP)
KTE90066-96T	Abbkine	96T	EUR 572
The hormonally responsive prolactin-inducible protein gene is expressed in benign and malignant breast tumor tissues and in some normal exocrine organs such as sweat, salivary, and lacrimal glands.The PIP gene is 7 kb long with 4 exons ranging from 1 Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Prolactin-inducible protein (PIP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human PIP AssayLite Antibody (FITC Conjugate)
32081-05141	AssayPro	150 ug	EUR 428

Human PIP AssayLite Antibody (RPE Conjugate)
32081-05151	AssayPro	150 ug	EUR 428

Human PIP AssayLite Antibody (APC Conjugate)
32081-05161	AssayPro	150 ug	EUR 428

Human PIP AssayLite Antibody (PerCP Conjugate)
32081-05171	AssayPro	150 ug	EUR 471

Prolactin Induced Protein (PIP) Antibody (FITC)
20-abx271198	Abbexa	EUR 537.00 EUR 272.00 EUR 1664.00 EUR 759.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Prolactin Induced Protein (PIP) Antibody (FITC)
20-abx271240	Abbexa	EUR 523.00 EUR 258.00 EUR 1581.00 EUR 732.00 EUR 411.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Prolactin Induced Protein (PIP) Antibody (Biotin)
20-abx271464	Abbexa	EUR 509.00 EUR 258.00 EUR 1539.00 EUR 718.00 EUR 411.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Prolactin Induced Protein (PIP) Antibody (Biotin)
20-abx271506	Abbexa	EUR 495.00 EUR 258.00 EUR 1469.00 EUR 690.00 EUR 398.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

PIP protein (His tag)
80R-3014	Fitzgerald	100 ug	EUR 327
Description: Purified recombinant PIP protein (His tag)

Human PIP ELISA Kit
ELA-E2138h	Lifescience Market	96 Tests	EUR 824

Human PIP ELISA Kit
EHP0017	Abclonal	96Tests	EUR 521

Bovine PIP ELISA Kit
EBP0017	Abclonal	96Tests	EUR 521

Anserini PIP ELISA Kit
EAP0017	Abclonal	96Tests	EUR 521

Chicken PIP ELISA Kit
ECKP0017	Abclonal	96Tests	EUR 521

Canine PIP ELISA Kit
ECP0017	Abclonal	96Tests	EUR 521

Goat PIP ELISA Kit
EGTP0017	Abclonal	96Tests	EUR 521

PIP ELISA KIT|Human
EF004606	Lifescience Market	96 Tests	EUR 689

Mouse PIP shRNA Plasmid
20-abx972041	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat PIP shRNA Plasmid
20-abx986335	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human PIP shRNA Plasmid
20-abx953546	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Porcine PIP ELISA Kit
EPP0017	Abclonal	96Tests	EUR 521

Sheep PIP ELISA Kit
ESP0017	Abclonal	96Tests	EUR 521

Rat PIP ELISA Kit
ERP0017	Abclonal	96Tests	EUR 521

Monkey PIP ELISA Kit
EMKP0017	Abclonal	96Tests	EUR 521

Mouse PIP ELISA Kit
EMP0017	Abclonal	96Tests	EUR 521

PIP Recombinant Protein (Human)
RP023539	ABM	100 ug	Ask for price

PIP Recombinant Protein (Human)
RP023542	ABM	100 ug	Ask for price

PIP Recombinant Protein (Mouse)
RP162239	ABM	100 ug	Ask for price

PIP Recombinant Protein (Rat)
RP220592	ABM	100 ug	Ask for price

Human Prolactin-inducible protein (PIP)
1-CSB-EP018020HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 17.5 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Prolactin-inducible protein(PIP) expressed in E.coli

Human Prolactin-inducible protein (PIP)
1-CSB-YP018020HU	Cusabio	EUR 430.00 EUR 234.00 EUR 1508.00 EUR 642.00 EUR 1009.00 EUR 291.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 16 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Prolactin-inducible protein(PIP) expressed in Yeast

Human PIP AssayMax ELISA Kit
EP1505-1	AssayPro	96 Well Plate	EUR 477

Pip ORF Vector (Rat) (pORF)
ORF073532	ABM	1.0 ug DNA	EUR 506

PIP ORF Vector (Human) (pORF)
ORF007847	ABM	1.0 ug DNA	EUR 95

PIP ORF Vector (Human) (pORF)
ORF007848	ABM	1.0 ug DNA	EUR 95

Pip ORF Vector (Mouse) (pORF)
ORF054081	ABM	1.0 ug DNA	EUR 506

PIP Prolactin-Induced Protein Human
PROTP12273	BosterBio	Regular: 10ug	EUR 317
Description: The Prolactin-Induced Protein produced from Human Seminal Plasma has a molecular mass of 13.52kDa (calculated without glycosylation) containing 118 amino acid residues.

Recombinant Prolactin Induced Protein (PIP)
4-RPM035Hu01	Cloud-Clone	EUR 485.28 EUR 233.00 EUR 1544.80 EUR 581.60 EUR 1063.20 EUR 388.00 EUR 3712.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P12273 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 20.4kDa Isoelectric Point: 8.6
Description: Recombinant Human Prolactin Induced Protein expressed in: E.coli

Recombinant Prolactin Induced Protein (PIP)
4-RPM035Mu01	Cloud-Clone	EUR 485.28 EUR 233.00 EUR 1544.80 EUR 581.60 EUR 1063.20 EUR 388.00 EUR 3712.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P02816 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 48.8kDa Isoelectric Point: 5.7
Description: Recombinant Mouse Prolactin Induced Protein expressed in: E.coli

Recombinant Prolactin Induced Protein (PIP)
4-RPM035Ra01	Cloud-Clone	EUR 513.95 EUR 241.00 EUR 1652.32 EUR 617.44 EUR 1134.88 EUR 407.00 EUR 3980.80	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O70417 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 43.5kDa Isoelectric Point: Inquire
Description: Recombinant Rat Prolactin Induced Protein expressed in: E.coli

Recombinant Prolactin Induced Protein (PIP)
4-RPM035Ra02	Cloud-Clone	EUR 508.58 EUR 239.00 EUR 1632.16 EUR 610.72 EUR 1121.44 EUR 403.00 EUR 3930.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O70417 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 12.7kDa Isoelectric Point: Inquire
Description: Recombinant Rat Prolactin Induced Protein expressed in: E.coli

PIP ELISA Kit (Rat) (OKCD02771)
OKCD02771	Aviva Systems Biology	96 Wells	EUR 988
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 16.23 pg/mL

PIP ELISA Kit (Human) (OKCD09351)
OKCD09351	Aviva Systems Biology	96 Wells	EUR 909
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.255ng/mL

PIP ELISA Kit (Mouse) (OKEH03461)
OKEH03461	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

PIP ELISA Kit (Bovine) (OKEH03940)
OKEH03940	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: ;Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.17 ng/mL

Mycoplasma pneumoniae Putative proline iminopeptidase (pip)
1-CSB-EP305049MLW	Cusabio	EUR 611.00 EUR 309.00 EUR 1827.00 EUR 939.00 EUR 1218.00 EUR 397.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 50.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mycoplasma pneumoniae Putative proline iminopeptidase(pip) expressed in E.coli

Rat Prolactin-inducible protein homolog (Pip)
1-CSB-YP530344RA	Cusabio	EUR 504.00 EUR 265.00 EUR 1832.00 EUR 763.00 EUR 1216.00 EUR 334.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 15.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Prolactin-inducible protein homolog(Pip) expressed in Yeast

Rat Prolactin Induced Protein (PIP) Protein
20-abx165970	Abbexa	EUR 704.00 EUR 286.00 EUR 2193.00 EUR 843.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Prolactin Induced Protein (PIP) Protein
20-abx167865	Abbexa	EUR 676.00 EUR 286.00 EUR 2082.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rat Prolactin Induced Protein (PIP) Protein
20-abx068687	Abbexa	EUR 718.00 EUR 286.00 EUR 2221.00 EUR 857.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Mouse Prolactin Induced Protein (PIP) Protein
20-abx068688	Abbexa	EUR 676.00 EUR 286.00 EUR 2082.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Human Prolactin Induced Protein (PIP) Protein
20-abx260765	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Human Prolactin Induced Protein (PIP) Protein
20-abx263247	Abbexa	EUR 1609.00 EUR 328.00 EUR 230.00	100 ug 10 ug 2 µg
Shipped within 5-10 working days.

Pip sgRNA CRISPR Lentivector set (Rat)
K6992201	ABM	3 x 1.0 ug	EUR 339

Pip sgRNA CRISPR Lentivector set (Mouse)
K3407801	ABM	3 x 1.0 ug	EUR 339

PIP sgRNA CRISPR Lentivector set (Human)
K1652201	ABM	3 x 1.0 ug	EUR 339

Anti-GCDFP-15 Antibody Clone PIP/1571, Unconjugated-20ug
5304-MSM1-P0	EnQuireBio	20ug	EUR 233

Anti-GCDFP-15 Antibody Clone PIP/1571, Unconjugated-100ug
5304-MSM1-P1	EnQuireBio	100ug	EUR 428

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul	SAB	50ul	EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody
ABP57570-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody
ABP57572-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

MEK2 Rabbit Polyclonal Antibody
ABP57573-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK3 Rabbit Polyclonal Antibody
ABP57574-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

Nrf2 Rabbit Polyclonal Antibody
ABP57575-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody
ABP57575-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody
ABP57575-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

ATG4a Rabbit Polyclonal Antibody
ABP57576-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody
ABP57576-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody
ABP57576-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4b Rabbit Polyclonal Antibody
ABP57577-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG4b Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody
ABP57577-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG4b Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

PIP Rabbit Polyclonal Antibody