EHMT2 Rabbit Polyclonal Antibody

EHMT2 Rabbit Polyclonal Antibody

To Order Now:

EHMT2 Polyclonal Antibody

ABP58465-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human EHMT2 protein at amino acid sequence of 370-450
  • Applications tips:
Description: A polyclonal antibody for detection of EHMT2 from Human, Mouse. This EHMT2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EHMT2 protein at amino acid sequence of 370-450

EHMT2 Polyclonal Antibody

ABP58465-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human EHMT2 protein at amino acid sequence of 370-450
  • Applications tips:
Description: A polyclonal antibody for detection of EHMT2 from Human, Mouse. This EHMT2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EHMT2 protein at amino acid sequence of 370-450

EHMT2 Polyclonal Antibody

ABP58465-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human EHMT2 protein at amino acid sequence of 370-450
  • Applications tips:
Description: A polyclonal antibody for detection of EHMT2 from Human, Mouse. This EHMT2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EHMT2 protein at amino acid sequence of 370-450

EHMT2 Polyclonal Antibody

A-3019 100 µl
EUR 616.95
Description: reagents widely cited

EHMT2 Rabbit pAb

A1247-100ul 100 ul
EUR 308

EHMT2 Rabbit pAb

A1247-200ul 200 ul
EUR 459

EHMT2 Rabbit pAb

A1247-20ul 20 ul
EUR 183

EHMT2 Rabbit pAb

A1247-50ul 50 ul
EUR 223

EHMT2 Rabbit pAb

A2295-100ul 100 ul
EUR 308

EHMT2 Rabbit pAb

A2295-200ul 200 ul
EUR 459

EHMT2 Rabbit pAb

A2295-20ul 20 ul Ask for price

EHMT2 Rabbit pAb

A2295-50ul 50 ul Ask for price

Polyclonal EHMT2 Antibody (Center)

AMM07023G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EHMT2 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal EHMT2 Antibody (Center)

APC00113G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EHMT2 (Center). This antibody is tested and proven to work in the following applications:

EHMT2 antibody

70R-7930 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal EHMT2 antibody

EHMT2 Antibody

ABD6379 100 ug
EUR 438

EHMT2 Antibody

32257-100ul 100ul
EUR 252

EHMT2 Antibody

EUR 414

EHMT2 antibody

70R-17027 50 ul
EUR 435
Description: Rabbit polyclonal EHMT2 antibody

EHMT2 Antibody

DF6379 200ul
EUR 304
Description: EHMT2 Antibody detects endogenous levels of total EHMT2.

EHMT2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EHMT2. Recognizes EHMT2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal (Mouse) Ehmt2 Antibody (Center)

AMM08708G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human (Mouse) Ehmt2 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal (Mouse) Ehmt2 Antibody (N-term)

AMM08709G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human (Mouse) Ehmt2 (N-term). This antibody is tested and proven to work in the following applications:

EHMT2 Conjugated Antibody

C32257 100ul
EUR 397

EHMT2 / G9a Antibody

abx232679-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Anti-EHMT2 Antibody

EUR 479

Anti-EHMT2 antibody

STJ23499 100 µl
EUR 277
Description: This gene encodes a methyltransferase that methylates lysine residues of histone H3. Methylation of H3 at lysine 9 by this protein results in recruitment of additional epigenetic regulators and repression of transcription. This gene was initially thought to be two different genes, NG36 and G9a, adjacent to each other in the HLA locus. Alternative splicing results in multiple transcript variants.

Anti-EHMT2 antibody

STJ23500 100 µl
EUR 277
Description: This gene encodes a methyltransferase that methylates lysine residues of histone H3. Methylation of H3 at lysine 9 by this protein results in recruitment of additional epigenetic regulators and repression of transcription. This gene was initially thought to be two different genes, NG36 and G9a, adjacent to each other in the HLA locus. Alternative splicing results in multiple transcript variants.

Anti-EHMT2 antibody

STJ192390 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to EHMT2


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT18033 2 ug
EUR 300

anti- EHMT2/G9a antibody

FNab02679 100µg
EUR 505.25
  • Immunogen: euchromatic histone-lysine N-methyltransferase 2
  • Uniprot ID: Q96KQ7
  • Research Area: Stem cells, Epigenetics, Developmental biology
Description: Antibody raised against EHMT2/G9a

Anti-EHMT2/G9a antibody

PAab02679 100 ug
EUR 355


HY-111778 10mM/1mL
EUR 744


HY-111904 10mg
EUR 1025

EHMT2 Blocking Peptide

33R-9760 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EHMT2 antibody, catalog no. 70R-7930

EHMT2 Blocking Peptide

DF6379-BP 1mg
EUR 195

EHMT2 cloning plasmid

CSB-CL846653HU-10ug 10ug
EUR 1112
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3006
  • Sequence: atgagtgatgatgtccactcactgggaaaggtgacctcagatctggccaaaaggaggaagctgaactcaggaggtggcctgtcggaggagttaggttctgcccggcgttcaggagaagtgaccctgacgaaaggggaccccgggtccctggaggagtgggagacggtggtgggtg
  • Show more
Description: A cloning plasmid for the EHMT2 gene.


PVT18089 2 ug
EUR 300


PVT18614 2 ug
EUR 341

pOTB7-EHMT2 Plasmid

PVTB01045-1 2 ug
EUR 356

Ehmt2 ELISA Kit| Mouse Histone-lysine N-methyltransferase EHMT2

EF014211 96 Tests
EUR 689

Mouse EHMT2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-26579h 96 Tests
EUR 824


EF010427 96 Tests
EUR 689

Mouse Ehmt2 ELISA KIT

ELI-47578m 96 Tests
EUR 865

Human EHMT2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

G9a/Ehmt2 (anti G9a antibody, clone# A8620A)

PP-A8620A-00 0.1mg/100uL
EUR 623
Description: The G9a/Ehmt2 (anti G9a antibody, clone# A8620A) is available in Europe and for worldwide shipping via Gentaur.

EHMT2 ORF Vector (Human) (pORF)

ORF003444 1.0 ug DNA
EUR 95

Ehmt2 ORF Vector (Rat) (pORF)

ORF066421 1.0 ug DNA
EUR 506

Ehmt2 ORF Vector (Mouse) (pORF)

ORF043720 1.0 ug DNA
EUR 506

Ehmt2 ORF Vector (Mouse) (pORF)

ORF043721 1.0 ug DNA
EUR 506

Euchromatic Histone-Lysine N-Methyltransferase 2 (EHMT2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Euchromatic Histone-Lysine N-Methyltransferase 2 (EHMT2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Euchromatic Histone-Lysine N-Methyltransferase 2 (EHMT2) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

EHMT2 sgRNA CRISPR Lentivector set (Human)

K0663801 3 x 1.0 ug
EUR 339

Ehmt2 sgRNA CRISPR Lentivector set (Mouse)

K4341101 3 x 1.0 ug
EUR 339

Ehmt2 sgRNA CRISPR Lentivector set (Rat)

K7325301 3 x 1.0 ug
EUR 339

EHMT2-AS1 ORF Vector (Human) (pORF)

ORF018770 1.0 ug DNA Ask for price

EHMT2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0663802 1.0 ug DNA
EUR 154

EHMT2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0663803 1.0 ug DNA
EUR 154

EHMT2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0663804 1.0 ug DNA
EUR 154

Ehmt2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4341102 1.0 ug DNA
EUR 154

Ehmt2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4341103 1.0 ug DNA
EUR 154

Ehmt2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4341104 1.0 ug DNA
EUR 154

Ehmt2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7325302 1.0 ug DNA
EUR 154

Ehmt2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7325303 1.0 ug DNA
EUR 154

Ehmt2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7325304 1.0 ug DNA
EUR 154

Recombinant human Histone-lysine N-methyltransferase EHMT2

P1681 100ug Ask for price
  • Uniprot ID: Q96KQ7
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Histone-lysine N-methyltransferase EHMT2

EHMT2 Protein Vector (Mouse) (pPB-C-His)

PV174878 500 ng
EUR 1065

EHMT2 Protein Vector (Mouse) (pPB-N-His)

PV174879 500 ng
EUR 1065

EHMT2 Protein Vector (Mouse) (pPM-C-HA)

PV174880 500 ng
EUR 1065

EHMT2 Protein Vector (Mouse) (pPM-C-His)

PV174881 500 ng
EUR 1065

EHMT2 Protein Vector (Mouse) (pPB-C-His)

PV174882 500 ng
EUR 1065

EHMT2 Protein Vector (Mouse) (pPB-N-His)

PV174883 500 ng
EUR 1065

EHMT2 Protein Vector (Mouse) (pPM-C-HA)

PV174884 500 ng
EUR 1065

EHMT2 Protein Vector (Mouse) (pPM-C-His)

PV174885 500 ng
EUR 1065

EHMT2 Protein Vector (Human) (pPB-C-His)

PV013773 500 ng
EUR 329

EHMT2 Protein Vector (Human) (pPB-N-His)

PV013774 500 ng
EUR 329

EHMT2 Protein Vector (Human) (pPM-C-HA)

PV013775 500 ng
EUR 329

EHMT2 Rabbit Polyclonal Antibody