MFSD8 Rabbit Polyclonal Antibody
MFSD8 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
MFSD8 Polyclonal Antibody |
ABP59268-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human MFSD8 protein at amino acid sequence of 351-400
- Applications tips:
|
Description: A polyclonal antibody for detection of MFSD8 from Human. This MFSD8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MFSD8 protein at amino acid sequence of 351-400 |
MFSD8 Polyclonal Antibody |
ABP59268-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human MFSD8 protein at amino acid sequence of 351-400
- Applications tips:
|
Description: A polyclonal antibody for detection of MFSD8 from Human. This MFSD8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MFSD8 protein at amino acid sequence of 351-400 |
MFSD8 Polyclonal Antibody |
A66782 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
MFSD8 antibody |
70R-9335 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal MFSD8 antibody |
MFSD8 Antibody |
1-CSB-PA844087LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MFSD8. Recognizes MFSD8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
Polyclonal MFSD8 antibody - middle region |
APR17366G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MFSD8 - middle region. This antibody is tested and proven to work in the following applications: |
MFSD8 Polyclonal Antibody, HRP Conjugated |
A66783 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
MFSD8 Polyclonal Antibody, FITC Conjugated |
A66784 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
MFSD8 Polyclonal Antibody, Biotin Conjugated |
A66785 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
anti- MFSD8 antibody |
FNab05155 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: major facilitator superfamily domain containing 8
- Uniprot ID: Q8NHS3
- Gene ID: 256471
- Research Area: Signal Transduction
|
Description: Antibody raised against MFSD8 |
Anti-MFSD8 antibody |
STJ192571 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to MFSD8 |
MFSD8 siRNA |
20-abx924072 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MFSD8 siRNA |
20-abx924073 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MFSD8 Antibody, HRP conjugated |
1-CSB-PA844087LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MFSD8. Recognizes MFSD8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
MFSD8 Antibody, FITC conjugated |
1-CSB-PA844087LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MFSD8. Recognizes MFSD8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
MFSD8 Antibody, Biotin conjugated |
1-CSB-PA844087LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MFSD8. Recognizes MFSD8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
MFSD8 Blocking Peptide |
33R-2891 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MFSD8 antibody, catalog no. 70R-9335 |
MFSD8 cloning plasmid |
CSB-CL844087HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1557
- Sequence: atggccggcctgcggaacgaaagtgaacaggagccgctcttaggcgacacacctggaagcagagaatgggacattttagagactgaagagcattataagagccgatggagatctattaggattttatatcttactatgtttctcagcagtgtagggttttctgtagtgatgatgt
- Show more
|
Description: A cloning plasmid for the MFSD8 gene. |
Mouse MFSD8 shRNA Plasmid |
20-abx977704 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human MFSD8 shRNA Plasmid |
20-abx966758 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MFSD8 Recombinant Protein (Human) |
RP019285 |
ABM |
100 ug |
Ask for price |
MFSD8 Recombinant Protein (Rat) |
RP211562 |
ABM |
100 ug |
Ask for price |
MFSD8 Recombinant Protein (Mouse) |
RP150473 |
ABM |
100 ug |
Ask for price |
MFSD8 ORF Vector (Human) (pORF) |
ORF006429 |
ABM |
1.0 ug DNA |
EUR 95 |
MFSD8 Rabbit Polyclonal Antibody