MFSD8 Rabbit Polyclonal Antibody

MFSD8 Rabbit Polyclonal Antibody

To Order Now:

MFSD8 Polyclonal Antibody

ABP59268-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MFSD8 protein at amino acid sequence of 351-400
  • Applications tips:
Description: A polyclonal antibody for detection of MFSD8 from Human. This MFSD8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MFSD8 protein at amino acid sequence of 351-400

MFSD8 Polyclonal Antibody

ES11413-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MFSD8 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

MFSD8 Polyclonal Antibody

ES11413-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MFSD8 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

MFSD8 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MFSD8. Recognizes MFSD8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

MFSD8 antibody

70R-9335 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal MFSD8 antibody

Polyclonal MFSD8 antibody - middle region

APR17366G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MFSD8 - middle region. This antibody is tested and proven to work in the following applications:

MFSD8 Polyclonal Antibody, HRP Conjugated

A66783 100 µg
EUR 570.55
Description: Ask the seller for details

MFSD8 Polyclonal Antibody, FITC Conjugated

A66784 100 µg
EUR 570.55
Description: The best epigenetics products

MFSD8 Polyclonal Antibody, Biotin Conjugated

A66785 100 µg
EUR 570.55
Description: kits suitable for this type of research

anti- MFSD8 antibody

FNab05155 100µg
EUR 548.75
  • Immunogen: major facilitator superfamily domain containing 8
  • Uniprot ID: Q8NHS3
  • Gene ID: 256471
  • Research Area: Signal Transduction
Description: Antibody raised against MFSD8

Anti-MFSD8 antibody

PAab05155 100 ug
EUR 386

Anti-MFSD8 antibody

STJ192571 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MFSD8


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MFSD8 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MFSD8. Recognizes MFSD8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MFSD8 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MFSD8. Recognizes MFSD8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MFSD8 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MFSD8. Recognizes MFSD8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MFSD8 Blocking Peptide

33R-2891 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MFSD8 antibody, catalog no. 70R-9335

MFSD8 cloning plasmid

CSB-CL844087HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1557
  • Sequence: atggccggcctgcggaacgaaagtgaacaggagccgctcttaggcgacacacctggaagcagagaatgggacattttagagactgaagagcattataagagccgatggagatctattaggattttatatcttactatgtttctcagcagtgtagggttttctgtagtgatgatgt
  • Show more
Description: A cloning plasmid for the MFSD8 gene.


ELI-14023h 96 Tests
EUR 824

Mouse Mfsd8 ELISA KIT

ELI-19506m 96 Tests
EUR 865


EF000770 96 Tests
EUR 689

Mouse MFSD8 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MFSD8 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MFSD8 Recombinant Protein (Human)

RP019285 100 ug Ask for price

MFSD8 Recombinant Protein (Mouse)

RP150473 100 ug Ask for price

MFSD8 Recombinant Protein (Rat)

RP211562 100 ug Ask for price

Mfsd8 ORF Vector (Rat) (pORF)

ORF070522 1.0 ug DNA
EUR 506

MFSD8 Rabbit Polyclonal Antibody