GDNF Rabbit Polyclonal Antibody
GDNF Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
GDNF Polyclonal Antibody |
ABP58627-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human GDNF protein at amino acid sequence of 100-180
- Applications tips:
|
Description: A polyclonal antibody for detection of GDNF from Human, Mouse, Rat. This GDNF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GDNF protein at amino acid sequence of 100-180 |
GDNF Polyclonal Antibody |
ABP58627-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human GDNF protein at amino acid sequence of 100-180
- Applications tips:
|
Description: A polyclonal antibody for detection of GDNF from Human, Mouse, Rat. This GDNF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GDNF protein at amino acid sequence of 100-180 |
GDNF Polyclonal Antibody |
ABP58627-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human GDNF protein at amino acid sequence of 100-180
- Applications tips:
|
Description: A polyclonal antibody for detection of GDNF from Human, Mouse, Rat. This GDNF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GDNF protein at amino acid sequence of 100-180 |
GDNF Polyclonal Antibody |
ES11350-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against GDNF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
GDNF Polyclonal Antibody |
ES11350-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against GDNF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
GDNF Rabbit pAb |
A14639-100ul |
Abclonal |
100 ul |
EUR 308 |
GDNF Rabbit pAb |
A14639-200ul |
Abclonal |
200 ul |
EUR 459 |
GDNF Rabbit pAb |
A14639-20ul |
Abclonal |
20 ul |
EUR 183 |
GDNF Rabbit pAb |
A14639-50ul |
Abclonal |
50 ul |
EUR 223 |
GDNF Rabbit pAb |
A14734-100ul |
Abclonal |
100 ul |
EUR 308 |
GDNF Rabbit pAb |
A14734-200ul |
Abclonal |
200 ul |
EUR 459 |
GDNF Rabbit pAb |
A14734-20ul |
Abclonal |
20 ul |
EUR 183 |
GDNF Rabbit pAb |
A14734-50ul |
Abclonal |
50 ul |
EUR 223 |
Anti-GDNF Rabbit Monoclonal Antibody |
M00710 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal GDNF Antibody. Validated in WB and tested in Human, Mouse, Rat. |
Rabbit GDNF ELISA Kit |
ERTG0160 |
Abclonal |
96Tests |
EUR 521 |
Human Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit |
DLR-GDNF-Hu-48T |
DL Develop |
48T |
EUR 441 |
- Should the Human Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Glial Cell Line Derived Neurotrophic Factor (GDNF) in samples from serum, plasma, tissue homogenates, cell lysates, cerebrospinal fluid, cell culture supernates or other biological fluids. |
Human Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit |
DLR-GDNF-Hu-96T |
DL Develop |
96T |
EUR 570 |
- Should the Human Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Glial Cell Line Derived Neurotrophic Factor (GDNF) in samples from serum, plasma, tissue homogenates, cell lysates, cerebrospinal fluid, cell culture supernates or other biological fluids. |
Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit |
DLR-GDNF-Mu-48T |
DL Develop |
48T |
EUR 489 |
- Should the Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit |
DLR-GDNF-Mu-96T |
DL Develop |
96T |
EUR 635 |
- Should the Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rat Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit |
DLR-GDNF-Ra-48T |
DL Develop |
48T |
EUR 467 |
- Should the Rat Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Glial Cell Line Derived Neurotrophic Factor (GDNF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rat Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit |
DLR-GDNF-Ra-96T |
DL Develop |
96T |
EUR 605 |
- Should the Rat Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Glial Cell Line Derived Neurotrophic Factor (GDNF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit |
RDR-GDNF-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 455 |
Human Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit |
RDR-GDNF-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 629 |
Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit |
RDR-GDNF-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit |
RDR-GDNF-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Rat Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit |
RDR-GDNF-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 486 |
Rat Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit |
RDR-GDNF-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 672 |
Human Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit |
RD-GDNF-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 436 |
Human Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit |
RD-GDNF-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 601 |
Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit |
RD-GDNF-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 489 |
Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit |
RD-GDNF-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 677 |
Rat Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit |
RD-GDNF-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 465 |
Rat Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit |
RD-GDNF-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 643 |
GDNF antibody |
20R-1778 |
Fitzgerald |
100 ug |
EUR 651 |
Description: Rabbit polyclonal GDNF antibody |
GDNF antibody |
70R-12262 |
Fitzgerald |
100 ug |
EUR 527 |
Description: Rabbit polyclonal GDNF antibody |
GDNF antibody |
70R-14004 |
Fitzgerald |
100 ug |
EUR 322 |
Description: Affinity purified Rabbit polyclonal GDNF antibody |
GDNF Antibody |
49556-100ul |
SAB |
100ul |
EUR 333 |
GDNF Antibody |
49556-50ul |
SAB |
50ul |
EUR 239 |
GDNF Antibody |
45120-100ul |
SAB |
100ul |
EUR 252 |
GDNF Antibody |
45120-50ul |
SAB |
50ul |
EUR 187 |
GDNF Antibody |
DF7727 |
Affbiotech |
200ul |
EUR 304 |
Description: GDNF Antibody detects endogenous levels of total GDNF. |
GDNF antibody |
70R-GR020 |
Fitzgerald |
50 ug |
EUR 273 |
Description: Affinity purified Rabbit polyclonal GDNF antibody |
GDNF Conjugated Antibody |
C49556 |
SAB |
100ul |
EUR 397 |
GDNF Conjugated Antibody |
C45120 |
SAB |
100ul |
EUR 397 |
Anti-GDNF Antibody |
PA1465 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-GDNF Antibody |
PB9069 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-GDNF antibody |
STJ116846 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The recombinant form of this protein, a highly conserved neurotrophic factor, was shown to promote the survival and differentiation of dopaminergic neurons in culture, and was able to prevent apoptosis of motor neurons induced by axotomy. This protein is a ligand for the product of the RET (rearranged during transfection) protooncogene. Mutations in this gene may be associated with Hirschsprung disease and Tourette syndrome. This gene encodes multiple protein isoforms that may undergo similar proteolytic processing. |
Anti-GDNF antibody |
STJ116934 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The recombinant form of this protein, a highly conserved neurotrophic factor, was shown to promote the survival and differentiation of dopaminergic neurons in culture, and was able to prevent apoptosis of motor neurons induced by axotomy. This protein is a ligand for the product of the RET (rearranged during transfection) protooncogene. Mutations in this gene may be associated with Hirschsprung disease and Tourette syndrome. This gene encodes multiple protein isoforms that may undergo similar proteolytic processing. |
Anti-GDNF antibody |
STJ192508 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to GDNF |
GDNF protein |
30R-2209 |
Fitzgerald |
25 ug |
EUR 500 |
Description: Purified recombinant Human GDNF protein |
GDNF protein |
30R-2460 |
Fitzgerald |
10 ug |
EUR 325 |
Description: Purified recombinant Human GDNF protein |
GDNF protein |
30R-AG008 |
Fitzgerald |
2 ug |
EUR 127 |
Description: Purified recombinant Human GDNF protein |
GDNF protein |
30R-AG038 |
Fitzgerald |
10 ug |
EUR 273 |
Description: Purified recombinant Human GDNF protein |
GDNF protein |
30R-AG039 |
Fitzgerald |
10 ug |
EUR 273 |
Description: Purified recombinant Human GDNF protein |
GDNF siRNA |
20-abx902122 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GDNF siRNA |
20-abx917747 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GDNF siRNA |
20-abx917748 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GDNF Biotinylated |
GT15007B |
Neuromics |
50 ug |
EUR 552 |
GDNF, human |
RC218-25 |
BBI Biotech |
2ug |
EUR 101.33 |
- Product category: Proteins/Recombinant Proteins/Neurotrophins
|
GDNF, rat |
RC258-25 |
BBI Biotech |
2ug |
EUR 104.38 |
- Product category: Proteins/Recombinant Proteins/Neurotrophins
|
anti-GDNF |
YF-PA11999 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to GDNF |
anti-GDNF |
YF-PA12000 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to GDNF |
anti-GDNF |
YF-PA23773 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to GDNF |
GDNF recombinant monoclonal antibody |
A5308 |
Bimake |
100ul X 3 |
EUR 595 |
- Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
- Show more
|
Description: A recombinant monoclonal antibody from rabbit against human GDNF for WB, IHC,ELISA |
Antibody for Human GDNF |
SPC-710D |
Stressmarq |
0.1mg |
EUR 354 |
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is unconjugated. |
Antibody for Human GDNF |
SPC-710D-A390 |
Stressmarq |
0.1mg |
EUR 401 |
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to ATTO 390. |
Antibody for Human GDNF |
SPC-710D-A488 |
Stressmarq |
0.1mg |
EUR 400 |
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to ATTO 488. |
Antibody for Human GDNF |
SPC-710D-A565 |
Stressmarq |
0.1mg |
EUR 400 |
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to ATTO 565. |
Antibody for Human GDNF |
SPC-710D-A594 |
Stressmarq |
0.1mg |
EUR 400 |
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to ATTO 594. |
Antibody for Human GDNF |
SPC-710D-A633 |
Stressmarq |
0.1mg |
EUR 400 |
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to ATTO 633. |
Antibody for Human GDNF |
SPC-710D-A655 |
Stressmarq |
0.1mg |
EUR 400 |
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to ATTO 655. |
Antibody for Human GDNF |
SPC-710D-A680 |
Stressmarq |
0.1mg |
EUR 400 |
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to ATTO 680. |
Antibody for Human GDNF |
SPC-710D-A700 |
Stressmarq |
0.1mg |
EUR 400 |
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to ATTO 700. |
Antibody for Human GDNF |
SPC-710D-ALP |
Stressmarq |
0.1mg |
EUR 394 |
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to Alkaline Phosphatase. |
Antibody for Human GDNF |
SPC-710D-APC |
Stressmarq |
0.1mg |
EUR 399 |
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to APC . |
Antibody for Human GDNF |
SPC-710D-APCCY7 |
Stressmarq |
0.1mg |
EUR 471 |
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to APC/Cy7. |
Antibody for Human GDNF |
SPC-710D-BI |
Stressmarq |
0.1mg |
EUR 396 |
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to Biotin. |
Antibody for Human GDNF |
SPC-710D-DY350 |
Stressmarq |
0.1mg |
EUR 414 |
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to Dylight 350. |
Antibody for Human GDNF |
SPC-710D-DY405 |
Stressmarq |
0.1mg |
EUR 403 |
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to Dylight 405. |
Antibody for Human GDNF |
SPC-710D-DY488 |
Stressmarq |
0.1mg |
EUR 393 |
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to Dylight 488. |
Antibody for Human GDNF |
SPC-710D-DY594 |
Stressmarq |
0.1mg |
EUR 395 |
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to Dylight 594. |
Antibody for Human GDNF |
SPC-710D-DY633 |
Stressmarq |
0.1mg |
EUR 390 |
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to Dylight 633. |
Antibody for Human GDNF |
SPC-710D-FITC |
Stressmarq |
0.1mg |
EUR 392 |
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to FITC. |
Antibody for Human GDNF |
SPC-710D-HRP |
Stressmarq |
0.1mg |
EUR 388 |
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to HRP. |
Antibody for Human GDNF |
SPC-710D-P594 |
Stressmarq |
0.1mg |
EUR 407 |
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to PE/ATTO 594. |
Antibody for Human GDNF |
SPC-710D-PCP |
Stressmarq |
0.1mg |
EUR 399 |
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to PerCP. |
Antibody for Human GDNF |
SPC-710D-RPE |
Stressmarq |
0.1mg |
EUR 397 |
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to RPE . |
Antibody for Human GDNF |
SPC-710D-STR |
Stressmarq |
0.1mg |
EUR 398 |
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to Streptavidin. |
Antibody for Human GDNF |
SPC-710S |
Stressmarq |
0.012mg |
EUR 65 |
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is unconjugated. |
Glial cell derived neurotrophic factor (GDNF) polyclonal antibody |
ABP-PAB-10125 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Cytokines, Chemokines, Growth Factors
- Brand:
|
GDNF Blocking Peptide |
33R-10575 |
Fitzgerald |
50 ug |
EUR 349 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GDNF antibody, catalog no. 20R-1778 |
GDNF Blocking Peptide |
33R-11039 |
Fitzgerald |
50 ug |
EUR 191 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GDNF antibody, catalog no. 70R-12262 |
GDNF Blocking Peptide |
5098BP-50 |
Biovision |
|
EUR 153 |
GDNF, human recombinant |
4097-10 |
Biovision |
|
EUR 245 |
GDNF, human recombinant |
4097-1000 |
Biovision |
|
EUR 5270 |
GDNF, human recombinant |
4097-50 |
Biovision |
|
EUR 697 |
GDNF Blocking Peptide |
DF7727-BP |
Affbiotech |
1mg |
EUR 195 |
GDNF, murine recombinant |
7156-10 |
Biovision |
|
EUR 278 |
GDNF, murine recombinant |
7156-50 |
Biovision |
|
EUR 1132 |
GDNF, rat recombinant |
7157-10 |
Biovision |
|
EUR 278 |
GDNF, rat recombinant |
7157-50 |
Biovision |
|
EUR 1132 |
GDNF cloning plasmid |
CSB-CL009356HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 636
- Sequence: atgaagttatgggatgtcgtggctgtctgcctggtgctgctccacaccgcgtccgccttcccgctgcccgccggtaagaggcctcccgaggcgcccgccgaagaccgctccctcggccgccgccgcgcgcccttcgcgctgagcagtgactcaaatatgccagaggattatcctga
- Show more
|
Description: A cloning plasmid for the GDNF gene. |
GDNF (Human, Mouse) |
PR27022 |
Neuromics |
2 ug |
EUR 191 |
Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Human) |
4-PAA043Hu01 |
Cloud-Clone |
-
EUR 217.00
-
EUR 2048.00
-
EUR 520.00
-
EUR 268.00
-
EUR 201.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GDNF (Ser78~Ile211)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Glial Cell Line Derived Neurotrophic Factor (GDNF) |
Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Mouse) |
4-PAA043Mu01 |
Cloud-Clone |
-
EUR 236.00
-
EUR 2338.00
-
EUR 586.00
-
EUR 294.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GDNF (Asp79~Leu217)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF) |
Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Rat) |
4-PAA043Ra01 |
Cloud-Clone |
-
EUR 227.00
-
EUR 2206.00
-
EUR 556.00
-
EUR 282.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GDNF (Ser78~Ile211)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Glial Cell Line Derived Neurotrophic Factor (GDNF) |
Human GDNF ELISA Kit |
55R-1581 |
Fitzgerald |
1 kit |
EUR 590 |
Description: ELISA kit for detection of GDNF in the research laboratory |
Rat GDNF ELISA Kit |
55R-1582 |
Fitzgerald |
1 kit |
EUR 590 |
Description: ELISA kit for detection of GDNF in the research laboratory |
Human GDNF ELISA Kit |
EHG0160 |
Abclonal |
96Tests |
EUR 521 |
Goat GDNF ELISA Kit |
EGTG0160 |
Abclonal |
96Tests |
EUR 521 |
Bovine GDNF ELISA Kit |
EBG0160 |
Abclonal |
96Tests |
EUR 521 |
Canine GDNF ELISA Kit |
ECG0160 |
Abclonal |
96Tests |
EUR 521 |
Chicken GDNF ELISA Kit |
ECKG0160 |
Abclonal |
96Tests |
EUR 521 |
Anserini GDNF ELISA Kit |
EAG0160 |
Abclonal |
96Tests |
EUR 521 |
Rat GDNF shRNA Plasmid |
20-abx985038 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse GDNF shRNA Plasmid |
20-abx970512 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human GDNF shRNA Plasmid |
20-abx951777 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse GDNF ELISA Kit |
EMG0160 |
Abclonal |
96Tests |
EUR 521 |
Rat GDNF ELISA Kit |
ERG0160 |
Abclonal |
96Tests |
EUR 521 |
Sheep GDNF ELISA Kit |
ESG0160 |
Abclonal |
96Tests |
EUR 521 |
GDNF Receptor Alpha 1 |
GT15004 |
Neuromics |
100 ug |
EUR 526 |
GDNF Receptor Alpha 2 |
GT15005 |
Neuromics |
100 ug |
EUR 526 |
GDNF Receptor Alpha 4 |
GT15083 |
Neuromics |
100 ug |
EUR 526 |
GDNF Receptor Alpha 1 |
GT15108 |
Neuromics |
100 ug |
EUR 500 |
GDNF Receptor Alpha 3 |
GT15123 |
Neuromics |
100 ug |
EUR 526 |
Monkey GDNF ELISA Kit |
EMKG0160 |
Abclonal |
96Tests |
EUR 521 |
Porcine GDNF ELISA Kit |
EPG0160 |
Abclonal |
96Tests |
EUR 521 |
GDNF (Human) ELISA Kit |
K4184-100 |
Biovision |
|
EUR 805 |
Rat GDNF ELISA kit |
LF-EK50057 |
Abfrontier |
1×96T |
EUR 648 |
Human GDNF ELISA kit |
LF-EK50637 |
Abfrontier |
1×96T |
EUR 648 |
Mouse GDNF ELISA Kit |
LF-EK50960 |
Abfrontier |
1×96T |
EUR 648 |
GDNF Receptor Alpha 1 |
MO15093 |
Neuromics |
500 ug |
EUR 513 |
Recombinant Murine GDNF Protein |
PROTP48540-1 |
BosterBio |
10ug |
EUR 317 |
Description: GDNF is a disulfide-linked homodimeric neurotrophic factor structurally related to Artemin, Neurturin and Persephin. These proteins belong to the cysteine-knot superfamily of growth factors that assume stable dimeric protein structures. GDNF signals through a multicomponent receptor system, composed of a RET and one of the four GFR α(α1-α4) receptors. GDNF specifically promotes dopamine uptake and survival and morphological differentiation of midbrain neurons. Using Parkinson’s disease mouse model, GDNF has been shown to improve conditions such as bradykinesia, rigidity, and postural instability. The functional murine GDNF ligand is a disulfide-linked homodimer, of two 15.1 kDa polypeptide chains called monomers. Each monomer contains seven conserved cysteine residues, one of which is used for inter-chain disulfide bridging and the others are involved in intramolecular ring formation known as the cysteine knot configuration. |
Recombinant Rat GDNF Protein |
PROTQ07731-1 |
BosterBio |
10ug |
EUR 317 |
Description: GDNF is a disulfide-linked homodimeric neurotrophic factor structurally related to Artemin, Neurturin and Persephin. These proteins belong to the cysteine-knot superfamily of growth factors that assume stable dimeric protein structures. GDNF signals through a multicomponent receptor system, composed of a RET and one of the four GFR α(α1-α4) receptors. GDNF specifically promotes dopamine uptake and survival and morphological differentiation of midbrain neurons. Using Parkinson’s disease mouse model, GDNF has been shown to improve conditions such as bradykinesia, rigidity, and postural instability. The functional rat GDNF ligand is a disulfide-linked homodimer, of two 15 kDa polypeptide chains called monomers. Each monomer contains seven conserved cysteine residues, one of which (Cys 101) is used for inter-chain disulfide bridging and the others are involved in intramolecular ring formation known as the cysteine knot configuration. |
GDNF (Rat), Carrier Free |
PR15008CF |
Neuromics |
50 ug |
EUR 1277 |
Recombinant Human GDNF Protein |
PROTP39905-1 |
BosterBio |
10ug |
EUR 317 |
Description: GDNF is a disulfide-linked homodimeric neurotrophic factor structurally related to Artemin, Neurturin and Persephin. These proteins belong to the cysteine-knot superfamily of growth factors that assume stable dimeric protein structures. GDNF signals through a multicomponent receptor system, composed of a RET and one of the four GFRα (α1-α4) receptors. GDNF specifically promotes dopamine uptake and survival and morphological differentiation of midbrain neurons. Using Parkinson's disease mouse model, GDNF has been shown to improve conditions such as bradykinesia, rigidity, and postural instability. The functional human GDNF ligand is a disulfide-linked homodimer, of two 15 kDa polypeptide chains called monomers. Each monomer contains seven conserved cysteine residues, one of which (Cys 101) is used for inter-chain disulfide bridging and the others are involved in intramolecular ring formation known as the cysteine knot configuration. |
GDNF Receptor Alpha 3 |
RA30017 |
Neuromics |
50 ug |
EUR 605 |
Human GDNF ELISA Kit |
RK00291 |
Abclonal |
96 Tests |
EUR 521 |
Recombinant Human GDNF Protein |
RP00835 |
Abclonal |
10 μg |
EUR 221 |
Human GDNF ELISA Kit |
STJ150512 |
St John's Laboratory |
1 kit |
EUR 412 |
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of GDNF in human serum, plasma and other biological fluids |
Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Human), APC |
4-PAA043Hu01-APC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2645.00
-
EUR 755.00
-
EUR 377.00
-
EUR 200.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GDNF (Ser78~Ile211)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with APC. |
Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Human), Biotinylated |
4-PAA043Hu01-Biotin |
Cloud-Clone |
-
EUR 279.00
-
EUR 1998.00
-
EUR 612.00
-
EUR 334.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GDNF (Ser78~Ile211)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with Biotin. |
Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Human), Cy3 |
4-PAA043Hu01-Cy3 |
Cloud-Clone |
-
EUR 360.00
-
EUR 3485.00
-
EUR 965.00
-
EUR 461.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GDNF (Ser78~Ile211)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with Cy3. |
Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Human), FITC |
4-PAA043Hu01-FITC |
Cloud-Clone |
-
EUR 261.00
-
EUR 2136.00
-
EUR 624.00
-
EUR 321.00
-
EUR 180.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GDNF (Ser78~Ile211)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with FITC. |
Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Human), HRP |
4-PAA043Hu01-HRP |
Cloud-Clone |
-
EUR 277.00
-
EUR 2309.00
-
EUR 671.00
-
EUR 343.00
-
EUR 190.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GDNF (Ser78~Ile211)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with HRP. |
Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Human), PE |
4-PAA043Hu01-PE |
Cloud-Clone |
-
EUR 261.00
-
EUR 2136.00
-
EUR 624.00
-
EUR 321.00
-
EUR 180.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GDNF (Ser78~Ile211)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with PE. |
Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Mouse), APC |
4-PAA043Mu01-APC |
Cloud-Clone |
-
EUR 329.00
-
EUR 3041.00
-
EUR 854.00
-
EUR 416.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GDNF (Asp79~Leu217)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with APC. |
Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Mouse), Biotinylated |
4-PAA043Mu01-Biotin |
Cloud-Clone |
-
EUR 299.00
-
EUR 2288.00
-
EUR 684.00
-
EUR 363.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GDNF (Asp79~Leu217)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with Biotin. |
Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Mouse), Cy3 |
4-PAA043Mu01-Cy3 |
Cloud-Clone |
-
EUR 397.00
-
EUR 4013.00
-
EUR 1097.00
-
EUR 513.00
-
EUR 241.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GDNF (Asp79~Leu217)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with Cy3. |
Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Mouse), FITC |
4-PAA043Mu01-FITC |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GDNF (Asp79~Leu217)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with FITC. |
Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Mouse), HRP |
4-PAA043Mu01-HRP |
Cloud-Clone |
-
EUR 302.00
-
EUR 2652.00
-
EUR 756.00
-
EUR 377.00
-
EUR 200.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GDNF (Asp79~Leu217)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with HRP. |
Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Mouse), PE |
4-PAA043Mu01-PE |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GDNF (Asp79~Leu217)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with PE. |
Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Rat), APC |
4-PAA043Ra01-APC |
Cloud-Clone |
-
EUR 316.00
-
EUR 2861.00
-
EUR 809.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GDNF (Ser78~Ile211)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with APC. |
Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Rat), Biotinylated |
4-PAA043Ra01-Biotin |
Cloud-Clone |
-
EUR 290.00
-
EUR 2156.00
-
EUR 651.00
-
EUR 350.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GDNF (Ser78~Ile211)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with Biotin. |
Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Rat), Cy3 |
4-PAA043Ra01-Cy3 |
Cloud-Clone |
-
EUR 380.00
-
EUR 3773.00
-
EUR 1037.00
-
EUR 489.00
-
EUR 234.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GDNF (Ser78~Ile211)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with Cy3. |
Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Rat), FITC |
4-PAA043Ra01-FITC |
Cloud-Clone |
-
EUR 273.00
-
EUR 2308.00
-
EUR 667.00
-
EUR 338.00
-
EUR 185.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GDNF (Ser78~Ile211)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with FITC. |
Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Rat), HRP |
4-PAA043Ra01-HRP |
Cloud-Clone |
-
EUR 291.00
-
EUR 2496.00
-
EUR 717.00
-
EUR 362.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GDNF (Ser78~Ile211)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with HRP. |
Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Rat), PE |
4-PAA043Ra01-PE |
Cloud-Clone |
-
EUR 273.00
-
EUR 2308.00
-
EUR 667.00
-
EUR 338.00
-
EUR 185.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GDNF (Ser78~Ile211)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with PE. |
GDNF Family Receptor Alpha 3 (GFRA3) Antibody |
20-abx007218 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
GDNF Family Receptor Alpha 2 (GFRA2) Antibody |
20-abx007289 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
GDNF Family Receptor Alpha 4 (GFRA4) Antibody |
abx027306-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
GDNF Family Receptor Alpha 4 (GFRA4) Antibody |
abx027306-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
GDNF Family Receptor Alpha 2 (GFRA2) Antibody |
abx028008-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
GDNF Family Receptor Alpha 2 (GFRA2) Antibody |
abx028008-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
GDNF Family Receptor Alpha 1 (GFRA1) Antibody |
20-abx004114 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
GDNF Family Receptor Alpha 3 (GFRA3) Antibody |
20-abx214635 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GDNF Family Receptor Alpha 4 (GFRA4) Antibody |
20-abx211166 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GDNF Family Receptor Alpha 3 (GFRA3) Antibody |
20-abx213628 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GDNF Family Receptor Alpha 3 (GFRA3) Antibody |
abx028745-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
GDNF Family Receptor Alpha 3 (GFRA3) Antibody |
abx028745-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
GDNF Family Receptor Alpha 2 (GFRA2) Antibody |
abx412459-01mg |
Abbexa |
0.1 mg |
EUR 509 |
|
GDNF Family Receptor Alpha 4 (GFRA4) Antibody |
20-abx339770 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GDNF Family Receptor Alpha 2 (GFRA2) Antibody |
abx233438-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
GDNF Family Receptor Alpha 2 (GFRA2) Antibody |
abx233439-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
GDNF Family Receptor Alpha 3 (GFRA3) Antibody |
abx233440-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
GDNF Family Receptor Alpha 4 (GFRA4) Antibody |
20-abx323388 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GDNF Family Receptor Alpha 2 (GFRA2) Antibody |
20-abx318070 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
GDNF Family Receptor Alpha 1 (GFRA1) Antibody |
20-abx318227 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
GDNF Family Receptor Alpha 3 (GFRA3) Antibody |
20-abx302214 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
GDNF Family Receptor Alpha 1 (GFRA1) Antibody |
20-abx225186 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Anti-GDNF Receptor alpha 1/GFRA1 Antibody |
PB9202 |
BosterBio |
100ug/vial |
EUR 334 |
GDNF Rabbit Polyclonal Antibody