GDNF Rabbit Polyclonal Antibody

GDNF Rabbit Polyclonal Antibody

To Order Now:

GDNF Polyclonal Antibody

ABP58627-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human GDNF protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of GDNF from Human, Mouse, Rat. This GDNF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GDNF protein at amino acid sequence of 100-180

GDNF Polyclonal Antibody

ABP58627-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human GDNF protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of GDNF from Human, Mouse, Rat. This GDNF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GDNF protein at amino acid sequence of 100-180

GDNF Polyclonal Antibody

ABP58627-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GDNF protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of GDNF from Human, Mouse, Rat. This GDNF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GDNF protein at amino acid sequence of 100-180

GDNF Polyclonal Antibody

ES11350-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GDNF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GDNF Polyclonal Antibody

ES11350-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GDNF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GDNF Rabbit pAb

A14639-100ul 100 ul
EUR 308

GDNF Rabbit pAb

A14639-200ul 200 ul
EUR 459

GDNF Rabbit pAb

A14639-20ul 20 ul
EUR 183

GDNF Rabbit pAb

A14639-50ul 50 ul
EUR 223

GDNF Rabbit pAb

A14734-100ul 100 ul
EUR 308

GDNF Rabbit pAb

A14734-200ul 200 ul
EUR 459

GDNF Rabbit pAb

A14734-20ul 20 ul
EUR 183

GDNF Rabbit pAb

A14734-50ul 50 ul
EUR 223

Anti-GDNF Rabbit Monoclonal Antibody

M00710 100ug/vial
EUR 397
Description: Rabbit Monoclonal GDNF Antibody. Validated in WB and tested in Human, Mouse, Rat.


ERTG0160 96Tests
EUR 521

Human Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit

EUR 441
  • Should the Human Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glial Cell Line Derived Neurotrophic Factor (GDNF) in samples from serum, plasma, tissue homogenates, cell lysates, cerebrospinal fluid, cell culture supernates or other biological fluids.

Human Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit

EUR 570
  • Should the Human Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glial Cell Line Derived Neurotrophic Factor (GDNF) in samples from serum, plasma, tissue homogenates, cell lysates, cerebrospinal fluid, cell culture supernates or other biological fluids.

Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit

EUR 489
  • Should the Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit

EUR 635
  • Should the Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit

EUR 467
  • Should the Rat Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Glial Cell Line Derived Neurotrophic Factor (GDNF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit

EUR 605
  • Should the Rat Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Glial Cell Line Derived Neurotrophic Factor (GDNF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit

RDR-GDNF-Hu-48Tests 48 Tests
EUR 455

Human Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit

RDR-GDNF-Hu-96Tests 96 Tests
EUR 629

Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit

RDR-GDNF-Mu-48Tests 48 Tests
EUR 511

Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit

RDR-GDNF-Mu-96Tests 96 Tests
EUR 709

Rat Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit

RDR-GDNF-Ra-48Tests 48 Tests
EUR 486

Rat Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit

RDR-GDNF-Ra-96Tests 96 Tests
EUR 672

Human Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit

RD-GDNF-Hu-48Tests 48 Tests
EUR 436

Human Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit

RD-GDNF-Hu-96Tests 96 Tests
EUR 601

Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit

RD-GDNF-Mu-48Tests 48 Tests
EUR 489

Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit

RD-GDNF-Mu-96Tests 96 Tests
EUR 677

Rat Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit

RD-GDNF-Ra-48Tests 48 Tests
EUR 465

Rat Glial Cell Line Derived Neurotrophic Factor (GDNF) ELISA Kit

RD-GDNF-Ra-96Tests 96 Tests
EUR 643

GDNF antibody

20R-1778 100 ug
EUR 651
Description: Rabbit polyclonal GDNF antibody

GDNF antibody

70R-12262 100 ug
EUR 527
Description: Rabbit polyclonal GDNF antibody

GDNF antibody

70R-14004 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal GDNF antibody

GDNF Antibody

EUR 403

GDNF Antibody

EUR 146

GDNF Antibody

EUR 338

GDNF Antibody

EUR 146

GDNF Antibody

49556-100ul 100ul
EUR 333

GDNF Antibody

49556-50ul 50ul
EUR 239

GDNF Antibody

45120-100ul 100ul
EUR 252

GDNF Antibody

45120-50ul 50ul
EUR 187

GDNF Antibody

DF7727 200ul
EUR 304
Description: GDNF Antibody detects endogenous levels of total GDNF.

GDNF antibody

70R-GR020 50 ug
EUR 273
Description: Affinity purified Rabbit polyclonal GDNF antibody

GDNF Antibody

ABD7727 100 ug
EUR 438


GT15007 100 ug
EUR 526


PR29004 2 ug
EUR 265

GDNF Conjugated Antibody

C49556 100ul
EUR 397

GDNF Conjugated Antibody

C45120 100ul
EUR 397

Anti-GDNF Antibody

PA1465 100ug/vial
EUR 334

Anti-GDNF Antibody

PB9069 100ug/vial
EUR 294

Anti-GDNF antibody

STJ116846 100 µl
EUR 277
Description: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The recombinant form of this protein, a highly conserved neurotrophic factor, was shown to promote the survival and differentiation of dopaminergic neurons in culture, and was able to prevent apoptosis of motor neurons induced by axotomy. This protein is a ligand for the product of the RET (rearranged during transfection) protooncogene. Mutations in this gene may be associated with Hirschsprung disease and Tourette syndrome. This gene encodes multiple protein isoforms that may undergo similar proteolytic processing.

Anti-GDNF antibody

STJ116934 100 µl
EUR 277
Description: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The recombinant form of this protein, a highly conserved neurotrophic factor, was shown to promote the survival and differentiation of dopaminergic neurons in culture, and was able to prevent apoptosis of motor neurons induced by axotomy. This protein is a ligand for the product of the RET (rearranged during transfection) protooncogene. Mutations in this gene may be associated with Hirschsprung disease and Tourette syndrome. This gene encodes multiple protein isoforms that may undergo similar proteolytic processing.

Anti-GDNF antibody

STJ192508 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GDNF

Anti-GDNF Antibody

STJ60015 100 µg
EUR 424


ELA-E0043r 96 Tests
EUR 886

GDNF protein

30R-2209 25 ug
EUR 500
Description: Purified recombinant Human GDNF protein

GDNF protein

30R-2460 10 ug
EUR 325
Description: Purified recombinant Human GDNF protein

GDNF protein

30R-AG008 2 ug
EUR 127
Description: Purified recombinant Human GDNF protein

GDNF protein

30R-AG038 10 ug
EUR 273
Description: Purified recombinant Human GDNF protein

GDNF protein

30R-AG039 10 ug
EUR 273
Description: Purified recombinant Human GDNF protein


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


AK8335-0002 2µg Ask for price


AK8335-0010 10µg Ask for price


AK8335-0100 100µg Ask for price


AK8335-1000 1mg Ask for price

GDNF, Human

HY-P7182 50ug
EUR 762

GDNF Biotinylated

GT15007B 50 ug
EUR 552

GDNF (Rat)

PR15008 50 ug
EUR 1277


YF-PA11999 50 ug
EUR 363
Description: Mouse polyclonal to GDNF


YF-PA12000 100 ug
EUR 403
Description: Rabbit polyclonal to GDNF


YF-PA23773 50 ul
EUR 334
Description: Mouse polyclonal to GDNF

GDNF, human

RC218-25 2ug
EUR 101.33
  • Product category: Proteins/Recombinant Proteins/Neurotrophins

GDNF, rat

RC258-25 2ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Neurotrophins

GDNF recombinant monoclonal antibody

A5308 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human GDNF for WB, IHC,ELISA

Antibody for Human GDNF

SPC-710D 0.1mg
EUR 354
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is unconjugated.

Antibody for Human GDNF

SPC-710D-A390 0.1mg
EUR 401
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to ATTO 390.

Antibody for Human GDNF

SPC-710D-A488 0.1mg
EUR 400
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to ATTO 488.

Antibody for Human GDNF

SPC-710D-A565 0.1mg
EUR 400
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to ATTO 565.

Antibody for Human GDNF

SPC-710D-A594 0.1mg
EUR 400
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to ATTO 594.

Antibody for Human GDNF

SPC-710D-A633 0.1mg
EUR 400
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to ATTO 633.

Antibody for Human GDNF

SPC-710D-A655 0.1mg
EUR 400
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to ATTO 655.

Antibody for Human GDNF

SPC-710D-A680 0.1mg
EUR 400
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to ATTO 680.

Antibody for Human GDNF

SPC-710D-A700 0.1mg
EUR 400
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to ATTO 700.

Antibody for Human GDNF

SPC-710D-ALP 0.1mg
EUR 394
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to Alkaline Phosphatase.

Antibody for Human GDNF

SPC-710D-APC 0.1mg
EUR 399
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to APC .

Antibody for Human GDNF

SPC-710D-APCCY7 0.1mg
EUR 471
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to APC/Cy7.

Antibody for Human GDNF

SPC-710D-BI 0.1mg
EUR 396
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to Biotin.

Antibody for Human GDNF

SPC-710D-DY350 0.1mg
EUR 414
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to Dylight 350.

Antibody for Human GDNF

SPC-710D-DY405 0.1mg
EUR 403
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to Dylight 405.

Antibody for Human GDNF

SPC-710D-DY488 0.1mg
EUR 393
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to Dylight 488.

Antibody for Human GDNF

SPC-710D-DY594 0.1mg
EUR 395
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to Dylight 594.

Antibody for Human GDNF

SPC-710D-DY633 0.1mg
EUR 390
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to Dylight 633.

Antibody for Human GDNF

SPC-710D-FITC 0.1mg
EUR 392
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to FITC.

Antibody for Human GDNF

SPC-710D-HRP 0.1mg
EUR 388
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to HRP.

Antibody for Human GDNF

SPC-710D-P594 0.1mg
EUR 407
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to PE/ATTO 594.

Antibody for Human GDNF

SPC-710D-PCP 0.1mg
EUR 399
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to PerCP.

Antibody for Human GDNF

SPC-710D-RPE 0.1mg
EUR 397
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to RPE .

Antibody for Human GDNF

SPC-710D-STR 0.1mg
EUR 398
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is conjugated to Streptavidin.

Antibody for Human GDNF

SPC-710S 0.012mg
EUR 65
Description: A polyclonal antibody for GDNF from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human GDNF. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This GDNF antibody is unconjugated.

Glial cell derived neurotrophic factor (GDNF) polyclonal antibody

ABP-PAB-10125 100 ug Ask for price
    • Product line: Cytokines, Chemokines, Growth Factors
    • Brand:

GDNF Blocking Peptide

33R-10575 50 ug
EUR 349
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GDNF antibody, catalog no. 20R-1778

GDNF Blocking Peptide

33R-11039 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GDNF antibody, catalog no. 70R-12262

GDNF Blocking Peptide

EUR 153

GDNF, human recombinant

EUR 245

GDNF, human recombinant

EUR 5270

GDNF, human recombinant

EUR 697

GDNF Blocking Peptide

DF7727-BP 1mg
EUR 195

GDNF, murine recombinant

EUR 278

GDNF, murine recombinant

EUR 1132

GDNF, rat recombinant

EUR 278

GDNF, rat recombinant

EUR 1132

GDNF cloning plasmid

CSB-CL009356HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 636
  • Sequence: atgaagttatgggatgtcgtggctgtctgcctggtgctgctccacaccgcgtccgccttcccgctgcccgccggtaagaggcctcccgaggcgcccgccgaagaccgctccctcggccgccgccgcgcgcccttcgcgctgagcagtgactcaaatatgccagaggattatcctga
  • Show more
Description: A cloning plasmid for the GDNF gene.

GDNF (Human, Mouse)

PR27022 2 ug
EUR 191

Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Human)

  • EUR 217.00
  • EUR 2048.00
  • EUR 520.00
  • EUR 268.00
  • EUR 201.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDNF (Ser78~Ile211)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glial Cell Line Derived Neurotrophic Factor (GDNF)

Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Mouse)

  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDNF (Asp79~Leu217)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF)

Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Rat)

  • EUR 227.00
  • EUR 2206.00
  • EUR 556.00
  • EUR 282.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDNF (Ser78~Ile211)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glial Cell Line Derived Neurotrophic Factor (GDNF)


55R-1581 1 kit
EUR 590
Description: ELISA kit for detection of GDNF in the research laboratory


55R-1582 1 kit
EUR 590
Description: ELISA kit for detection of GDNF in the research laboratory


ELA-E0043h 96 Tests
EUR 824


EHG0160 96Tests
EUR 521


EGTG0160 96Tests
EUR 521


EBG0160 96Tests
EUR 521


ECG0160 96Tests
EUR 521

Chicken GDNF ELISA Kit

ECKG0160 96Tests
EUR 521

Anserini GDNF ELISA Kit

EAG0160 96Tests
EUR 521


EF000123 96 Tests
EUR 689

Rat GDNF shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GDNF shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GDNF shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GDNF (CHO-expressed), Mouse

HY-P7359 50ug
EUR 762


EMG0160 96Tests
EUR 521


ERG0160 96Tests
EUR 521


ESG0160 96Tests
EUR 521

GDNF Receptor Alpha 1

GT15004 100 ug
EUR 526

GDNF Receptor Alpha 2

GT15005 100 ug
EUR 526

GDNF Receptor Alpha 4

GT15083 100 ug
EUR 526

GDNF Receptor Alpha 1

GT15108 100 ug
EUR 500

GDNF Receptor Alpha 3

GT15123 100 ug
EUR 526


EMKG0160 96Tests
EUR 521

Porcine GDNF ELISA Kit

EPG0160 96Tests
EUR 521

GDNF (Human) ELISA Kit

EUR 805


LF-EK50057 1×96T
EUR 648

Human GDNF ELISA kit

LF-EK50637 1×96T
EUR 648


LF-EK50960 1×96T
EUR 648

GDNF Receptor Alpha 1

MO15093 500 ug
EUR 513

Recombinant Murine GDNF Protein

PROTP48540-1 10ug
EUR 317
Description: GDNF is a disulfide-linked homodimeric neurotrophic factor structurally related to Artemin, Neurturin and Persephin. These proteins belong to the cysteine-knot superfamily of growth factors that assume stable dimeric protein structures. GDNF signals through a multicomponent receptor system, composed of a RET and one of the four GFR α(α1-α4) receptors. GDNF specifically promotes dopamine uptake and survival and morphological differentiation of midbrain neurons. Using Parkinson’s disease mouse model, GDNF has been shown to improve conditions such as bradykinesia, rigidity, and postural instability. The functional murine GDNF ligand is a disulfide-linked homodimer, of two 15.1 kDa polypeptide chains called monomers. Each monomer contains seven conserved cysteine residues, one of which is used for inter-chain disulfide bridging and the others are involved in intramolecular ring formation known as the cysteine knot configuration.

Recombinant Rat GDNF Protein

PROTQ07731-1 10ug
EUR 317
Description: GDNF is a disulfide-linked homodimeric neurotrophic factor structurally related to Artemin, Neurturin and Persephin. These proteins belong to the cysteine-knot superfamily of growth factors that assume stable dimeric protein structures. GDNF signals through a multicomponent receptor system, composed of a RET and one of the four GFR α(α1-α4) receptors. GDNF specifically promotes dopamine uptake and survival and morphological differentiation of midbrain neurons. Using Parkinson’s disease mouse model, GDNF has been shown to improve conditions such as bradykinesia, rigidity, and postural instability. The functional rat GDNF ligand is a disulfide-linked homodimer, of two 15 kDa polypeptide chains called monomers. Each monomer contains seven conserved cysteine residues, one of which (Cys 101) is used for inter-chain disulfide bridging and the others are involved in intramolecular ring formation known as the cysteine knot configuration.

GDNF (Rat), Carrier Free

PR15008CF 50 ug
EUR 1277

Recombinant Human GDNF Protein

PROTP39905-1 10ug
EUR 317
Description: GDNF is a disulfide-linked homodimeric neurotrophic factor structurally related to Artemin, Neurturin and Persephin. These proteins belong to the cysteine-knot superfamily of growth factors that assume stable dimeric protein structures. GDNF signals through a multicomponent receptor system, composed of a RET and one of the four GFRα (α1-α4) receptors. GDNF specifically promotes dopamine uptake and survival and morphological differentiation of midbrain neurons. Using Parkinson's disease mouse model, GDNF has been shown to improve conditions such as bradykinesia, rigidity, and postural instability. The functional human GDNF ligand is a disulfide-linked homodimer, of two 15 kDa polypeptide chains called monomers. Each monomer contains seven conserved cysteine residues, one of which (Cys 101) is used for inter-chain disulfide bridging and the others are involved in intramolecular ring formation known as the cysteine knot configuration.

GDNF Receptor Alpha 3

RA30017 50 ug
EUR 605


RK00291 96 Tests
EUR 521

Recombinant Human GDNF Protein

RP00835 10 μg
EUR 221


STJ150512 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of GDNF in human serum, plasma and other biological fluids

Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Human), APC

  • EUR 301.00
  • EUR 2645.00
  • EUR 755.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDNF (Ser78~Ile211)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with APC.

Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Human), Biotinylated

  • EUR 279.00
  • EUR 1998.00
  • EUR 612.00
  • EUR 334.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDNF (Ser78~Ile211)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with Biotin.

Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Human), Cy3

  • EUR 360.00
  • EUR 3485.00
  • EUR 965.00
  • EUR 461.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDNF (Ser78~Ile211)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with Cy3.

Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Human), FITC

  • EUR 261.00
  • EUR 2136.00
  • EUR 624.00
  • EUR 321.00
  • EUR 180.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDNF (Ser78~Ile211)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with FITC.

Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Human), HRP

  • EUR 277.00
  • EUR 2309.00
  • EUR 671.00
  • EUR 343.00
  • EUR 190.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDNF (Ser78~Ile211)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with HRP.

Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Human), PE

  • EUR 261.00
  • EUR 2136.00
  • EUR 624.00
  • EUR 321.00
  • EUR 180.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDNF (Ser78~Ile211)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with PE.

Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Mouse), APC

  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDNF (Asp79~Leu217)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with APC.

Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDNF (Asp79~Leu217)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with Biotin.

Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Mouse), Cy3

  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDNF (Asp79~Leu217)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with Cy3.

Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Mouse), FITC

  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDNF (Asp79~Leu217)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with FITC.

Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Mouse), HRP

  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDNF (Asp79~Leu217)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with HRP.

Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Mouse), PE

  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDNF (Asp79~Leu217)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with PE.

Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Rat), APC

  • EUR 316.00
  • EUR 2861.00
  • EUR 809.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDNF (Ser78~Ile211)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with APC.

Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Rat), Biotinylated

  • EUR 290.00
  • EUR 2156.00
  • EUR 651.00
  • EUR 350.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDNF (Ser78~Ile211)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with Biotin.

Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Rat), Cy3

  • EUR 380.00
  • EUR 3773.00
  • EUR 1037.00
  • EUR 489.00
  • EUR 234.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDNF (Ser78~Ile211)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with Cy3.

Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Rat), FITC

  • EUR 273.00
  • EUR 2308.00
  • EUR 667.00
  • EUR 338.00
  • EUR 185.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDNF (Ser78~Ile211)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with FITC.

Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Rat), HRP

  • EUR 291.00
  • EUR 2496.00
  • EUR 717.00
  • EUR 362.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDNF (Ser78~Ile211)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with HRP.

Glial Cell Line Derived Neurotrophic Factor (GDNF) Polyclonal Antibody (Rat), PE

  • EUR 273.00
  • EUR 2308.00
  • EUR 667.00
  • EUR 338.00
  • EUR 185.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDNF (Ser78~Ile211)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glial Cell Line Derived Neurotrophic Factor (GDNF). This antibody is labeled with PE.

GDNF Family Receptor Alpha 3 (GFRA3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

GDNF Family Receptor Alpha 4 (GFRA4) Antibody

abx027306-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

GDNF Family Receptor Alpha 4 (GFRA4) Antibody

abx027306-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody

abx028008-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody

abx028008-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

GDNF Family Receptor Alpha 1 (GFRA1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

GDNF Family Receptor Alpha 3 (GFRA3) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

GDNF Family Receptor Alpha 4 (GFRA4) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

GDNF Family Receptor Alpha 3 (GFRA3) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

GDNF Family Receptor Alpha 3 (GFRA3) Antibody

abx028745-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

GDNF Family Receptor Alpha 3 (GFRA3) Antibody

abx028745-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody

abx412459-01mg 0.1 mg
EUR 509
  • Shipped within 1 week.

GDNF Family Receptor Alpha 4 (GFRA4) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody

abx233438-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody

abx233439-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

GDNF Family Receptor Alpha 3 (GFRA3) Antibody

abx233440-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

GDNF Family Receptor Alpha 4 (GFRA4) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GDNF Family Receptor Alpha 1 (GFRA1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GDNF Family Receptor Alpha 3 (GFRA3) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GDNF Family Receptor Alpha 1 (GFRA1) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anti-GDNF Receptor alpha 1/GFRA1 Antibody

PB9202 100ug/vial
EUR 334

GDNF Rabbit Polyclonal Antibody