CLN3 Rabbit Polyclonal Antibody
CLN3 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
 CLN3 Polyclonal Antibody |
|
ES11433-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CLN3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CLN3 Polyclonal Antibody |
|
ES11433-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CLN3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 CLN3 Rabbit pAb |
|
A1931-100ul |
Abclonal |
100 ul |
EUR 308 |
CLN3 Rabbit pAb |
|
A1931-200ul |
Abclonal |
200 ul |
EUR 459 |
CLN3 Rabbit pAb |
|
A1931-20ul |
Abclonal |
20 ul |
EUR 183 |
CLN3 Rabbit pAb |
|
A1931-50ul |
Abclonal |
50 ul |
EUR 223 |
) Polyclonal CLN3 Antibody (Center) |
|
APR11597G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CLN3 (Center). This antibody is tested and proven to work in the following applications: |
Polyclonal CLN3 Antibody (Center) |
|
APR11598G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CLN3 (Center). This antibody is tested and proven to work in the following applications: |
 CLN3 antibody |
|
70R-16456 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal CLN3 antibody |
CLN3 antibody |
|
38322-100ul |
SAB |
100ul |
EUR 252 |
 CLN3 Antibody |
|
1-CSB-PA005565GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
|
Description: A polyclonal antibody against CLN3. Recognizes CLN3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
CLN3 Antibody |
|
1-CSB-PA621659ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against CLN3. Recognizes CLN3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
 ELISA kit) Rabbit Battenin(CLN3) ELISA kit |
|
E04B0886-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Battenin(CLN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Battenin(CLN3) ELISA kit |
|
E04B0886-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Battenin(CLN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Battenin(CLN3) ELISA kit |
|
E04B0886-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Battenin(CLN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Antibody) Battenin (CLN3) Antibody |
|
abx027328-400ul |
Abbexa |
400 ul |
EUR 551 |
- Shipped within 5-10 working days.
|
Battenin (CLN3) Antibody |
|
abx027328-80l |
Abbexa |
80 µl |
EUR 321 |
- Shipped within 5-10 working days.
|
Battenin (CLN3) Antibody |
|
20-abx111558 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 CLN3 Conjugated Antibody |
|
C38322 |
SAB |
100ul |
EUR 397 |
Battenin (CLN3) Antibody |
|
20-abx321731 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Battenin (CLN3) Antibody |
|
abx231767-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Battenin (CLN3) Antibody |
|
20-abx001577 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
 anti- CLN3 antibody |
|
FNab01767 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: ceroid-lipofuscinosis, neuronal 3
- Uniprot ID: Q13286
- Gene ID: 1201
- Research Area: Neuroscience, Metabolism
|
|
Description: Antibody raised against CLN3 |
 Anti-CLN3 antibody |
|
STJ192591 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to CLN3 |
Anti-CLN3 antibody |
|
STJ23171 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a protein that is involved in lysosomal function. Mutations in this, as well as other neuronal ceroid-lipofuscinosis (CLN) genes, cause neurodegenerative diseases commonly known as Batten disease or collectively known as neuronal ceroid lipofuscinoses (NCLs). Many alternatively spliced transcript variants have been found for this gene. |
 CLN3 siRNA |
|
20-abx912102 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CLN3 siRNA |
|
20-abx912103 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-CLN3 |
|
YF-PA10994 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to CLN3 |
 CLN3 cloning plasmid |
|
CSB-CL621659HU-10ug |
Cusabio |
10ug |
EUR 478 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1317
- Sequence: atgggaggctgtgcaggctcgcggcggcgcttttcggattccgagggggaggagaccgtcccggagccccggctccctctgttggaccatcagggcgcgcattggaagaacgcggtgggcttctggctgctgggcctttgcaacaacttctcttatgtggtgatgctgagtgccg
- Show more
|
|
Description: A cloning plasmid for the CLN3 gene. |
) Anti-CLN3 (1G10) |
|
YF-MA12479 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to CLN3 |
 Mouse CLN3 shRNA Plasmid |
|
20-abx969706 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human CLN3 shRNA Plasmid |
|
20-abx950858 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) CLN3 Recombinant Protein (Human) |
|
RP007378 |
ABM |
100 ug |
Ask for price |
) CLN3 Recombinant Protein (Rat) |
|
RP195404 |
ABM |
100 ug |
Ask for price |
) CLN3 Recombinant Protein (Mouse) |
|
RP124748 |
ABM |
100 ug |
Ask for price |
CLN3 Recombinant Protein (Mouse) |
|
RP124751 |
ABM |
100 ug |
Ask for price |
 (M03), Clone: 1G10) Monoclonal CLN3 Antibody (monoclonal) (M03), Clone: 1G10 |
|
APR11599G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human CLN3 (monoclonal) (M03). The antibodies are raised in Mouse and are from clone 1G10. This antibody is applicable in WB, E |
 ELISA kit) Human Battenin(CLN3) ELISA kit |
|
E01B0886-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Human Battenin(CLN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Battenin(CLN3) ELISA kit |
|
E01B0886-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Human Battenin(CLN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Battenin(CLN3) ELISA kit |
|
E01B0886-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Human Battenin(CLN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Mouse Battenin(CLN3) ELISA kit |
|
E03B0886-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Mouse Battenin(CLN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Battenin(CLN3) ELISA kit |
|
E03B0886-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Mouse Battenin(CLN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Battenin(CLN3) ELISA kit |
|
E03B0886-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Mouse Battenin(CLN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Goat Battenin(CLN3) ELISA kit |
|
E06B0886-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Goat Battenin(CLN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
CLN3 Rabbit Polyclonal Antibody
