CLN3 Rabbit Polyclonal Antibody
CLN3 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
CLN3 Polyclonal Antibody |
ABP58191-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human CLN3 protein at amino acid sequence of 221-270
- Applications tips:
|
Description: A polyclonal antibody for detection of CLN3 from Human. This CLN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CLN3 protein at amino acid sequence of 221-270 |
CLN3 Polyclonal Antibody |
ABP58191-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CLN3 protein at amino acid sequence of 221-270
- Applications tips:
|
Description: A polyclonal antibody for detection of CLN3 from Human. This CLN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CLN3 protein at amino acid sequence of 221-270 |
CLN3 Rabbit pAb |
A1931-100ul |
Abclonal |
100 ul |
EUR 308 |
CLN3 Rabbit pAb |
A1931-200ul |
Abclonal |
200 ul |
EUR 459 |
CLN3 Rabbit pAb |
A1931-20ul |
Abclonal |
20 ul |
EUR 183 |
CLN3 Rabbit pAb |
A1931-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal CLN3 Antibody (Center) |
APR11597G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CLN3 (Center). This antibody is tested and proven to work in the following applications: |
Polyclonal CLN3 Antibody (Center) |
APR11598G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CLN3 (Center). This antibody is tested and proven to work in the following applications: |
CLN3 antibody |
38322-100ul |
SAB |
100ul |
EUR 252 |
CLN3 antibody |
70R-16456 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal CLN3 antibody |
CLN3 Antibody |
1-CSB-PA005565GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against CLN3. Recognizes CLN3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
CLN3 Antibody |
1-CSB-PA621659ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against CLN3. Recognizes CLN3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
Rabbit Battenin(CLN3) ELISA kit |
E04B0886-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Battenin(CLN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Battenin(CLN3) ELISA kit |
E04B0886-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Battenin(CLN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Battenin(CLN3) ELISA kit |
E04B0886-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Battenin(CLN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
CLN3 Conjugated Antibody |
C38322 |
SAB |
100ul |
EUR 397 |
anti- CLN3 antibody |
FNab01767 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: ceroid-lipofuscinosis, neuronal 3
- Uniprot ID: Q13286
- Gene ID: 1201
- Research Area: Neuroscience, Metabolism
|
Description: Antibody raised against CLN3 |
Battenin (CLN3) Antibody |
20-abx111558 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Battenin (CLN3) Antibody |
20-abx001577 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Battenin (CLN3) Antibody |
abx027328-400ul |
Abbexa |
400 ul |
EUR 551 |
- Shipped within 5-10 working days.
|
Battenin (CLN3) Antibody |
abx027328-80l |
Abbexa |
80 µl |
EUR 321 |
- Shipped within 5-10 working days.
|
Battenin (CLN3) Antibody |
20-abx321731 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Battenin (CLN3) Antibody |
abx231767-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Anti-CLN3 antibody |
STJ23171 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein that is involved in lysosomal function. Mutations in this, as well as other neuronal ceroid-lipofuscinosis (CLN) genes, cause neurodegenerative diseases commonly known as Batten disease or collectively known as neuronal ceroid lipofuscinoses (NCLs). Many alternatively spliced transcript variants have been found for this gene. |
Anti-CLN3 antibody |
STJ192591 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to CLN3 |
CLN3 siRNA |
20-abx912102 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CLN3 siRNA |
20-abx912103 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-CLN3 |
YF-PA10994 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to CLN3 |
CLN3 cloning plasmid |
CSB-CL621659HU-10ug |
Cusabio |
10ug |
EUR 478 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1317
- Sequence: atgggaggctgtgcaggctcgcggcggcgcttttcggattccgagggggaggagaccgtcccggagccccggctccctctgttggaccatcagggcgcgcattggaagaacgcggtgggcttctggctgctgggcctttgcaacaacttctcttatgtggtgatgctgagtgccg
- Show more
|
Description: A cloning plasmid for the CLN3 gene. |
Anti-CLN3 (1G10) |
YF-MA12479 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to CLN3 |
Human CLN3 shRNA Plasmid |
20-abx950858 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse CLN3 shRNA Plasmid |
20-abx969706 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CLN3 Recombinant Protein (Human) |
RP007378 |
ABM |
100 ug |
Ask for price |
CLN3 Recombinant Protein (Rat) |
RP195404 |
ABM |
100 ug |
Ask for price |
CLN3 Recombinant Protein (Mouse) |
RP124748 |
ABM |
100 ug |
Ask for price |
CLN3 Recombinant Protein (Mouse) |
RP124751 |
ABM |
100 ug |
Ask for price |
Monoclonal CLN3 Antibody (monoclonal) (M03), Clone: 1G10 |
APR11599G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human CLN3 (monoclonal) (M03). The antibodies are raised in Mouse and are from clone 1G10. This antibody is applicable in WB, E |
Goat Battenin(CLN3) ELISA kit |
E06B0886-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Battenin(CLN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Battenin(CLN3) ELISA kit |
E06B0886-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Battenin(CLN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Battenin(CLN3) ELISA kit |
E06B0886-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Battenin(CLN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Battenin(CLN3) ELISA kit |
E02B0886-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Battenin(CLN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Battenin(CLN3) ELISA kit |
E02B0886-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Battenin(CLN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Battenin(CLN3) ELISA kit |
E02B0886-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Battenin(CLN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Battenin(CLN3) ELISA kit |
E01B0886-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Battenin(CLN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
CLN3 Rabbit Polyclonal Antibody