PAEP Rabbit Polyclonal Antibody

PAEP Rabbit Polyclonal Antibody

To Order Now:

PAEP Polyclonal Antibody
ES10976-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PAEP from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
PAEP Polyclonal Antibody
ABP59813-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PAEP protein
  • Applications tips:
Description: A polyclonal antibody for detection of PAEP from Human. This PAEP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAEP protein
PAEP Polyclonal Antibody
ABP59813-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PAEP protein
  • Applications tips:
Description: A polyclonal antibody for detection of PAEP from Human. This PAEP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAEP protein
PAEP Polyclonal Antibody
ABP59813-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PAEP protein
  • Applications tips:
Description: A polyclonal antibody for detection of PAEP from Human. This PAEP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAEP protein
PAEP Rabbit pAb
A11810-100ul 100 ul
EUR 308
PAEP Rabbit pAb
A11810-200ul 200 ul
EUR 459
PAEP Rabbit pAb
A11810-20ul 20 ul Ask for price
PAEP Rabbit pAb
A11810-50ul 50 ul Ask for price
PAEP Rabbit pAb
A5751-100ul 100 ul
EUR 308
PAEP Rabbit pAb
A5751-200ul 200 ul
EUR 459
PAEP Rabbit pAb
A5751-20ul 20 ul
EUR 183
PAEP Rabbit pAb
A5751-50ul 50 ul
EUR 223
PAEP Rabbit pAb
A14757-100ul 100 ul
EUR 308
PAEP Rabbit pAb
A14757-200ul 200 ul
EUR 459
PAEP Rabbit pAb
A14757-20ul 20 ul
EUR 183
PAEP Rabbit pAb
A14757-50ul 50 ul
EUR 223
Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit
EUR 517
  • Should the Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Progestagen Associated Endometrial Protein (PAEP) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit
EUR 673
  • Should the Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Progestagen Associated Endometrial Protein (PAEP) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit
RD-PAEP-Hu-48Tests 48 Tests
EUR 521
Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit
RD-PAEP-Hu-96Tests 96 Tests
EUR 723
Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit
RDR-PAEP-Hu-48Tests 48 Tests
EUR 544
Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit
RDR-PAEP-Hu-96Tests 96 Tests
EUR 756
PAEP Antibody
ABD2701 100 ug
EUR 438
PAEP Antibody
33016-100ul 100ul
EUR 252
PAEP Antibody
DF2701 200ul
EUR 304
Description: PAEP antibody detects endogenous levels of total PAEP.
PAEP Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:100-1:300
PAEP Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:100-1:300
PAEP Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IP; Recommended dilution: IHC:1:20-1:200, IP:1:200-1:2000
PAEP Conjugated Antibody
C33016 100ul
EUR 397
Anti-PAEP antibody
STJ28318 100 µl
EUR 277
Description: This gene is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of chromosome 9. The encoded glycoprotein has been previously referred to as pregnancy-associated endometrial alpha-2-globulin, placental protein 14, and glycodelin, but has been officially named progestagen-associated endometrial protein. Three distinct forms, with identical protein backbones but different glycosylation profiles, are found in amniotic fluid, follicular fluid and seminal plasma of the reproductive system. These glycoproteins have distinct and essential roles in regulating a uterine environment suitable for pregnancy and in the timing and occurrence of the appropriate sequence of events in the fertilization process. Alternative splicing results in multiple transcript variants.
Anti-PAEP antibody
STJ113389 100 µl
EUR 277
Description: This gene is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of chromosome 9. The encoded glycoprotein has been previously referred to as pregnancy-associated endometrial alpha-2-globulin, placental protein 14, and glycodelin, but has been officially named progestagen-associated endometrial protein. Three distinct forms, with identical protein backbones but different glycosylation profiles, are found in amniotic fluid, follicular fluid and seminal plasma of the reproductive system. These glycoproteins have distinct and essential roles in regulating a uterine environment suitable for pregnancy and in the timing and occurrence of the appropriate sequence of events in the fertilization process. Alternative splicing results in multiple transcript variants.
Anti-PAEP antibody
STJ116957 100 µl
EUR 277
Description: This gene is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of chromosome 9. The encoded glycoprotein has been previously referred to as pregnancy-associated endometrial alpha-2-globulin, placental protein 14, and glycodelin, but has been officially named progestagen-associated endometrial protein. Three distinct forms, with identical protein backbones but different glycosylation profiles, are found in amniotic fluid, follicular fluid and seminal plasma of the reproductive system. These glycoproteins have distinct and essential roles in regulating a uterine environment suitable for pregnancy and in the timing and occurrence of the appropriate sequence of events in the fertilization process. Alternative splicing results in multiple transcript variants.
Anti-PAEP antibody
STJ192134 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PAEP
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PAEP Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
PAEP Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
PAEP Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
PAEP cloning plasmid
CSB-CL017381HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 543
  • Sequence: atgctgtgcctcctgctcaccctgggcgtggccctggtctgtggtgtcccggccatggacatcccccagaccaagcaggacctggagctcccaaagttggcagggacctggcactccatggccatggcgaccaacaacatctccctcatggcgacactgaaggcccctctgagggt
  • Show more
Description: A cloning plasmid for the PAEP gene.
PAEP Blocking Peptide
DF2701-BP 1mg
EUR 195
Human Glycodelin (PAEP)
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 22.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Glycodelin(PAEP) expressed in E.coli
Human Glycodelin (PAEP)
  • EUR 358.00
  • EUR 1257.00
  • EUR 514.00
  • EUR 927.00
  • 100ug
  • 1MG
  • 200ug
  • 500ug
  • MW: 23.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Glycodelin(PAEP) expressed in Mammalian cell
Rabbit Progestagen-Associated Endometrial Protein (PAEP) ELISA Kit
abx362423-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
ELA-E10200h 96 Tests
EUR 824
EF002066 96 Tests
EUR 689
Human PAEP shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PAEP protein (His tag)
80R-2711 50 ug
EUR 424
Description: Purified recombinant PAEP protein (His tag)
PAEP Recombinant Protein (Human)
RP022438 100 ug Ask for price
Progestagen-Associated Endometrial Protein (PAEP) Antibody
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Progestagen-Associated Endometrial Protein (PAEP) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Progestagen-Associated Endometrial Protein (PAEP) Antibody
abx028157-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Progestagen-Associated Endometrial Protein (PAEP) Antibody
abx028157-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Progestagen Associated Endometrial Protein (PAEP) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Progestagen Associated Endometrial Protein (PAEP) Antibody
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
Progestagen-Associated Endometrial Protein (PAEP) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Progestagen-Associated Endometrial Protein (PAEP) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Progestagen-Associated Endometrial Protein (PAEP) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Progestagen-Associated Endometrial Protein (PAEP) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Progestagen-Associated Endometrial Protein (PAEP) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Progestagen-Associated Endometrial Protein (PAEP) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PAEP Rabbit Polyclonal Antibody