PAEP Rabbit Polyclonal Antibody
PAEP Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
PAEP Polyclonal Antibody |
ABP59813-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PAEP protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PAEP from Human. This PAEP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAEP protein |
PAEP Polyclonal Antibody |
ABP59813-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PAEP protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PAEP from Human. This PAEP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAEP protein |
PAEP Polyclonal Antibody |
ES10976-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against PAEP from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PAEP Polyclonal Antibody |
ES10976-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PAEP from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PAEP Rabbit pAb |
A11810-100ul |
Abclonal |
100 ul |
EUR 308 |
PAEP Rabbit pAb |
A11810-200ul |
Abclonal |
200 ul |
EUR 459 |
PAEP Rabbit pAb |
A11810-20ul |
Abclonal |
20 ul |
Ask for price |
PAEP Rabbit pAb |
A11810-50ul |
Abclonal |
50 ul |
Ask for price |
PAEP Rabbit pAb |
A14757-100ul |
Abclonal |
100 ul |
EUR 308 |
PAEP Rabbit pAb |
A14757-200ul |
Abclonal |
200 ul |
EUR 459 |
PAEP Rabbit pAb |
A14757-20ul |
Abclonal |
20 ul |
EUR 183 |
PAEP Rabbit pAb |
A14757-50ul |
Abclonal |
50 ul |
EUR 223 |
PAEP Rabbit pAb |
A5751-100ul |
Abclonal |
100 ul |
EUR 308 |
PAEP Rabbit pAb |
A5751-200ul |
Abclonal |
200 ul |
EUR 459 |
PAEP Rabbit pAb |
A5751-20ul |
Abclonal |
20 ul |
EUR 183 |
PAEP Rabbit pAb |
A5751-50ul |
Abclonal |
50 ul |
EUR 223 |
Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit |
DLR-PAEP-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Progestagen Associated Endometrial Protein (PAEP) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit |
DLR-PAEP-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Progestagen Associated Endometrial Protein (PAEP) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit |
RDR-PAEP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit |
RDR-PAEP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit |
RD-PAEP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit |
RD-PAEP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
PAEP Antibody |
33016-100ul |
SAB |
100ul |
EUR 252 |
PAEP Antibody |
DF2701 |
Affbiotech |
200ul |
EUR 304 |
Description: PAEP antibody detects endogenous levels of total PAEP. |
PAEP Antibody |
1-CSB-PA017381LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IP; Recommended dilution: IHC:1:20-1:200, IP:1:200-1:2000 |
PAEP Antibody |
1-CSB-PA043641 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:100-1:300 |
PAEP Antibody |
1-CSB-PA198597 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:100-1:300 |
PAEP Conjugated Antibody |
C33016 |
SAB |
100ul |
EUR 397 |
Anti-PAEP antibody |
STJ28318 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of chromosome 9. The encoded glycoprotein has been previously referred to as pregnancy-associated endometrial alpha-2-globulin, placental protein 14, and glycodelin, but has been officially named progestagen-associated endometrial protein. Three distinct forms, with identical protein backbones but different glycosylation profiles, are found in amniotic fluid, follicular fluid and seminal plasma of the reproductive system. These glycoproteins have distinct and essential roles in regulating a uterine environment suitable for pregnancy and in the timing and occurrence of the appropriate sequence of events in the fertilization process. Alternative splicing results in multiple transcript variants. |
Anti-PAEP antibody |
STJ113389 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of chromosome 9. The encoded glycoprotein has been previously referred to as pregnancy-associated endometrial alpha-2-globulin, placental protein 14, and glycodelin, but has been officially named progestagen-associated endometrial protein. Three distinct forms, with identical protein backbones but different glycosylation profiles, are found in amniotic fluid, follicular fluid and seminal plasma of the reproductive system. These glycoproteins have distinct and essential roles in regulating a uterine environment suitable for pregnancy and in the timing and occurrence of the appropriate sequence of events in the fertilization process. Alternative splicing results in multiple transcript variants. |
Anti-PAEP antibody |
STJ116957 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of chromosome 9. The encoded glycoprotein has been previously referred to as pregnancy-associated endometrial alpha-2-globulin, placental protein 14, and glycodelin, but has been officially named progestagen-associated endometrial protein. Three distinct forms, with identical protein backbones but different glycosylation profiles, are found in amniotic fluid, follicular fluid and seminal plasma of the reproductive system. These glycoproteins have distinct and essential roles in regulating a uterine environment suitable for pregnancy and in the timing and occurrence of the appropriate sequence of events in the fertilization process. Alternative splicing results in multiple transcript variants. |
Anti-PAEP antibody |
STJ192134 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PAEP |
PAEP siRNA |
20-abx927607 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PAEP Antibody, HRP conjugated |
1-CSB-PA017381LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PAEP Antibody, FITC conjugated |
1-CSB-PA017381LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PAEP Antibody, Biotin conjugated |
1-CSB-PA017381LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Human Glycodelin (PAEP) |
1-CSB-EP017381HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 22.4 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Glycodelin(PAEP) expressed in E.coli |
Human Glycodelin (PAEP) |
1-CSB-MP017381HU |
Cusabio |
-
EUR 358.00
-
EUR 1257.00
-
EUR 514.00
-
EUR 927.00
|
|
- MW: 23.9 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Glycodelin(PAEP) expressed in Mammalian cell |
PAEP Blocking Peptide |
DF2701-BP |
Affbiotech |
1mg |
EUR 195 |
PAEP cloning plasmid |
CSB-CL017381HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 543
- Sequence: atgctgtgcctcctgctcaccctgggcgtggccctggtctgtggtgtcccggccatggacatcccccagaccaagcaggacctggagctcccaaagttggcagggacctggcactccatggccatggcgaccaacaacatctccctcatggcgacactgaaggcccctctgagggt
- Show more
|
Description: A cloning plasmid for the PAEP gene. |
Rabbit Progestagen-Associated Endometrial Protein (PAEP) ELISA Kit |
abx362423-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
PAEP protein (His tag) |
80R-2711 |
Fitzgerald |
50 ug |
EUR 424 |
Description: Purified recombinant PAEP protein (His tag) |
Human PAEP shRNA Plasmid |
20-abx953353 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PAEP Recombinant Protein (Human) |
RP022438 |
ABM |
100 ug |
Ask for price |
Progestagen-Associated Endometrial Protein (PAEP) Antibody |
abx028157-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Progestagen-Associated Endometrial Protein (PAEP) Antibody |
abx028157-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Progestagen-Associated Endometrial Protein (PAEP) Antibody |
20-abx004400 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Progestagen Associated Endometrial Protein (PAEP) Antibody |
20-abx178096 |
Abbexa |
|
|
|
Progestagen-Associated Endometrial Protein (PAEP) Antibody |
20-abx211693 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Progestagen-Associated Endometrial Protein (PAEP) Antibody |
20-abx213124 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Progestagen-Associated Endometrial Protein (PAEP) Antibody |
20-abx126995 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Progestagen Associated Endometrial Protein (PAEP) Antibody |
20-abx174167 |
Abbexa |
|
|
|
Progestagen-Associated Endometrial Protein (PAEP) Antibody |
20-abx301834 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Progestagen-Associated Endometrial Protein (PAEP) Antibody (HRP) |
20-abx315904 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Progestagen-Associated Endometrial Protein (PAEP) Antibody (FITC) |
20-abx315905 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Progestagen-Associated Endometrial Protein (PAEP) Antibody (Biotin) |
20-abx315906 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
PAEP Rabbit Polyclonal Antibody