ZBP1 Rabbit Polyclonal Antibody

ZBP1 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

ZBP1 Polyclonal Antibody
ES11422-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ZBP1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
ZBP1 Polyclonal Antibody
ABP60951-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ZBP1 protein at amino acid sequence of 21-70
  • Applications tips:
Description: A polyclonal antibody for detection of ZBP1 from Human. This ZBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ZBP1 protein at amino acid sequence of 21-70
ZBP1 Polyclonal Antibody
ABP60951-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ZBP1 protein at amino acid sequence of 21-70
  • Applications tips:
Description: A polyclonal antibody for detection of ZBP1 from Human. This ZBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ZBP1 protein at amino acid sequence of 21-70
ZBP1 Polyclonal Antibody
ABP60951-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ZBP1 protein at amino acid sequence of 21-70
  • Applications tips:
Description: A polyclonal antibody for detection of ZBP1 from Human. This ZBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ZBP1 protein at amino acid sequence of 21-70
ZBP1 Polyclonal Antibody
28403-100ul 100ul
EUR 252
ZBP1 Polyclonal Antibody
28403-50ul 50ul
EUR 187
ZBP1 Rabbit pAb
A13899-100ul 100 ul
EUR 308
ZBP1 Rabbit pAb
A13899-200ul 200 ul
EUR 459
ZBP1 Rabbit pAb
A13899-20ul 20 ul
EUR 183
ZBP1 Rabbit pAb
A13899-50ul 50 ul
EUR 223
ZBP1 Polyclonal Conjugated Antibody
C28403 100ul
EUR 397
ZBP1 antibody
70R-21368 50 ul
EUR 435
Description: Rabbit polyclonal ZBP1 antibody
ZBP1 Antibody
24608-100ul 100ul
EUR 390
ZBP1 antibody
70R-1257 100 ug
EUR 377
Description: Rabbit polyclonal ZBP1 antibody raised against the middle region of ZBP1
ZBP1 Antibody
1-CSB-PA026311GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ZBP1. Recognizes ZBP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
Rabbit ZBP1 ELISA Kit
ERTZ0008 96Tests
EUR 521
anti- ZBP1 antibody
FNab09586 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200
  • Immunogen: Z-DNA binding protein 1
  • Uniprot ID: Q9H171
  • Gene ID: 81030
Description: Antibody raised against ZBP1
Anti-ZBP1 antibody
PAab09586 100 ug
EUR 412
Anti-ZBP1 antibody
STJ192580 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ZBP1
Anti-ZBP1 antibody
STJ115838 100 µl
EUR 277
Description: This gene encodes a Z-DNA binding protein. The encoded protein plays a role in the innate immune response by binding to foreign DNA and inducing type-I interferon production. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.
Zbp1/ Rat Zbp1 ELISA Kit
ELI-40534r 96 Tests
EUR 886
ZBP1 siRNA
20-abx940166
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ZBP1 siRNA
20-abx940167
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Anti-IMP1 / ZBP1 antibody
STJ72253 100 µg
EUR 359
ZBP1 cloning plasmid
CSB-CL861990HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 450
  • Sequence: atggcccaggctcctgctgacccgggcagagaaggccaccttgaacaaagaatcctgcaggtgctgacagaggctggctccccggtgaaacttgcccagctggtgaaggaatgccaagcacccaagagggagctcaaccaagtcctctaccgaatgaaaaaggagttgaaagtctc
  • Show more
Description: A cloning plasmid for the ZBP1 gene.
ZBP1 cloning plasmid
CSB-CL861990HU2-10ug 10ug
EUR 471
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1290
  • Sequence: ATGGCCCAGGCTCCTGCTGACCCGGGCAGAGAAGGCCACCTTGAACAAAGAATCCTGCAGGTGCTGACAGAGGCTGGCTCCCCGGTGAAACTTGCCCAGCTGGTGAAGGAATGCCAAGCACCCAAGAGGGAGCTCAACCAAGTCCTCTACCGAATGAAAAAGGAGTTGAAAGTCT
  • Show more
Description: A cloning plasmid for the ZBP1 gene.
Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human)
4-PAB552Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZBP1 (Arg10~Pro167)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1)
Mouse ZBP1 shRNA Plasmid
20-abx975072
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human ZBP1 shRNA Plasmid
20-abx962944
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human ZBP1 ELISA Kit
EHZ0008 96Tests
EUR 521
Goat ZBP1 ELISA Kit
EGTZ0008 96Tests
EUR 521
Bovine ZBP1 ELISA Kit
EBZ0008 96Tests
EUR 521
Chicken ZBP1 ELISA Kit
ECKZ0008 96Tests
EUR 521
Anserini ZBP1 ELISA Kit
EAZ0008 96Tests
EUR 521
Canine ZBP1 ELISA Kit
ECZ0008 96Tests
EUR 521
ZBP1 ELISA KIT|Human
EF004355 96 Tests
EUR 689
Porcine ZBP1 ELISA Kit
EPZ0008 96Tests
EUR 521

ZBP1 Rabbit Polyclonal Antibody