GPC2 Rabbit Polyclonal Antibody
GPC2 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
GPC2 Polyclonal Antibody |
ABP58679-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human GPC2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of GPC2 from Human. This GPC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPC2 protein |
GPC2 Polyclonal Antibody |
ABP58679-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human GPC2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of GPC2 from Human. This GPC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPC2 protein |
GPC2 Polyclonal Antibody |
ABP58679-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human GPC2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of GPC2 from Human. This GPC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPC2 protein |
Human Glypican 2 (GPC2) ELISA Kit |
DLR-GPC2-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Glypican 2 (GPC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Glypican 2 (GPC2) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Glypican 2 (GPC2) ELISA Kit |
DLR-GPC2-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Glypican 2 (GPC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Glypican 2 (GPC2) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Glypican 2 (GPC2) ELISA Kit |
RD-GPC2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Glypican 2 (GPC2) ELISA Kit |
RD-GPC2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Glypican 2 (GPC2) ELISA Kit |
RDR-GPC2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Glypican 2 (GPC2) ELISA Kit |
RDR-GPC2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
GPC2 Antibody |
47512-100ul |
SAB |
100ul |
EUR 252 |
Rabbit GPC2 ELISA Kit |
ERTG0234 |
Abclonal |
96Tests |
EUR 521 |
Polyclonal GPC2 Antibody (N-term) |
APR16461G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPC2 (N-term). This antibody is tested and proven to work in the following applications: |
Polyclonal GPC2 Antibody - C-terminal region |
APR16462G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPC2 - C-terminal region. This antibody is tested and proven to work in the following applications: |
GPC2 Conjugated Antibody |
C47512 |
SAB |
100ul |
EUR 397 |
Anti-GPC2 antibody |
STJ192101 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to GPC2 |
GPC2 siRNA |
20-abx902253 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GPC2 siRNA |
20-abx918352 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GPC2 siRNA |
20-abx918353 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Rabbit Glypican 2 (GPC2) ELISA Kit |
abx363696-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Glypican 2 (GPC2) Antibody |
abx028841-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Glypican 2 (GPC2) Antibody |
abx028841-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Glypican 2 (GPC2) Antibody |
20-abx172654 |
Abbexa |
|
|
|
Glypican 2 (GPC2) Antibody |
20-abx176682 |
Abbexa |
|
|
|
GPC2 cloning plasmid |
CSB-CL818680HU-10ug |
Cusabio |
10ug |
EUR 597 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1740
- Sequence: atgtccgcgctgcgacctctcctgcttctgctgctgcctctgtgtcccggtcctggtcccggacccgggagcgaggcaaaggtcacccggagttgtgcagagacccggcaggtgctgggggcccggggatatagcttaaacctaatccctcccgccctgatctcaggtgagcacc
- Show more
|
Description: A cloning plasmid for the GPC2 gene. |
GPC2 Rabbit Polyclonal Antibody