XG Rabbit Polyclonal Antibody
XG Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
XG Polyclonal Antibody |
ABP60937-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human XG protein
- Applications tips:
|
Description: A polyclonal antibody for detection of XG from Human. This XG antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human XG protein |
XG Polyclonal Antibody |
ABP60937-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human XG protein
- Applications tips:
|
Description: A polyclonal antibody for detection of XG from Human. This XG antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human XG protein |
XG Polyclonal Antibody |
A63804 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
Glycoprotein Xg (XG) Antibody |
20-abx318551 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Glycoprotein Xg (XG) Antibody (HRP) |
20-abx305946 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Glycoprotein Xg (XG) Antibody (FITC) |
20-abx305947 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Glycoprotein Xg (XG) Antibody (Biotin) |
20-abx305948 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
XG Antibody |
1-CSB-PA026190LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against XG. Recognizes XG from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000 |
Glycoprotein Xg (XG) Protein |
20-abx263339 |
Abbexa |
-
EUR 1609.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
XG Polyclonal Antibody, HRP Conjugated |
A63805 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
XG Polyclonal Antibody, FITC Conjugated |
A63806 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
XG Polyclonal Antibody, Biotin Conjugated |
A63807 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
Anti-XG antibody |
STJ192120 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to XG |
XG siRNA |
20-abx939974 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-XG |
YF-PA15331 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to XG |
XG Antibody, HRP conjugated |
1-CSB-PA026190LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against XG. Recognizes XG from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
XG Antibody, FITC conjugated |
1-CSB-PA026190LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against XG. Recognizes XG from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
XG Antibody, Biotin conjugated |
1-CSB-PA026190LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against XG. Recognizes XG from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
XG cloning plasmid |
CSB-CL026190HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 546
- Sequence: ATGGAGAGCTGGTGGGGACTTCCCTGTCTTGCGTTCCTGTGTTTTCTAATGCACGCCCGAGGTCAAAGAGACTTTGATTTGGCAGATGCCCTTGATGACCCTGAACCCACCAAGAAGCCAAACTCAGATATCTACCCAAAGCCAAAACCACCTTACTACCCACAGCCCGAGAATCC
- Show more
|
Description: A cloning plasmid for the XG gene. |
Human XG shRNA Plasmid |
20-abx955129 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
XG protein (His tag) |
80R-2709 |
Fitzgerald |
20 ug |
EUR 322 |
Description: Purified recombinant XG protein (His tag) |
XG Recombinant Protein (Human) |
RP044887 |
ABM |
100 ug |
Ask for price |
XG ORF Vector (Human) (pORF) |
ORF014963 |
ABM |
1.0 ug DNA |
EUR 354 |
XG sgRNA CRISPR Lentivector set (Human) |
K2647501 |
ABM |
3 x 1.0 ug |
EUR 339 |
XG Blood Group Human Recombinant Protein |
PROTP55808 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: XG Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 144 amino acids (22-142a.a) and having a molecular mass of 15.5kDa. XG is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
XG sgRNA CRISPR Lentivector (Human) (Target 1) |
K2647502 |
ABM |
1.0 ug DNA |
EUR 154 |
XG sgRNA CRISPR Lentivector (Human) (Target 2) |
K2647503 |
ABM |
1.0 ug DNA |
EUR 154 |
XG sgRNA CRISPR Lentivector (Human) (Target 3) |
K2647504 |
ABM |
1.0 ug DNA |
EUR 154 |
XG Protein Vector (Human) (pPB-C-His) |
PV059849 |
ABM |
500 ng |
EUR 481 |
XG Protein Vector (Human) (pPB-N-His) |
PV059850 |
ABM |
500 ng |
EUR 481 |
XG Protein Vector (Human) (pPM-C-HA) |
PV059851 |
ABM |
500 ng |
EUR 481 |
XG Protein Vector (Human) (pPM-C-His) |
PV059852 |
ABM |
500 ng |
EUR 481 |
Recombinant Human XG Protein, His, E.coli-100ug |
QP13971-100ug |
EnQuireBio |
100ug |
EUR 1261 |
Recombinant Human XG Protein, His, E.coli-10ug |
QP13971-10ug |
EnQuireBio |
10ug |
EUR 201 |
Recombinant Human XG Protein, His, E.coli-2ug |
QP13971-2ug |
EnQuireBio |
2ug |
EUR 155 |
XG 3'UTR GFP Stable Cell Line |
TU078571 |
ABM |
1.0 ml |
EUR 1521 |
XG 3'UTR Luciferase Stable Cell Line |
TU028571 |
ABM |
1.0 ml |
EUR 1521 |
Guinea pig Anti-Zaire+Sudan+Reston+ Bundibugyo+Marburg Glycoproteins combo IgG ELISA Kit, 96 tests, Quantitative |
AE-325600-XG |
Alpha Diagnostics |
1 Kit |
EUR 1260 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
XG Rabbit Polyclonal Antibody