XG Rabbit Polyclonal Antibody

XG Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

XG Polyclonal Antibody
ABP60937-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human XG protein
  • Applications tips:
Description: A polyclonal antibody for detection of XG from Human. This XG antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human XG protein

XG Polyclonal Antibody
ABP60937-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human XG protein
  • Applications tips:
Description: A polyclonal antibody for detection of XG from Human. This XG antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human XG protein

XG Polyclonal Antibody
A63804 100 µg
EUR 570.55
Description: Ask the seller for details

Glycoprotein Xg (XG) Antibody
20-abx318551
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glycoprotein Xg (XG) Antibody (HRP)
20-abx305946
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glycoprotein Xg (XG) Antibody (FITC)
20-abx305947
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glycoprotein Xg (XG) Antibody (Biotin)
20-abx305948
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

XG Antibody
1-CSB-PA026190LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against XG. Recognizes XG from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

Glycoprotein Xg (XG) Protein
20-abx263339
  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.

XG Polyclonal Antibody, HRP Conjugated
A63805 100 µg
EUR 570.55
Description: The best epigenetics products

XG Polyclonal Antibody, FITC Conjugated
A63806 100 µg
EUR 570.55
Description: kits suitable for this type of research

XG Polyclonal Antibody, Biotin Conjugated
A63807 100 µg
EUR 570.55
Description: fast delivery possible

Anti-XG antibody
STJ192120 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to XG

Human Glycoprotein Xg, XG ELISA KIT
ELI-14972h 96 Tests
EUR 824

XG siRNA
20-abx939974
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-XG
YF-PA15331 50 ul
EUR 363
Description: Mouse polyclonal to XG

XG Antibody, HRP conjugated
1-CSB-PA026190LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against XG. Recognizes XG from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

XG Antibody, FITC conjugated
1-CSB-PA026190LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against XG. Recognizes XG from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

XG Antibody, Biotin conjugated
1-CSB-PA026190LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against XG. Recognizes XG from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

XG cloning plasmid
CSB-CL026190HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 546
  • Sequence: ATGGAGAGCTGGTGGGGACTTCCCTGTCTTGCGTTCCTGTGTTTTCTAATGCACGCCCGAGGTCAAAGAGACTTTGATTTGGCAGATGCCCTTGATGACCCTGAACCCACCAAGAAGCCAAACTCAGATATCTACCCAAAGCCAAAACCACCTTACTACCCACAGCCCGAGAATCC
  • Show more
Description: A cloning plasmid for the XG gene.

Human XG shRNA Plasmid
20-abx955129
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

XG protein (His tag)
80R-2709 20 ug
EUR 322
Description: Purified recombinant XG protein (His tag)

XG Recombinant Protein (Human)
RP044887 100 ug Ask for price

XG ORF Vector (Human) (pORF)
ORF014963 1.0 ug DNA
EUR 354

XG sgRNA CRISPR Lentivector set (Human)
K2647501 3 x 1.0 ug
EUR 339

XG Blood Group Human Recombinant Protein
PROTP55808 Regular: 10ug
EUR 317
Description: XG Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 144 amino acids (22-142a.a) and having a molecular mass of 15.5kDa. XG is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

XG sgRNA CRISPR Lentivector (Human) (Target 1)
K2647502 1.0 ug DNA
EUR 154

XG sgRNA CRISPR Lentivector (Human) (Target 2)
K2647503 1.0 ug DNA
EUR 154

XG sgRNA CRISPR Lentivector (Human) (Target 3)
K2647504 1.0 ug DNA
EUR 154

XG Protein Vector (Human) (pPB-C-His)
PV059849 500 ng
EUR 481

XG Protein Vector (Human) (pPB-N-His)
PV059850 500 ng
EUR 481

XG Protein Vector (Human) (pPM-C-HA)
PV059851 500 ng
EUR 481

XG Protein Vector (Human) (pPM-C-His)
PV059852 500 ng
EUR 481

Recombinant Human XG Protein, His, E.coli-100ug
QP13971-100ug 100ug
EUR 1261

Recombinant Human XG Protein, His, E.coli-10ug
QP13971-10ug 10ug
EUR 201

Recombinant Human XG Protein, His, E.coli-2ug
QP13971-2ug 2ug
EUR 155

XG 3'UTR GFP Stable Cell Line
TU078571 1.0 ml
EUR 1521

XG 3'UTR Luciferase Stable Cell Line
TU028571 1.0 ml
EUR 1521

Guinea pig Anti-Zaire+Sudan+Reston+ Bundibugyo+Marburg Glycoproteins combo IgG ELISA Kit, 96 tests, Quantitative
AE-325600-XG 1 Kit
EUR 1260

VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

XG Rabbit Polyclonal Antibody

Apex Business WordPress Theme | Designed by Crafthemes