TPP1 Rabbit Polyclonal Antibody

TPP1 Rabbit Polyclonal Antibody

To Order Now:

TPP1 Polyclonal Antibody

ABP60740-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TPP1 protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of TPP1 from Human, Mouse, Rat. This TPP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TPP1 protein at amino acid sequence of 10-90

TPP1 Polyclonal Antibody

ABP60740-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TPP1 protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of TPP1 from Human, Mouse, Rat. This TPP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TPP1 protein at amino acid sequence of 10-90

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit

DLR-TPP1-Hu-48T 48T
EUR 517
  • Should the Human Tripeptidyl Peptidase I (TPP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tripeptidyl Peptidase I (TPP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit

DLR-TPP1-Hu-96T 96T
EUR 673
  • Should the Human Tripeptidyl Peptidase I (TPP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tripeptidyl Peptidase I (TPP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit

DLR-TPP1-Mu-48T 48T
EUR 527
  • Should the Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tripeptidyl Peptidase I (TPP1) in samples from tissue homogenates or other biological fluids.

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit

DLR-TPP1-Mu-96T 96T
EUR 688
  • Should the Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tripeptidyl Peptidase I (TPP1) in samples from tissue homogenates or other biological fluids.

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit

RDR-TPP1-Hu-48Tests 48 Tests
EUR 544

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit

RDR-TPP1-Hu-96Tests 96 Tests
EUR 756

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit

RDR-TPP1-Mu-48Tests 48 Tests
EUR 557

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit

RDR-TPP1-Mu-96Tests 96 Tests
EUR 774

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit

RD-TPP1-Hu-48Tests 48 Tests
EUR 521

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit

RD-TPP1-Hu-96Tests 96 Tests
EUR 723

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit

RD-TPP1-Mu-48Tests 48 Tests
EUR 533

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit

RD-TPP1-Mu-96Tests 96 Tests
EUR 740

TPP1 Rabbit pAb

A5627-100ul 100 ul
EUR 308

TPP1 Rabbit pAb

A5627-200ul 200 ul
EUR 459

TPP1 Rabbit pAb

A5627-20ul 20 ul
EUR 183

TPP1 Rabbit pAb

A5627-50ul 50 ul
EUR 223

TPP1 Rabbit pAb

A6269-100ul 100 ul
EUR 308

TPP1 Rabbit pAb

A6269-200ul 200 ul
EUR 459

TPP1 Rabbit pAb

A6269-20ul 20 ul Ask for price

TPP1 Rabbit pAb

A6269-50ul 50 ul Ask for price

TPP1 antibody

70R-20940 50 ul
EUR 435
Description: Rabbit polyclonal TPP1 antibody

TPP1 Antibody

ABD7425 100 ug
EUR 438

TPP1 Antibody

32932-100ul 100ul
EUR 252

TPP1 antibody

70R-13534 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal TPP1 antibody

TPP1 Antibody

DF7425 200ul
EUR 304
Description: TPP1 Antibody detects endogenous levels of total TPP1.

TPP1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TPP1. Recognizes TPP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

TPP1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TPP1. Recognizes TPP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

Polyclonal TPP1 Antibody (N-term)

APR13781G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TPP1 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-CLN2 / TPP1 Antibody

APG03348G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-CLN2 / TPP1 . This antibody is tested and proven to work in the following applications:

TPP1 Conjugated Antibody

C32932 100ul
EUR 397

anti- TPP1 antibody

FNab08894 100µg
EUR 548.75
  • Immunogen: tripeptidyl peptidase I
  • Uniprot ID: O14773
  • Gene ID: 1200
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against TPP1

Anti-TPP1 Antibody

PB9899 100ug/vial
EUR 334

Anti-TPP1 antibody

PAab08894 100 ug
EUR 386

Anti-TPP1 antibody

STJ28191 100 µl
EUR 277
Description: This gene encodes a member of the sedolisin family of serine proteases. The protease functions in the lysosome to cleave N-terminal tripeptides from substrates, and has weaker endopeptidase activity. It is synthesized as a catalytically-inactive enzyme which is activated and auto-proteolyzed upon acidification. Mutations in this gene result in late-infantile neuronal ceroid lipofuscinosis, which is associated with the failure to degrade specific neuropeptides and a subunit of ATP synthase in the lysosome.

Anti-TPP1 antibody

STJ27594 100 µl
EUR 277
Description: This gene encodes a member of the sedolisin family of serine proteases. The protease functions in the lysosome to cleave N-terminal tripeptides from substrates, and has weaker endopeptidase activity. It is synthesized as a catalytically-inactive enzyme which is activated and auto-proteolyzed upon acidification. Mutations in this gene result in late-infantile neuronal ceroid lipofuscinosis, which is associated with the failure to degrade specific neuropeptides and a subunit of ATP synthase in the lysosome.

Anti-TPP1 antibody

STJ192438 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TPP1

Tpp1/ Rat Tpp1 ELISA Kit

ELI-36485r 96 Tests
EUR 886

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPP1 (Met1~Pro320)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1)

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPP1 (Gly198~Pro562)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1)


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA10990 50 ul
EUR 363
Description: Mouse polyclonal to TPP1


YF-PA10991 50 ug
EUR 363
Description: Mouse polyclonal to TPP1


YF-PA10992 100 ul
EUR 403
Description: Rabbit polyclonal to TPP1


YF-PA10993 100 ug
EUR 403
Description: Rabbit polyclonal to TPP1

TPP1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TPP1. Recognizes TPP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TPP1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TPP1. Recognizes TPP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TPP1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TPP1. Recognizes TPP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-CLN2 / TPP1 antibody

STJ72001 100 µg
EUR 359

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPP1 (Met1~Pro320)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with APC.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPP1 (Met1~Pro320)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with Biotin.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPP1 (Met1~Pro320)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with Cy3.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPP1 (Met1~Pro320)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with FITC.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPP1 (Met1~Pro320)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with HRP.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPP1 (Met1~Pro320)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with PE.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPP1 (Gly198~Pro562)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with APC.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPP1 (Gly198~Pro562)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with Biotin.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPP1 (Gly198~Pro562)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with Cy3.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPP1 (Gly198~Pro562)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with FITC.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPP1 (Gly198~Pro562)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with HRP.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPP1 (Gly198~Pro562)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with PE.

Rabbit Tripeptidyl Peptidase I (TPP1) ELISA Kit

abx363635-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

TPP1 cloning plasmid

CSB-CL024113HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1692
  • Sequence: atgggactccaagcctgcctcctagggctctttgccctcatcctctctggcaaatgcagttacagcccggagcccgaccagcggaggacgctgcccccaggctgggtgtccctgggccgtgcggaccctgaggaagagctgagtctcacctttgccctgagacagcagaatgtgg
  • Show more
Description: A cloning plasmid for the TPP1 gene.

TPP1 Blocking Peptide

DF7425-BP 1mg
EUR 195


PVT13794 2 ug
EUR 391

Anti-TPP1 (3B1)

YF-MA10174 100 ug
EUR 363
Description: Mouse monoclonal to TPP1

Tripeptidyl Peptidase I (TPP1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Tripeptidyl Peptidase I (TPP1) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Tripeptidyl Peptidase I (TPP1) Antibody

abx145299-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody

abx029244-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody

abx029244-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Tripeptidyl Peptidase I (TPP1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody

abx238894-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Tripeptidyl Peptidase I (TPP1) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPP1 (Met1~Pro320)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with APC-Cy7.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPP1 (Gly198~Pro562)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with APC-Cy7.

Tripeptidyl Peptidase I (TPP1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rat TPP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF003763 96 Tests
EUR 689


ELI-51931d 96 Tests
EUR 928

Human TPP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse TPP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TPP1 Recombinant Protein (Human)

RP032686 100 ug Ask for price

TPP1 Recombinant Protein (Rat)

RP234425 100 ug Ask for price

TPP1 Recombinant Protein (Mouse)

RP180740 100 ug Ask for price

Monoclonal TPP1 Antibody (monoclonal) (M01), Clone: 3B1

APR13780G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human TPP1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3B1. This antibody is applicable in WB and IHC, E

Human TPP1 PicoKine ELISA Kit

EK2042 96 wells
EUR 425
Description: For quantitative detection of human TPP1 in cell culture supernates, serum and plasma (heparin, EDTA).

Tpp1 ORF Vector (Rat) (pORF)

ORF078143 1.0 ug DNA
EUR 506

TPP1 ORF Vector (Human) (pORF)

ORF010896 1.0 ug DNA
EUR 95

Tpp1 ORF Vector (Mouse) (pORF)

ORF060248 1.0 ug DNA
EUR 506

Recombinant Tripeptidyl Peptidase I (TPP1)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O14773
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 38.2kDa
  • Isoelectric Point: 5.7
Description: Recombinant Human Tripeptidyl Peptidase I expressed in: E.coli

Recombinant Tripeptidyl Peptidase I (TPP1)

  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O89023
  • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 43.2kDa
  • Isoelectric Point: 5.9
Description: Recombinant Mouse Tripeptidyl Peptidase I expressed in: E.coli

TPP1 ELISA Kit (Human) (OKCD00354)

OKCD00354 96 Wells
EUR 831
Description: Description of target: Lysosomal serine protease with tripeptidyl-peptidase I activity. May act as a non-specific lysosomal peptidase which generates tripeptides from the breakdown products produced by lysosomal proteinases. Requires substrates with an unsubstituted N-terminus (By similarity).By similarity ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL

TPP1 ELISA Kit (Human) (OKAN06104)

OKAN06104 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the sedolisin family of serine proteases. The protease functions in the lysosome to cleave N-terminal tripeptides from substrates, and has weaker endopeptidase activity. It is synthesized as a catalytically-inactive enzyme which is activated and auto-proteolyzed upon acidification. Mutations in this gene result in late-infantile neuronal ceroid lipofuscinosis, which is associated with the failure to degrade specific neuropeptides and a subunit of ATP synthase in the lysosome.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.055 ng/mL

TPP1 ELISA Kit (Mouse) (OKCD08264)

OKCD08264 96 Wells
EUR 1001
Description: Description of target: This gene encodes a lysosomal serine protease that cleaves N-terminal tripeptides from protein substrates. The encoded preproprotein undergoes autocatalytic processing to generate a mature enzyme. Mice lacking the encoded protein exhibit a progressive neurodegeneration and a greatly shortened lifespan. At the cellular level, mice lacking the encoded protein exhibit accumulation of autofluorescent lipopigments. Mutations in the human ortholog of this gene cause classical late-infantile neuronal ceroid lipofuscinosis.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

TPP1 ELISA Kit (Human) (OKDD00573)

OKDD00573 96 Wells
EUR 975
Description: Description of target: This gene encodes a member of the sedolisin family of serine proteases. The protease functions in the lysosome to cleave N-terminal tripeptides from substrates, and has weaker endopeptidase activity. It is synthesized as a catalytically-inactive enzyme which is activated and auto-proteolyzed upon acidification. Mutations in this gene result in late-infantile neuronal ceroid lipofuscinosis, which is associated with the failure to degrade specific neuropeptides and a subunit of ATP synthase in the lysosome.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.063 ng/mL

TPP1 ELISA Kit (Mouse) (OKDD00789)

OKDD00789 96 Wells
EUR 988
Description: Description of target: This gene encodes a lysosomal serine protease that cleaves n-terminal tripeptides from protein substrates. the encoded preproprotein undergoes autocatalytic processing to generate a mature enzyme. mice lacking the encoded protein exhibit a progressive neurodegeneration and a greatly shortened lifespan. at the cellular level, mice lacking the encoded protein exhibit accumulation of autofluorescent lipopigments. mutations in the human ortholog of this gene cause classical late-infantile neuronal ceroid lipofuscinosis.;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.055ng/mL

TPP1 ELISA Kit (Human) (OKBB01409)

OKBB01409 96 Wells
EUR 505
Description: Description of target: Tripeptidyl-peptidase 1, also known as Lysosomal pepstatin-insensitive protease, is an enzyme that in humans is encoded by the TPP1 gene. The human gene TPP1 encodes a member of the sedolisin family of serine proteases. The human gene has 13 exons and locates at the chromosome band 11p15. This gene encodes a member of the sedolisin family of serine proteases. The protease functions in the lysosome to cleave N-terminal tripeptides from substrates, and has weaker endopeptidase activity. It is synthesized as a catalytically-inactive enzyme which is activated and auto-proteolyzed upon acidification. Mutations in this gene result in late-infantile neuronal ceroid lipofuscinosis, which is associated with the failure to degrade specific neuropeptides and a subunit of ATP synthase in the lysosome.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

Monoclonal TPP1 / CLN2 Antibody (clone 3B1), Clone: 3B1

APR13779G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human TPP1 / CLN2 (clone 3B1). The antibodies are raised in Mouse and are from clone 3B1. This antibody is applicable in WB and IHC-P, E

Mouse Tripeptidyl Peptidase I (TPP1) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Tripeptidyl Peptidase I (TPP1) Protein

  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

TPP1 sgRNA CRISPR Lentivector set (Human)

K2429301 3 x 1.0 ug
EUR 339

Tpp1 sgRNA CRISPR Lentivector set (Mouse)

K3405201 3 x 1.0 ug
EUR 339

Tpp1 sgRNA CRISPR Lentivector set (Rat)

K7023501 3 x 1.0 ug
EUR 339

Pig Tripeptidyl Peptidase I (TPP1) ELISA Kit

abx360652-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Tripeptidyl Peptidase I (TPP1) ELISA Kit

abx364262-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Human Tripeptidyl- peptidase 1, TPP1 ELISA KIT

ELI-16982h 96 Tests
EUR 824

Bovine Tripeptidyl- peptidase 1, TPP1 ELISA KIT

ELI-40084b 96 Tests
EUR 928

Mouse Tripeptidyl- peptidase 1, Tpp1 ELISA KIT

ELI-40085m 96 Tests
EUR 865

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit

abx358322-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Monkey Tripeptidyl Peptidase I (TPP1) ELISA Kit

abx358877-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Tripeptidyl Peptidase I (TPP1) ELISA Kit

abx355837-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Tripeptidyl Peptidase I (TPP1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Tripeptidyl Peptidase I (TPP1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Tripeptidyl Peptidase I (TPP1) CLIA Kit

abx197847-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Tripeptidyl Peptidase I (TPP1)ELISA Kit

201-12-2521 96 tests
EUR 440
  • This Tripeptidyl Peptidase I ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

TPP1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2429302 1.0 ug DNA
EUR 154

TPP1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2429303 1.0 ug DNA
EUR 154

TPP1 Rabbit Polyclonal Antibody