DPPA4 Rabbit Polyclonal Antibody

DPPA4 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

DPPA4 Polyclonal Antibody
ES11028-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DPPA4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
DPPA4 Polyclonal Antibody
ES11028-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DPPA4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
DPPA4 Polyclonal Antibody
ABP58414-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human DPPA4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DPPA4 from Human, Mouse, Rat. This DPPA4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DPPA4 protein
DPPA4 Polyclonal Antibody
ABP58414-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human DPPA4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DPPA4 from Human, Mouse, Rat. This DPPA4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DPPA4 protein
DPPA4 Polyclonal Antibody
ABP58414-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DPPA4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DPPA4 from Human, Mouse, Rat. This DPPA4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DPPA4 protein
DPPA4 Polyclonal Antibody
A58842 100 µg
EUR 570.55
Description: fast delivery possible
DPPA4 Rabbit pAb
A13724-100ul 100 ul
EUR 308
DPPA4 Rabbit pAb
A13724-200ul 200 ul
EUR 459
DPPA4 Rabbit pAb
A13724-20ul 20 ul
EUR 183
DPPA4 Rabbit pAb
A13724-50ul 50 ul
EUR 223
DPPA4 Rabbit pAb
A13725-100ul 100 ul
EUR 308
DPPA4 Rabbit pAb
A13725-200ul 200 ul
EUR 459
DPPA4 Rabbit pAb
A13725-20ul 20 ul
EUR 183
DPPA4 Rabbit pAb
A13725-50ul 50 ul
EUR 223
DPPA4 Rabbit pAb
A9238-100ul 100 ul
EUR 308
DPPA4 Rabbit pAb
A9238-200ul 200 ul
EUR 459
DPPA4 Rabbit pAb
A9238-20ul 20 ul Ask for price
DPPA4 Rabbit pAb
A9238-50ul 50 ul Ask for price
Polyclonal DPPA4 Antibody (Center)
APC00108G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DPPA4 (Center). This antibody is tested and proven to work in the following applications:
DPPA4 antibody
70R-3293 50 ug
EUR 467
Description: Rabbit polyclonal DPPA4 antibody raised against the N terminal of DPPA4
DPPA4 Antibody
EUR 316
DPPA4 Antibody
EUR 146
DPPA4 Antibody
47509-100ul 100ul
EUR 252
DPPA4 antibody
70R-12122 100 ug
EUR 403
Description: Rabbit polyclonal DPPA4 antibody
DPPA4 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DPPA4. Recognizes DPPA4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
Polyclonal DPPA4 Antibody (aa1-50)
APR02983G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DPPA4 (aa1-50). This antibody is tested and proven to work in the following applications:
Polyclonal DPPA4 Antibody (N-term)
AMM06955G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DPPA4 (N-term). This antibody is tested and proven to work in the following applications:
DPPA4 Polyclonal Antibody, Biotin Conjugated
A58843 100 µg
EUR 570.55
Description: reagents widely cited
DPPA4 Polyclonal Antibody, FITC Conjugated
A58844 100 µg
EUR 570.55
Description: Ask the seller for details
DPPA4 Polyclonal Antibody, HRP Conjugated
A58845 100 µg
EUR 570.55
Description: The best epigenetics products
DPPA4 Conjugated Antibody
C47509 100ul
EUR 397
anti- DPPA4 antibody
FNab02525 100µg
EUR 585
  • Immunogen: developmental pluripotency associated 4
  • Uniprot ID: Q7L190
  • Gene ID: 55211
  • Research Area: Stem Cells
Description: Antibody raised against DPPA4
Anti-DPPA4 Antibody
A10283 100 ug
EUR 397
Description: Rabbit Polyclonal DPPA4 Antibody. Validated in WB and tested in Human.
Anti-DPPA4 antibody
PAab02525 100 ug
EUR 412
Anti-DPPA4 antibody
STJ111623 100 µl
EUR 277
Description: This gene encodes a nuclear factor that is involved in the maintenance of pluripotency in stem cells and essential for embryogenesis. The encoded protein has a scaffold-attachment factor A/B, acinus and PIAS (SAP) domain that binds DNA and is thought to modify chromatin. Mice with a homozygous knockout of the orthologous gene die during late embryonic development or within hours after birth. Knockout embryos are normal in size at embryonic day 18.5 but exhibit skeletal and lung tissue abnormalities. This gene, when mutated, is highly expressed in embryonal carcinomas, pluripotent germ cell tumors, and other cancers and is thought to play an important role in tumor progression. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants.
Anti-DPPA4 antibody
STJ192186 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DPPA4
Anti-DPPA4 antibody
STJ115677 100 µl
EUR 277
Description: This gene encodes a nuclear factor that is involved in the maintenance of pluripotency in stem cells and essential for embryogenesis. The encoded protein has a scaffold-attachment factor A/B, acinus and PIAS (SAP) domain that binds DNA and is thought to modify chromatin. Mice with a homozygous knockout of the orthologous gene die during late embryonic development or within hours after birth. Knockout embryos are normal in size at embryonic day 18.5 but exhibit skeletal and lung tissue abnormalities. This gene, when mutated, is highly expressed in embryonal carcinomas, pluripotent germ cell tumors, and other cancers and is thought to play an important role in tumor progression. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants.
Anti-DPPA4 antibody
STJ115678 100 µl
EUR 277
Description: This gene encodes a nuclear factor that is involved in the maintenance of pluripotency in stem cells and essential for embryogenesis. The encoded protein has a scaffold-attachment factor A/B, acinus and PIAS (SAP) domain that binds DNA and is thought to modify chromatin. Mice with a homozygous knockout of the orthologous gene die during late embryonic development or within hours after birth. Knockout embryos are normal in size at embryonic day 18.5 but exhibit skeletal and lung tissue abnormalities. This gene, when mutated, is highly expressed in embryonal carcinomas, pluripotent germ cell tumors, and other cancers and is thought to play an important role in tumor progression. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
YF-PA19622 50 ul
EUR 363
Description: Mouse polyclonal to Dppa4
YF-PA19623 50 ug
EUR 363
Description: Mouse polyclonal to Dppa4
YF-PA19624 50 ug
EUR 363
Description: Mouse polyclonal to Dppa4
YF-PA19625 100 ug
EUR 403
Description: Rabbit polyclonal to Dppa4
DPPA4 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DPPA4. Recognizes DPPA4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
DPPA4 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DPPA4. Recognizes DPPA4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
DPPA4 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DPPA4. Recognizes DPPA4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
DPPA4 Blocking Peptide
33R-6210 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DPPA4 antibody, catalog no. 70R-3293
DPPA4 Blocking Peptide
33R-10939 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DPPA4 antibody, catalog no. 70R-12122
DPPA4 Blocking Peptide
EUR 153
DPPA4 cloning plasmid
CSB-CL765975HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 885
  • Sequence: atggagaaggcaaaaggcaaggagtggacctccacagagaagtcgagggaagaggatcagcaggcttctaatcaaccaaattcaattgctttgccaggaacatcagcaaagagaaccaaagaaaaaatgtctgtcaaaggcagtaaagtgctctgccctaagaaaaaggcagagca
  • Show more
Description: A cloning plasmid for the DPPA4 gene.
Mouse DPPA4 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ELI-09401h 96 Tests
EUR 824
Mouse Dppa4 ELISA KIT
ELI-09402m 96 Tests
EUR 865
EF009215 96 Tests
EUR 689
DPPA4 protein (His tag)
80R-2904 100 ug
EUR 424
Description: Purified recombinant DPPA4 protein (His tag)
Human DPPA4 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
DPPA4 Recombinant Protein (Human)
RP009781 100 ug Ask for price
DPPA4 Recombinant Protein (Mouse)
RP129977 100 ug Ask for price
DPPA4 Recombinant Protein (Mouse)
RP129980 100 ug Ask for price
Developmental Pluripotency-Associated Protein 4 (DPPA4) Antibody
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Developmental Pluripotency-Associated Protein 4 (DPPA4) Antibody
abx028023-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Developmental Pluripotency-Associated Protein 4 (DPPA4) Antibody
abx028023-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Developmental Pluripotency-Associated Protein 4 (DPPA4) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Developmental Pluripotency-Associated Protein 4 (DPPA4) Antibody
abx232525-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
DPPA4 ORF Vector (Human) (pORF)
ORF003261 1.0 ug DNA
EUR 95
Dppa4 ORF Vector (Mouse) (pORF)
ORF043327 1.0 ug DNA
EUR 506
Dppa4 ORF Vector (Mouse) (pORF)
ORF043328 1.0 ug DNA
EUR 506
Developmental Pluripotency-Associated Protein 4 (DPPA4) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Developmental Pluripotency-Associated Protein 4 (DPPA4) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Developmental Pluripotency-Associated Protein 4 (DPPA4) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
DPPA4 sgRNA CRISPR Lentivector set (Human)
K0628801 3 x 1.0 ug
EUR 339
Dppa4 sgRNA CRISPR Lentivector set (Mouse)
K4938401 3 x 1.0 ug
EUR 339
DPPA4 sgRNA CRISPR Lentivector (Human) (Target 1)
K0628802 1.0 ug DNA
EUR 154
DPPA4 sgRNA CRISPR Lentivector (Human) (Target 2)
K0628803 1.0 ug DNA
EUR 154
DPPA4 sgRNA CRISPR Lentivector (Human) (Target 3)
K0628804 1.0 ug DNA
EUR 154
Dppa4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4938402 1.0 ug DNA
EUR 154
Dppa4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4938403 1.0 ug DNA
EUR 154
Dppa4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4938404 1.0 ug DNA
EUR 154
DPPA4 Protein Vector (Mouse) (pPB-C-His)
PV173306 500 ng
EUR 603
DPPA4 Protein Vector (Mouse) (pPB-N-His)
PV173307 500 ng
EUR 603
DPPA4 Protein Vector (Mouse) (pPM-C-HA)
PV173308 500 ng
EUR 603
DPPA4 Protein Vector (Mouse) (pPM-C-His)
PV173309 500 ng
EUR 603
DPPA4 Protein Vector (Mouse) (pPB-C-His)
PV173310 500 ng
EUR 603
DPPA4 Protein Vector (Mouse) (pPB-N-His)
PV173311 500 ng
EUR 603
DPPA4 Protein Vector (Mouse) (pPM-C-HA)
PV173312 500 ng
EUR 603
DPPA4 Protein Vector (Mouse) (pPM-C-His)
PV173313 500 ng
EUR 603
Recombinant Human DPPA4 Protein, His, E.coli-1mg
QP11699-1mg 1mg
EUR 3655
Recombinant Human DPPA4 Protein, His, E.coli-20ug
QP11699-20ug 20ug
EUR 201
Recombinant Human DPPA4 Protein, His, E.coli-5ug
QP11699-5ug 5ug
EUR 155
DPPA4 Protein Vector (Human) (pPB-C-His)
PV013041 500 ng
EUR 329
DPPA4 Protein Vector (Human) (pPB-N-His)
PV013042 500 ng
EUR 329
DPPA4 Protein Vector (Human) (pPM-C-HA)
PV013043 500 ng
EUR 329
DPPA4 Protein Vector (Human) (pPM-C-His)
PV013044 500 ng
EUR 329
Dppa4 3'UTR GFP Stable Cell Line
TU155370 1.0 ml Ask for price
DPPA4 3'UTR Luciferase Stable Cell Line
TU006286 1.0 ml
EUR 1521
Dppa4 3'UTR Luciferase Stable Cell Line
TU105370 1.0 ml Ask for price
DPPA4 3'UTR GFP Stable Cell Line
TU056286 1.0 ml
EUR 1521
DPPA4 Developmental Pluripotency Associated 4 Human Recombinant Protein
PROTQ7L190 Regular: 20ug
EUR 317
Description: DPPA4 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 327 amino acids (1-304) and having a molecular mass of 35.9kDa.;DPPA4 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

DPPA4 Rabbit Polyclonal Antibody