LGMN Rabbit Polyclonal Antibody

LGMN Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

Human Legumain (LGMN) ELISA Kit
RDR-LGMN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Legumain (LGMN) ELISA Kit
RDR-LGMN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Legumain (LGMN) ELISA Kit
RDR-LGMN-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Legumain (LGMN) ELISA Kit
RDR-LGMN-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Human Legumain (LGMN) ELISA Kit
RD-LGMN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Legumain (LGMN) ELISA Kit
RD-LGMN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Legumain (LGMN) ELISA Kit
RD-LGMN-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Legumain (LGMN) ELISA Kit
RD-LGMN-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

LGMN Polyclonal Antibody
27479-100ul	SAB	100ul	EUR 252

LGMN Polyclonal Antibody
27479-50ul	SAB	50ul	EUR 187

LGMN Polyclonal Antibody
A69571	EpiGentek	100 ?g	EUR 628.55
Description: The best epigenetics products

LGMN Polyclonal Antibody
ABP59112-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human LGMN protein at amino acid sequence of 60-140 Applications tips:
Description: A polyclonal antibody for detection of LGMN from Human, Mouse, Rat. This LGMN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LGMN protein at amino acid sequence of 60-140

LGMN Polyclonal Antibody
ABP59112-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human LGMN protein at amino acid sequence of 60-140 Applications tips:
Description: A polyclonal antibody for detection of LGMN from Human, Mouse, Rat. This LGMN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LGMN protein at amino acid sequence of 60-140

LGMN Polyclonal Antibody
ABP59112-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human LGMN protein at amino acid sequence of 60-140 Applications tips:
Description: A polyclonal antibody for detection of LGMN from Human, Mouse, Rat. This LGMN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LGMN protein at amino acid sequence of 60-140

LGMN Polyclonal Antibody
ES11326-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against LGMN from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

LGMN Polyclonal Antibody
ES11326-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against LGMN from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

LGMN Rabbit pAb
A10570-100ul	Abclonal	100 ul	EUR 308

LGMN Rabbit pAb
A10570-200ul	Abclonal	200 ul	EUR 459

LGMN Rabbit pAb
A10570-20ul	Abclonal	20 ul	EUR 183

LGMN Rabbit pAb
A10570-50ul	Abclonal	50 ul	EUR 223

LGMN Polyclonal Conjugated Antibody
C27479	SAB	100ul	EUR 397

LGMN Antibody
1-CSB-PA012903LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LGMN. Recognizes LGMN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:500-1:1000

Polyclonal LGMN Antibody (N-term)
APR08220G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LGMN (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal LGMN Antibody - middle region
APR08221G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LGMN - middle region. This antibody is tested and proven to work in the following applications:

LGMN Polyclonal Antibody, HRP Conjugated
A69572	EpiGentek	100 ?g	EUR 628.55
Description: kits suitable for this type of research

LGMN Polyclonal Antibody, FITC Conjugated
A69573	EpiGentek	100 ?g	EUR 628.55
Description: fast delivery possible

LGMN Polyclonal Antibody, Biotin Conjugated
A69574	EpiGentek	100 ?g	EUR 628.55
Description: reagents widely cited

Legumain (LGMN) Polyclonal Antibody (Mouse)
4-PAC564Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LGMN (Val18~Tyr435) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN)

Legumain (LGMN) Polyclonal Antibody (Mouse), APC
4-PAC564Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LGMN (Val18~Tyr435) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with APC.

Legumain (LGMN) Polyclonal Antibody (Mouse), Biotinylated
4-PAC564Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LGMN (Val18~Tyr435) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with Biotin.

Legumain (LGMN) Polyclonal Antibody (Mouse), Cy3
4-PAC564Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LGMN (Val18~Tyr435) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with Cy3.

Legumain (LGMN) Polyclonal Antibody (Mouse), FITC
4-PAC564Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LGMN (Val18~Tyr435) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with FITC.

Legumain (LGMN) Polyclonal Antibody (Mouse), HRP
4-PAC564Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LGMN (Val18~Tyr435) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with HRP.

Legumain (LGMN) Polyclonal Antibody (Mouse), PE
4-PAC564Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LGMN (Val18~Tyr435) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with PE.

Legumain (LGMN) Antibody
20-abx177320	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Legumain (LGMN) Antibody
20-abx126093	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Legumain (LGMN) Antibody
20-abx128416	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Legumain (LGMN) Antibody
20-abx129426	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Legumain (LGMN) Antibody
abx145639-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Legumain (LGMN) Antibody
20-abx173322	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Legumain (LGMN) Antibody
abx031307-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Legumain (LGMN) Antibody
abx031307-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Legumain (LGMN) Antibody
20-abx334421	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-LGMN antibody
STJ112585	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal systems. Enzyme activation is triggered by acidic pH and appears to be autocatalytic. Protein expression occurs after monocytes differentiate into dendritic cells. A fully mature, active enzyme is produced following lipopolysaccharide expression in mature dendritic cells. Overexpression of this gene may be associated with the majority of solid tumor types. This gene has a pseudogene on chromosome 13. Several alternatively spliced transcript variants have been described, but the biological validity of only two has been determined. These two variants encode the same isoform.

Anti-LGMN Antibody
STJ501591	St John's Laboratory	100 µg	EUR 476

Anti-LGMN antibody
STJ192484	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to LGMN

Lgmn/ Rat Lgmn ELISA Kit
ELI-03979r	Lifescience Market	96 Tests	EUR 886

Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat)
4-PAC564Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LGMN (Val18~Tyr433) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN)

Legumain (LGMN) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC564Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LGMN (Val18~Tyr435) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with APC-Cy7.

LGMN protein
80R-4392	Fitzgerald	50 ug	EUR 349
Description: Purified Recombinant LGMN protein

LGMN siRNA
20-abx902970	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LGMN siRNA
20-abx922498	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LGMN siRNA
20-abx922499	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LGMN Antibody, HRP conjugated
1-CSB-PA012903LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LGMN. Recognizes LGMN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LGMN Antibody, FITC conjugated
1-CSB-PA012903LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LGMN. Recognizes LGMN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LGMN Antibody, Biotin conjugated
1-CSB-PA012903LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LGMN. Recognizes LGMN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Legumain (LGMN) Antibody (HRP)
20-abx336315	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Legumain (LGMN) Antibody (FITC)
20-abx336316	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Legumain (LGMN) Antibody (Biotin)
20-abx336317	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-LGMN Antibody (Biotin)
STJ501592	St John's Laboratory	100 µg	EUR 586

Anti-LGMN Antibody (FITC)
STJ501593	St John's Laboratory	100 µg	EUR 586

Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), APC
4-PAC564Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LGMN (Val18~Tyr433) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with APC.

Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated
4-PAC564Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LGMN (Val18~Tyr433) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with Biotin.

Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), Cy3
4-PAC564Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LGMN (Val18~Tyr433) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with Cy3.

Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), FITC
4-PAC564Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LGMN (Val18~Tyr433) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with FITC.

Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), HRP
4-PAC564Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LGMN (Val18~Tyr433) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with HRP.

Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), PE
4-PAC564Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LGMN (Val18~Tyr433) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with PE.

Human Legumain (LGMN)
1-CSB-EP012903HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 38.8 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Legumain(LGMN) expressed in E.coli

Mouse Legumain (Lgmn)
1-CSB-EP012903MO	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 38.8 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Legumain(Lgmn) expressed in E.coli

Human Legumain (LGMN)
1-CSB-YP012903HU	Cusabio	EUR 504.00 EUR 265.00 EUR 1832.00 EUR 763.00 EUR 1216.00 EUR 334.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 36.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Legumain(LGMN) expressed in Yeast

Mouse Legumain (Lgmn)
1-CSB-YP012903MO	Cusabio	EUR 586.00 EUR 299.00 EUR 2172.00 EUR 900.00 EUR 1442.00 EUR 382.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 36.8 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Legumain(Lgmn) expressed in Yeast

LGMN cloning plasmid
CSB-CL012903HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1302 Sequence: atggtttggaaagtagctgtattcctcagtgtggccctgggcattggtgccattcctatagatgatcctgaagatggaggcaagcactgggtggtgatcgtggcaggttcaaatggctggtataattataggcaccaggcagacgcgtgccatgcctaccagatcattcaccgca Show more
Description: A cloning plasmid for the LGMN gene.

Recombinant Legumain (LGMN)
4-RPC564Hu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q99538 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 51.4kDa Isoelectric Point: Inquire
Description: Recombinant Human Legumain expressed in: E.coli

Recombinant Legumain (LGMN)
4-RPC564Mu01	Cloud-Clone	EUR 485.28 EUR 233.00 EUR 1544.80 EUR 581.60 EUR 1063.20 EUR 388.00 EUR 3712.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O89017 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 51.3KDa Isoelectric Point: 5.9
Description: Recombinant Mouse Legumain expressed in: E.coli

Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7
4-PAC564Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LGMN (Val18~Tyr433) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with APC-Cy7.

Macaca fascicularis Legumain (LGMN)
1-CSB-EP012903MOV	Cusabio	EUR 611.00 EUR 309.00 EUR 1827.00 EUR 939.00 EUR 1218.00 EUR 397.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 39.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Macaca fascicularis Legumain(LGMN) expressed in E.coli

Human Legumain (LGMN) Protein
20-abx166733	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Legumain (LGMN) Protein
20-abx167282	Abbexa	EUR 676.00 EUR 286.00 EUR 2082.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human LGMN ELISA Kit
ELA-E1201h	Lifescience Market	96 Tests	EUR 824

LGMN ELISA KIT|Human
EF004361	Lifescience Market	96 Tests	EUR 689

Mouse LGMN shRNA Plasmid
20-abx972224	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat LGMN shRNA Plasmid
20-abx986104	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human LGMN shRNA Plasmid
20-abx953802	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Macaca fascicularis Legumain (LGMN)
1-CSB-BP012903MOVb1	Cusabio	EUR 840.00 EUR 332.00 EUR 2170.00 EUR 1135.00 EUR 1579.00 EUR 470.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 38.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Macaca fascicularis Legumain(LGMN) expressed in Baculovirus

LGMN Recombinant Protein (Human)
RP017755	ABM	100 ug	Ask for price

LGMN Recombinant Protein (Rat)
RP208091	ABM	100 ug	Ask for price

LGMN Recombinant Protein (Mouse)
RP147344	ABM	100 ug	Ask for price

Monoclonal LGMN Antibody (monoclonal) (M02), Clone: M1
APR08219G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human LGMN (monoclonal) (M02). The antibodies are raised in mouse and are from clone M1. This antibody is applicable in E

Human Legumain(LGMN) ELISA kit
CSB-EL012903HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Legumain (LGMN) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Legumain(LGMN) ELISA kit
1-CSB-EL012903HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Legumain(LGMN) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Legumain (LGMN) ELISA Kit
20-abx154315	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Legumain (LGMN) ELISA Kit
20-abx152188	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Cow Legumain (LGMN) ELISA Kit
abx257255-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Lgmn/ Legumain ELISA Kit
E0866Mo	Sunlong	1 Kit	EUR 571

Human LGMN/ Legumain ELISA Kit
E1457Hu	Sunlong	1 Kit	EUR 571

Bovine LGMN(Legumain) ELISA Kit
EB0051	FN Test	96T	EUR 567.6
Detection range: 78-5000 pg/ml Uniprot ID: Q95M12
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Cattle;Sensitivity: 46.9pg/ml

Human LGMN(Legumain) ELISA Kit
EH1372	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: Q99538 Alias: LGMN(Legumain)/AEP/LGMN1/PRSC1/Protease, cysteine 1/Asparaginyl Endopeptidase/cysteine protease 1/legumain/protease, cysteine, 1(legumain)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Bovine Legumain, LGMN ELISA KIT
ELI-03977b	Lifescience Market	96 Tests	EUR 928

Human Legumain, LGMN ELISA KIT
ELI-03978h	Lifescience Market	96 Tests	EUR 824

Mouse Legumain, Lgmn ELISA KIT
ELI-03980m	Lifescience Market	96 Tests	EUR 865

Mouse Legumain (LGMN) ELISA Kit
abx571481-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Legumain (LGMN) ELISA Kit
abx572419-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Legumain (LGMN) ELISA Kit
abx515751-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Legumain (LGMN) CLIA Kit
20-abx493769	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Legumain (LGMN) CLIA Kit
20-abx493770	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Lgmn ORF Vector (Rat) (pORF)
ORF069365	ABM	1.0 ug DNA	EUR 506

LGMN ORF Vector (Human) (pORF)
ORF005919	ABM	1.0 ug DNA	EUR 95

Lgmn ORF Vector (Mouse) (pORF)
ORF049116	ABM	1.0 ug DNA	EUR 506

LGMN Legumain Human Recombinant Protein
PROTQ99538	BosterBio	Regular: 10ug	EUR 317
Description: LGMN produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain (18-433 a.a.) and fused to a 6 aa His Tag at C-terminus containing a total of 422 amino acids and having a molecular mass of 48.4kDa (Molecular size on SDS-PAGE will appear at approximately 40-57kDa).;LGMN is purified by proprietary chromatographic techniques.

LGMN Legumain Mouse Recombinant Protein
PROTO89017	BosterBio	Regular: 10ug	EUR 317
Description: LGMN produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 426 amino acids (18-435a.a.) and having a molecular mass of 48.6kDa. (Molecular size on SDS-PAGE will appear at approximately 40-57kDa). LGMN is expressed with an 8 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

Human Legumain(LGMN)ELISA Kit
QY-E01245	Qayee Biotechnology	96T	EUR 361

Human Legumain (LGMN) ELISA Kit
SEC564Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Legumain (LGMN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Legumain (LGMN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Legumain (LGMN) ELISA Kit
SEC564Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Legumain (LGMN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Legumain (LGMN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Legumain (LGMN) ELISA Kit
SEC564Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Legumain (LGMN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Legumain (LGMN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Legumain (LGMN) ELISA Kit
SEC564Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Legumain (LGMN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Legumain (LGMN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Legumain (LGMN) ELISA Kit
4-SEC564Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Legumain elisa. Alternative names of the recognized antigen: AEP LGMN1 PRSC1 Protease, Cysteine 1 Asparaginyl endopeptidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Legumain (LGMN) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Legumain (LGMN) ELISA Kit
SEC564Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Legumain (LGMN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Legumain (LGMN) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Legumain (LGMN) ELISA Kit
SEC564Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Legumain (LGMN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Legumain (LGMN) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Legumain (LGMN) ELISA Kit
SEC564Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Legumain (LGMN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Legumain (LGMN) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Legumain (LGMN) ELISA Kit
SEC564Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Legumain (LGMN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Legumain (LGMN) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Legumain (LGMN) ELISA Kit
4-SEC564Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Legumain elisa. Alternative names of the recognized antigen: AEP LGMN1 PRSC1 Protease, Cysteine 1 Asparaginyl endopeptidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Legumain (LGMN) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

LGMN ELISA Kit (Mouse) (OKCD02687)
OKCD02687	Aviva Systems Biology	96 Wells	EUR 857
Description: Description of target: Has a strict specificity for hydrolysis of asparaginyl bonds. Can also cleave aspartyl bonds slowly, especially under acidic conditions. May be involved in the processing of proteins for MHC class II antigen presentation in the lysosomal/endosomal system. Required for normal lysosomal protein degradation in renal proximal tubules. Required for normal degradation of internalized EGFR. Plays a role in the regulation of cell proliferation via its role in EGFR degradation.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.055 ng/mL

LGMN ELISA Kit (Human) (OKBB01091)
OKBB01091	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Legumain (asparaginyl endopeptidase, citvac, proteinase B, hemoglobinase, PRSC1 gene product or LGMN (Homo sapiens), vicilin peptidohydrolase, bean endopeptidase) is an enzyme that in humans is encoded by the LGMN gene (previous symbolPRSC1). Using fluorescence in situ hybridization, the LGMN gene was mapped to chromosome 14q32.1. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal systems. Enzyme activation is triggered by acidic pH and appears to be autocatalytic. Protein expression occurs after monocytes differentiate into dendritic cells. A fully mature, active enzyme is produced following lipopolysaccharide expression in mature dendritic cells. Overexpression of this gene may be associated with the majority of solid tumor types.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

Lgmn ELISA Kit (Mouse) (OKBB01092)
OKBB01092	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Legumain (asparaginyl endopeptidase, citvac, proteinase B, hemoglobinase, PRSC1 gene product or LGMN (Homo sapiens), vicilin peptidohydrolase, bean endopeptidase) is an enzyme that in humans is encoded by the LGMN gene (previous symbolPRSC1). Using fluorescence in situ hybridization, the LGMN gene was mapped to chromosome 14q32.1. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal systems. Enzyme activation is triggered by acidic pH and appears to be autocatalytic. Protein expression occurs after monocytes differentiate into dendritic cells. A fully mature, active enzyme is produced following lipopolysaccharide expression in mature dendritic cells. Overexpression of this gene may be associated with the majority of solid tumor types.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

Lgmn ELISA Kit (Rat) (OKBB01467)
OKBB01467	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Legumain is a protein that in humans is encoded by the LGMN gene. It is mapped to 6q32. This gene encodes a cysteine protease, legumain, that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal systems. Enzyme activation is triggered by acidic pH and appears to be autocatalytic. Protein expression occurs after monocytes differentiate into dendritic cells. A fully mature, active enzyme is produced following lipopolysaccharide expression in mature dendritic cells. Overexpression of this gene may be associated with the majority of solid tumor types. This gene has a pseudogene on chromosome 13. Several alternatively spliced transcript variants have been described, but the biological validity of only two has been determined. These two variants encode the same isoform.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

LGMN ELISA Kit (Human) (OKCD08182)
OKCD08182	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene encodes a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal systems. Enzyme activation is triggered by acidic pH and appears to be autocatalytic. Protein expression occurs after monocytes differentiate into dendritic cells. A fully mature, active enzyme is produced following lipopolysaccharide expression in mature dendritic cells. Overexpression of this gene may be associated with the majority of solid tumor types. This gene has a pseudogene on chromosome 13. Several alternatively spliced transcript variants have been described, but the biological validity of only two has been determined. ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.123ng/mL

LGMN ELISA Kit (Human) (OKEH00861)
OKEH00861	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: This gene encodes a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal systems. Enzyme activation is triggered by acidic pH and appears to be autocatalytic. Protein expression occurs after monocytes differentiate into dendritic cells. A fully mature, active enzyme is produced following lipopolysaccharide expression in mature dendritic cells. Overexpression of this gene may be associated with the majority of solid tumor types. This gene has a pseudogene on chromosome 13. Several alternatively spliced transcript variants have been described, but the biological validity of only two has been determined. These two variants encode the same isoform.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.087 ng/mL

LGMN ELISA Kit (Rat) (OKEH06205)
OKEH06205	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Has a strict specificity for hydrolysis of asparaginyl bonds. Can also cleave aspartyl bonds slowly, especially under acidic conditions. Required for normal lysosomal protein degradation in renal proximal tubules. Required for normal degradation of internalized EGFR. Plays a role in the regulation of cell proliferation via its role in EGFR degradation. May be involved in the processing of proteins for MHC class II antigen presentation in the lysosomal/endosomal system.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.086 ng/mL

LGMN ELISA Kit (Mouse) (OKEH07038)
OKEH07038	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Has a strict specificity for hydrolysis of asparaginyl bonds. Can also cleave aspartyl bonds slowly, especially under acidic conditions. May be involved in the processing of proteins for MHC class II antigen presentation in the lysosomal/endosomal system. Required for normal lysosomal protein degradation in renal proximal tubules. Required for normal degradation of internalized EGFR. Plays a role in the regulation of cell proliferation via its role in EGFR degradation.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 41 pg/mL

ELISA kit for Human LGMN (Legumain)
ELK3223	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Legumain (LGMN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Legumain (LGMN). N Show more
Description: A sandwich ELISA kit for detection of Legumain from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse LGMN (Legumain)
ELK6820	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Legumain (LGMN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Legumain (LGMN). N Show more
Description: A sandwich ELISA kit for detection of Legumain from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Lgmn sgRNA CRISPR Lentivector set (Rat)
K6909401	ABM	3 x 1.0 ug	EUR 339

Lgmn sgRNA CRISPR Lentivector set (Mouse)
K3716501	ABM	3 x 1.0 ug	EUR 339

LGMN sgRNA CRISPR Lentivector set (Human)
K1211801	ABM	3 x 1.0 ug	EUR 339

ELISA kit for Mouse Legumain (LGMN)
KTE71475-48T	Abbkine	48T	EUR 332
Legumain is a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal sy Show more
Description: Quantitative sandwich ELISA for measuring Mouse Legumain (LGMN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Legumain (LGMN)
KTE71475-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Legumain is a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal sy Show more
Description: Quantitative sandwich ELISA for measuring Mouse Legumain (LGMN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Legumain (LGMN)
KTE71475-96T	Abbkine	96T	EUR 539
Legumain is a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal sy Show more
Description: Quantitative sandwich ELISA for measuring Mouse Legumain (LGMN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Legumain (LGMN)
KTE61817-48T	Abbkine	48T	EUR 332
Legumain is a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal sy Show more
Description: Quantitative sandwich ELISA for measuring Human Legumain (LGMN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Legumain (LGMN)
KTE61817-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Legumain is a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal sy Show more
Description: Quantitative sandwich ELISA for measuring Human Legumain (LGMN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Legumain (LGMN)
KTE61817-96T	Abbkine	96T	EUR 539
Legumain is a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal sy Show more
Description: Quantitative sandwich ELISA for measuring Human Legumain (LGMN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

LGMN ELISA Kit| Bovine Legumain ELISA Kit
EF011005	Lifescience Market	96 Tests	EUR 689

Lgmn sgRNA CRISPR Lentivector (Rat) (Target 1)
K6909402	ABM	1.0 ug DNA	EUR 154

Lgmn sgRNA CRISPR Lentivector (Rat) (Target 2)
K6909403	ABM	1.0 ug DNA	EUR 154

Lgmn sgRNA CRISPR Lentivector (Rat) (Target 3)
K6909404	ABM	1.0 ug DNA	EUR 154

Lgmn sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3716502	ABM	1.0 ug DNA	EUR 154

Lgmn sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3716503	ABM	1.0 ug DNA	EUR 154

Lgmn sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3716504	ABM	1.0 ug DNA	EUR 154

LGMN sgRNA CRISPR Lentivector (Human) (Target 1)
K1211802	ABM	1.0 ug DNA	EUR 154

LGMN sgRNA CRISPR Lentivector (Human) (Target 2)
K1211803	ABM	1.0 ug DNA	EUR 154

LGMN sgRNA CRISPR Lentivector (Human) (Target 3)
K1211804	ABM	1.0 ug DNA	EUR 154

LGMN Protein Vector (Human) (pPB-C-His)
PV023673	ABM	500 ng	EUR 329

LGMN Protein Vector (Human) (pPB-N-His)
PV023674	ABM	500 ng	EUR 329

LGMN Protein Vector (Human) (pPM-C-HA)
PV023675	ABM	500 ng	EUR 329

LGMN Protein Vector (Human) (pPM-C-His)
PV023676	ABM	500 ng	EUR 329

LGMN Protein Vector (Rat) (pPB-C-His)
PV277458	ABM	500 ng	EUR 603

LGMN Protein Vector (Rat) (pPB-N-His)
PV277459	ABM	500 ng	EUR 603

LGMN Protein Vector (Rat) (pPM-C-HA)
PV277460	ABM	500 ng	EUR 603

LGMN Protein Vector (Rat) (pPM-C-His)
PV277461	ABM	500 ng	EUR 603

LGMN Protein Vector (Mouse) (pPB-C-His)
PV196462	ABM	500 ng	EUR 603

LGMN Protein Vector (Mouse) (pPB-N-His)
PV196463	ABM	500 ng	EUR 603

LGMN Protein Vector (Mouse) (pPM-C-HA)
PV196464	ABM	500 ng	EUR 603

LGMN Protein Vector (Mouse) (pPM-C-His)
PV196465	ABM	500 ng	EUR 603

Lgmn 3'UTR Luciferase Stable Cell Line
TU111027	ABM	1.0 ml	Ask for price

Lgmn 3'UTR GFP Stable Cell Line
TU161027	ABM	1.0 ml	Ask for price

Lgmn 3'UTR Luciferase Stable Cell Line
TU207045	ABM	1.0 ml	Ask for price

Lgmn 3'UTR GFP Stable Cell Line
TU257045	ABM	1.0 ml	Ask for price

LGMN 3'UTR GFP Stable Cell Line
TU062424	ABM	1.0 ml	EUR 1394

LGMN 3'UTR Luciferase Stable Cell Line
TU012424	ABM	1.0 ml	EUR 1394

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

LGMN Rabbit Polyclonal Antibody