TDGF1 Rabbit Polyclonal Antibody
TDGF1 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
TDGF1 Polyclonal Antibody |
ABP60649-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human TDGF1 protein at amino acid sequence of 21-70
- Applications tips:
|
Description: A polyclonal antibody for detection of TDGF1 from Human. This TDGF1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TDGF1 protein at amino acid sequence of 21-70 |
TDGF1 Polyclonal Antibody |
ABP60649-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human TDGF1 protein at amino acid sequence of 21-70
- Applications tips:
|
Description: A polyclonal antibody for detection of TDGF1 from Human. This TDGF1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TDGF1 protein at amino acid sequence of 21-70 |
TDGF1 Polyclonal Antibody |
ABP60649-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human TDGF1 protein at amino acid sequence of 21-70
- Applications tips:
|
Description: A polyclonal antibody for detection of TDGF1 from Human. This TDGF1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TDGF1 protein at amino acid sequence of 21-70 |
TDGF1 Polyclonal Antibody |
A54133 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
TDGF1 Polyclonal Antibody |
A54137 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
TDGF1 Rabbit pAb |
A1065-100ul |
Abclonal |
100 ul |
EUR 308 |
TDGF1 Rabbit pAb |
A1065-200ul |
Abclonal |
200 ul |
EUR 459 |
TDGF1 Rabbit pAb |
A1065-20ul |
Abclonal |
20 ul |
EUR 183 |
TDGF1 Rabbit pAb |
A1065-50ul |
Abclonal |
50 ul |
EUR 223 |
TDGF1 Rabbit pAb |
A11415-100ul |
Abclonal |
100 ul |
EUR 308 |
TDGF1 Rabbit pAb |
A11415-200ul |
Abclonal |
200 ul |
EUR 459 |
TDGF1 Rabbit pAb |
A11415-20ul |
Abclonal |
20 ul |
EUR 183 |
TDGF1 Rabbit pAb |
A11415-50ul |
Abclonal |
50 ul |
EUR 223 |
Human Teratocarcinoma Derived Growth Factor 1 (TDGF1) ELISA Kit |
DLR-TDGF1-Hu-48T |
DL Develop |
48T |
EUR 463 |
- Should the Human Teratocarcinoma Derived Growth Factor 1 (TDGF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Teratocarcinoma Derived Growth Factor 1 (TDGF1) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Teratocarcinoma Derived Growth Factor 1 (TDGF1) ELISA Kit |
DLR-TDGF1-Hu-96T |
DL Develop |
96T |
EUR 599 |
- Should the Human Teratocarcinoma Derived Growth Factor 1 (TDGF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Teratocarcinoma Derived Growth Factor 1 (TDGF1) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Teratocarcinoma Derived Growth Factor 1 (TDGF1) ELISA Kit |
RD-TDGF1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 460 |
Human Teratocarcinoma Derived Growth Factor 1 (TDGF1) ELISA Kit |
RD-TDGF1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 636 |
Human Teratocarcinoma Derived Growth Factor 1 (TDGF1) ELISA Kit |
RDR-TDGF1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 481 |
Human Teratocarcinoma Derived Growth Factor 1 (TDGF1) ELISA Kit |
RDR-TDGF1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 665 |
Rabbit TDGF1 ELISA Kit |
ERTT0113 |
Abclonal |
96Tests |
EUR 521 |
TDGF1 Antibody |
BF0656 |
Affbiotech |
200ul |
EUR 376 |
Description: TDGF1 antibody detects endogenous levels of total TDGF1. |
TDGF1 antibody |
70R-35633 |
Fitzgerald |
100 ug |
EUR 349 |
Description: Rabbit polyclonal TDGF1 antibody |
TDGF1 Antibody |
37506-100ul |
SAB |
100ul |
EUR 252 |
TDGF1 antibody |
38173-100ul |
SAB |
100ul |
EUR 252 |
TDGF1 antibody |
10R-11054 |
Fitzgerald |
100 ug |
EUR 349 |
Description: Mouse monoclonal TDGF1 antibody |
TDGF1 Antibody |
DF6210 |
Affbiotech |
200ul |
EUR 304 |
Description: TDGF1 Antibody detects endogenous levels of total TDGF1. |
TDGF1 Antibody |
1-CSB-PA170873 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against TDGF1. Recognizes TDGF1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:100 |
TDGF1 Antibody |
1-CSB-PA10764A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TDGF1. Recognizes TDGF1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
TDGF1 Antibody |
1-CSB-PA10769A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TDGF1. Recognizes TDGF1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
TDGF1 Antibody |
1-CSB-PA023343ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against TDGF1. Recognizes TDGF1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
TDGF1 Antibody |
1-CSB-PA023343ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against TDGF1. Recognizes TDGF1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
TDGF1 Polyclonal Antibody, HRP Conjugated |
A54134 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
TDGF1 Polyclonal Antibody, FITC Conjugated |
A54135 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
TDGF1 Polyclonal Antibody, Biotin Conjugated |
A54136 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
TDGF1 Polyclonal Antibody, HRP Conjugated |
A54138 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
TDGF1 Polyclonal Antibody, FITC Conjugated |
A54139 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
TDGF1 Polyclonal Antibody, Biotin Conjugated |
A54140 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
Polyclonal (Mouse) Tdgf1 Antibody (N-term) |
APR14743G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human (Mouse) Tdgf1 (N-term). This antibody is tested and proven to work in the following applications: |
Polyclonal (Mouse) Tdgf1 Antibody (N-term) |
APR14744G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human (Mouse) Tdgf1 (N-term). This antibody is tested and proven to work in the following applications: |
TDGF1 Conjugated Antibody |
C37506 |
SAB |
100ul |
EUR 397 |
Anti-TDGF1 antibody |
STJ25802 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes an epidermal growth factor-related protein that contains a cripto, FRL-1, and cryptic domain. The encoded protein is an extracellular, membrane-bound signaling protein that plays an essential role in embryonic development and tumor growth. Mutations in this gene are associated with forebrain defects. Pseudogenes of this gene are found on chromosomes 2, 3, 6, 8, 19 and X. Alternate splicing results in multiple transcript variants. |
Anti-TDGF1 antibody |
STJ113789 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes an epidermal growth factor-related protein that contains a cripto, FRL-1, and cryptic domain. The encoded protein is an extracellular, membrane-bound signaling protein that plays an essential role in embryonic development and tumor growth. Mutations in this gene are associated with forebrain defects. Pseudogenes of this gene are found on chromosomes 2, 3, 6, 8, 19 and X. Alternate splicing results in multiple transcript variants. |
Anti-TDGF1 antibody |
STJ192538 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to TDGF1 |
TDGF1 siRNA |
20-abx936400 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TDGF1 protein |
30R-2570 |
Fitzgerald |
10 ug |
EUR 358 |
Description: Purified recombinant Human TDGF1 protein |
anti-TDGF1 |
YF-PA27376 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to TDGF1 |
TDGF1 Antibody, HRP conjugated |
1-CSB-PA10764B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TDGF1. Recognizes TDGF1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
TDGF1 Antibody, FITC conjugated |
1-CSB-PA10764C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TDGF1. Recognizes TDGF1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
TDGF1 Antibody, Biotin conjugated |
1-CSB-PA10764D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TDGF1. Recognizes TDGF1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
TDGF1 Antibody, HRP conjugated |
1-CSB-PA10769B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TDGF1. Recognizes TDGF1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
TDGF1 Antibody, FITC conjugated |
1-CSB-PA10769C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TDGF1. Recognizes TDGF1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
TDGF1 Antibody, Biotin conjugated |
1-CSB-PA10769D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TDGF1. Recognizes TDGF1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
TDGF1 Blocking Peptide |
BF0656-BP |
Affbiotech |
1mg |
EUR 195 |
TDGF1 cloning plasmid |
CSB-CL023343HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 567
- Sequence: atggactgcaggaagatggcccgcttctcttacagtgtgatttggatcatggccatttctaaagcctttgaactgggattagttgccgggctgggccatcaggaatttgctcgtccatctcggggatacctggccttcagagatgacagcatttggccccaggaggagcctgcaat
- Show more
|
Description: A cloning plasmid for the TDGF1 gene. |
TDGF1 cloning plasmid |
CSB-CL023343HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 567
- Sequence: atggactgcaggaagatggcccgcttctcttacagtgtgatttggatcatggccatttctaaagcctttgaactgggattagttgccgggctgggccatcaggaatttgctcgtccatctcggggatacctggccttcagagatgacagcatttggccccaggaggagcctgcaat
- Show more
|
Description: A cloning plasmid for the TDGF1 gene. |
TDGF1, human recombinant |
4335-10 |
Biovision |
|
EUR 294 |
TDGF1, human recombinant |
4335-1000 |
Biovision |
|
EUR 9293 |
TDGF1, human recombinant |
4335-50 |
Biovision |
|
EUR 914 |
TDGF1 Blocking Peptide |
DF6210-BP |
Affbiotech |
1mg |
EUR 195 |
Human TDGF1 ELISA Kit |
EHT0113 |
Abclonal |
96Tests |
EUR 521 |
Goat TDGF1 ELISA Kit |
EGTT0113 |
Abclonal |
96Tests |
EUR 521 |
Bovine TDGF1 ELISA Kit |
EBT0113 |
Abclonal |
96Tests |
EUR 521 |
Chicken TDGF1 ELISA Kit |
ECKT0113 |
Abclonal |
96Tests |
EUR 521 |
Anserine TDGF1 ELISA Kit |
EAT0113 |
Abclonal |
96Tests |
EUR 521 |
Canine TDGF1 ELISA Kit |
ECT0113 |
Abclonal |
96Tests |
EUR 521 |
Porcine TDGF1 ELISA Kit |
EPT0113 |
Abclonal |
96Tests |
EUR 521 |
Rat TDGF1 ELISA Kit |
ERT0113 |
Abclonal |
96Tests |
EUR 521 |
Sheep TDGF1 ELISA Kit |
EST0113 |
Abclonal |
96Tests |
EUR 521 |
Monkey TDGF1 ELISA Kit |
EMKT0113 |
Abclonal |
96Tests |
EUR 521 |
Mouse TDGF1 ELISA Kit |
EMT0113 |
Abclonal |
96Tests |
EUR 521 |
Human TDGF1 shRNA Plasmid |
20-abx954777 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
TDGF1 protein (His tag) |
80R-3387 |
Fitzgerald |
50 ug |
EUR 257 |
Description: Purified recombinant TDGF1 protein (His tag) |
TDGF1 Recombinant Protein (Human) |
RP031219 |
ABM |
100 ug |
Ask for price |
TDGF1 Recombinant Protein (Human) |
RP031222 |
ABM |
100 ug |
Ask for price |
TDGF1 Recombinant Protein (Mouse) |
RP178010 |
ABM |
100 ug |
Ask for price |
Rabbit Teratocarcinoma Derived Growth Factor 1 (TDGF1) ELISA Kit |
abx362580-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Teratocarcinoma Derived Growth Factor 1 (TDGF1) Antibody |
20-abx126686 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Teratocarcinoma-Derived Growth Factor 1 (TDGF1) Antibody |
20-abx110257 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Teratocarcinoma-Derived Growth Factor 1 (TDGF1) Antibody |
20-abx110258 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Teratocarcinoma Derived Growth Factor 1 (TDGF1) Antibody |
20-abx000988 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Teratocarcinoma Derived Growth Factor 1 (TDGF1) Antibody |
abx037037-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Teratocarcinoma Derived Growth Factor 1 (TDGF1) Antibody |
abx012114-100ul |
Abbexa |
100 ul |
EUR 411 |
- Shipped within 5-10 working days.
|
Teratocarcinoma Derived Growth Factor 1 (TDGF1) Antibody |
20-abx174742 |
Abbexa |
|
|
|
Teratocarcinoma Derived Growth Factor 1 (TDGF1) Antibody |
20-abx320409 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Teratocarcinoma Derived Growth Factor 1 (TDGF1) Antibody |
20-abx320410 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Teratocarcinoma Derived Growth Factor 1 (TDGF1) Antibody |
20-abx339148 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Teratocarcinoma Derived Growth Factor 1 (TDGF1) Antibody |
20-abx178549 |
Abbexa |
|
|
|
Guinea Pig TDGF1 ELISA Kit |
EGT0113 |
Abclonal |
96Tests |
EUR 521 |
m TDGF1 inducible lentiviral particles |
LVP619 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made over-expression lentivirus for expressing mouse target: TDGF1 (teratocarcinoma-derived growth factor 1), [alternative names: CR1; cripto]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_011562.2. It also contains a RFP-Blasticidin dual selection marker. |
Tdgf1 ORF Vector (Mouse) (pORF) |
ORF059338 |
ABM |
1.0 ug DNA |
EUR 506 |
TDGF1 ORF Vector (Human) (pORF) |
ORF010407 |
ABM |
1.0 ug DNA |
EUR 95 |
TDGF1 ORF Vector (Human) (pORF) |
ORF010408 |
ABM |
1.0 ug DNA |
EUR 95 |
Recombinant Human Cripto/TDGF1 Protein |
RP00202 |
Abclonal |
5 μg |
EUR 213 |
TDGF1 ELISA Kit (Mouse) (OKBB00965) |
OKBB00965 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Teratocarcinoma-derived growth factor 1 is a protein that in humans is encoded by the TDGF1 gene. It is mapped to 3p23-p21. The protein is an extracellular, membrane-bound signaling protein that plays an essential role in embryonic developmentand tumor growth. Mutations in this gene are associated with forebrain defects. Pseudogenes of this gene are found on chromosomes 2, 3, 6, 8, 19 and X. Alternate splicing results in multiple transcript variants.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml |
TDGF1 ELISA Kit (Human) (OKCD08874) |
OKCD08874 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: This gene encodes an epidermal growth factor-related protein that contains a cripto, FRL-1, and cryptic domain. The encoded protein is an extracellular, membrane-bound signaling protein that plays an essential role in embryonic development and tumor growth. Mutations in this gene are associated with forebrain defects. Pseudogenes of this gene are found on chromosomes 2, 3, 6, 8, 19 and X. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 32pg/mL |
TDGF1 ELISA Kit (Mouse) (OKEH04458) |
OKEH04458 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Could play a role in the determination of the epiblastic cells that subsequently give rise to the mesoderm.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.64 pg/mL |
TDGF1 ELISA Kit (Human) (OKEH04459) |
OKEH04459 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: This gene encodes an epidermal growth factor-related protein that contains a cripto, FRL-1, and cryptic domain. The encoded protein is an extracellular, membrane-bound signaling protein that plays an essential role in embryonic development and tumor growth. Mutations in this gene are associated with forebrain defects. Pseudogenes of this gene are found on chromosomes 2, 3, 6, 8, 19 and X. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 21.8 pg/mL |
TDGF1 ELISA Kit (Rat) (OKEI00855) |
OKEI00855 |
Aviva Systems Biology |
96 Wells |
EUR 767 |
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 46.9 pg/mL |
Teratocarcinoma Derived Growth Factor 1 (TDGF1) Antibody Pair |
abx117572-1pair5x96wellplates |
Abbexa |
1 pair (5x96 well plates) |
EUR 1010 |
- Shipped within 5-10 working days.
|
Mouse Cripto/TDGF1 PicoKine ELISA Kit |
EK1405 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of mouse Cripto in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA). |
ELISA kit for Mouse Cripto/TDGF1 |
EK5651 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Cripto/TDGF1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
TDGF1 sgRNA CRISPR Lentivector set (Human) |
K2353401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Tdgf1 sgRNA CRISPR Lentivector set (Mouse) |
K4695701 |
ABM |
3 x 1.0 ug |
EUR 339 |
TDGF1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2353402 |
ABM |
1.0 ug DNA |
EUR 154 |
TDGF1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2353403 |
ABM |
1.0 ug DNA |
EUR 154 |
TDGF1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2353404 |
ABM |
1.0 ug DNA |
EUR 154 |
Tdgf1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4695702 |
ABM |
1.0 ug DNA |
EUR 154 |
Tdgf1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4695703 |
ABM |
1.0 ug DNA |
EUR 154 |
Tdgf1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4695704 |
ABM |
1.0 ug DNA |
EUR 154 |
Human TeRatocarcinoma-derived growth factor 1 (TDGF1) |
1-CSB-RP107644h |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 40.5 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human TeRatocarcinoma-derived growth factor 1(TDGF1),partial expressed in E.coli |
Human TeRatocarcinoma-derived growth factor 1 (TDGF1) |
1-CSB-RP107694h |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 17.5 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human TeRatocarcinoma-derived growth factor 1(TDGF1),partial expressed in E.coli |
Human CellExp? TDGF1, Fc Tag, human recombinant |
P1144-10 |
Biovision |
|
EUR 213 |
TDGF1 Protein Vector (Human) (pPB-C-His) |
PV041625 |
ABM |
500 ng |
EUR 329 |
TDGF1 Protein Vector (Human) (pPB-N-His) |
PV041626 |
ABM |
500 ng |
EUR 329 |
TDGF1 Protein Vector (Human) (pPM-C-HA) |
PV041627 |
ABM |
500 ng |
EUR 329 |
TDGF1 Protein Vector (Human) (pPM-C-His) |
PV041628 |
ABM |
500 ng |
EUR 329 |
TDGF1 Protein Vector (Human) (pPB-C-His) |
PV041629 |
ABM |
500 ng |
EUR 329 |
TDGF1 Protein Vector (Human) (pPB-N-His) |
PV041630 |
ABM |
500 ng |
EUR 329 |
TDGF1 Protein Vector (Human) (pPM-C-HA) |
PV041631 |
ABM |
500 ng |
EUR 329 |
TDGF1 Protein Vector (Human) (pPM-C-His) |
PV041632 |
ABM |
500 ng |
EUR 329 |
TDGF1 Recombinant Protein (Human) (C-Fc Tag) |
RP238896 |
ABM |
1mg |
Ask for price |
TDGF1 Recombinant Protein (Human) (C-Fc Tag) |
RP238897 |
ABM |
50ug |
Ask for price |
TDGF1 Protein Vector (Mouse) (pPB-C-His) |
PV237350 |
ABM |
500 ng |
EUR 603 |
TDGF1 Protein Vector (Mouse) (pPB-N-His) |
PV237351 |
ABM |
500 ng |
EUR 603 |
TDGF1 Protein Vector (Mouse) (pPM-C-HA) |
PV237352 |
ABM |
500 ng |
EUR 603 |
TDGF1 Protein Vector (Mouse) (pPM-C-His) |
PV237353 |
ABM |
500 ng |
EUR 603 |
Tdgf1 3'UTR GFP Stable Cell Line |
TU170323 |
ABM |
1.0 ml |
Ask for price |
TDGF1 3'UTR GFP Stable Cell Line |
TU075363 |
ABM |
1.0 ml |
EUR 1394 |
Tdgf1 3'UTR Luciferase Stable Cell Line |
TU120323 |
ABM |
1.0 ml |
Ask for price |
TDGF1 3'UTR Luciferase Stable Cell Line |
TU025363 |
ABM |
1.0 ml |
EUR 1394 |
Tdgf1 3'UTR Luciferase Stable Cell Line |
TU221730 |
ABM |
1.0 ml |
Ask for price |
Tdgf1 3'UTR GFP Stable Cell Line |
TU271730 |
ABM |
1.0 ml |
Ask for price |
TDGF1 Chemi-Luminescent ELISA Kit (Human) (OKCD03936) |
OKCD03936 |
Aviva Systems Biology |
96 Wells |
EUR 988 |
Description: Description of target: Could play a role in the determination of the epiblastic cells that subsequently give rise to the mesoderm.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
TDGF1 Rabbit Polyclonal Antibody