RSPO2 Rabbit Polyclonal Antibody
RSPO2 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
RSPO2 Polyclonal Antibody |
ABP60271-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RSPO2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of RSPO2 from Human, Mouse. This RSPO2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RSPO2 protein |
RSPO2 Polyclonal Antibody |
ES11063-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against RSPO2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RSPO2 Polyclonal Antibody |
ES11063-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against RSPO2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RSPO2 antibody |
70R-20031 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal RSPO2 antibody |
RSPO2 Antibody |
1-CSB-PA020551GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against RSPO2. Recognizes RSPO2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Polyclonal RSPO2 Antibody (C-term) |
APR05604G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RSPO2 (C-term). This antibody is tested and proven to work in the following applications: |
anti- RSPO2 antibody |
FNab07511 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:3000
- IP: 1:500-1:1000
- Immunogen: R-spondin 2 homolog
- Uniprot ID: Q6UXX9
- Gene ID: 340419
- Research Area: Neuroscience, Cardiovascular
|
Description: Antibody raised against RSPO2 |
Anti-RSPO2 antibody |
STJ192221 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to RSPO2 |
RSPO2 siRNA |
20-abx932213 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RSPO2 siRNA |
20-abx932214 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RSPO2 cloning plasmid |
CSB-CL751021HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 531
- Sequence: atgcgccagtatggagagtgcctgcattcctgcccatccgggtactatggacaccgagccccagatatgaacagatgtgcaagatgcagaatagaaaactgtgattcttgctttagcaaagacttttgtaccaagtgcaaagtaggcttttatttgcatagaggccgttgctttga
- Show more
|
Description: A cloning plasmid for the RSPO2 gene. |
R-Spondin 2 (RSPO2) Antibody |
20-abx115343 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
R-Spondin 2 (RSPO2) Antibody |
abx032461-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
R-Spondin 2 (RSPO2) Antibody |
abx032461-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
R-Spondin 2 (RSPO2) Antibody |
abx237511-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Human RSPO2 shRNA Plasmid |
20-abx967344 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse RSPO2 shRNA Plasmid |
20-abx982386 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
RSPO2 Recombinant Protein (Human) |
RP027343 |
ABM |
100 ug |
Ask for price |
RSPO2 Recombinant Protein (Rat) |
RP227027 |
ABM |
100 ug |
Ask for price |
RSPO2 Recombinant Protein (Mouse) |
RP169487 |
ABM |
100 ug |
Ask for price |
Rspo2 ORF Vector (Rat) (pORF) |
ORF075677 |
ABM |
1.0 ug DNA |
EUR 506 |
RSPO2 ORF Vector (Human) (pORF) |
ORF009115 |
ABM |
1.0 ug DNA |
EUR 95 |
Rspo2 ORF Vector (Mouse) (pORF) |
ORF056497 |
ABM |
1.0 ug DNA |
EUR 506 |
RSPO2 ELISA Kit (Human) (OKAN06303) |
OKAN06303 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes a member of the R-spondin family of proteins. These proteins are secreted ligands of leucine-rich repeat containing G protein-coupled receptors that enhance Wnt signaling through the inhibition of ubiquitin E3 ligases. A chromosomal translocation including this locus that results in the formation of a gene fusion has been identified in multiple human cancers. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.1 pg/mL |
RSPO2 ELISA Kit (Human) (OKCD02064) |
OKCD02064 |
Aviva Systems Biology |
96 Wells |
EUR 909 |
Description: Description of target: Activator of the canonical Wnt signaling pathway by acting as a ligand for LGR4-6 receptors. Upon binding to LGR4-6 (LGR4, LGR5 or LGR6), LGR4-6 associate with phosphorylated LRP6 and frizzled receptors that are activated by extracellular Wnt receptors, triggering the canonical Wnt signaling pathway to increase expression of target genes. Also regulates the canonical Wnt/beta-catenin-dependent pathway and non-canonical Wnt signaling by acting as an inhibitor of ZNRF3, an important regulator of the Wnt signaling pathway. Probably also acts as a ligand for frizzled and LRP receptors.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 6.1 pg/mL |
Rspo2 ELISA Kit (Mouse) (OKCD02065) |
OKCD02065 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
Description: Description of target: Activator of the canonical Wnt signaling pathway by acting as a ligand for LGR4-6 receptors. Upon binding to LGR4-6 (LGR4, LGR5 or LGR6), LGR4-6 associate with phosphorylated LRP6 and frizzled receptors that are activated by extracellular Wnt receptors, triggering the canonical Wnt signaling pathway to increase expression of target genes. Also regulates the canonical Wnt/beta-catenin-dependent pathway and non-canonical Wnt signaling by acting as an inhibitor of ZNRF3, an important regulator of the Wnt signaling pathway. Probably also acts as a ligand for frizzled and LRP receptors.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 29 pg/mL |
RSPO2 ELISA Kit (Human) (OKCA02143) |
OKCA02143 |
Aviva Systems Biology |
96 Wells |
EUR 833 |
Description: Description of target: Activator of the canonical Wnt signaling pathway by acting as a ligand for LGR4-6 receptors. Upon binding to LGR4-6 (LGR4, LGR5 or LGR6), LGR4-6 associate with phosphorylated LRP6 and frizzled receptors that are activated by extracellular Wnt receptors, triggering the canonical Wnt signaling pathway to increase expression of target genes. Also regulates the canonical Wnt/beta-catenin-dependent pathway and non-canonical Wnt signaling by acting as an inhibitor of ZNRF3, an important regulator of the Wnt signaling pathway. Probably also acts as a ligand for frizzled and LRP receptors.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.039 ng/mL. |
RSPO2 ELISA Kit (Mouse) (OKCA02189) |
OKCA02189 |
Aviva Systems Biology |
96 Wells |
EUR 833 |
Description: Description of target: Activator of the canonical Wnt signaling pathway by acting as a ligand for LGR4-6 receptors. Upon binding to LGR4-6 (LGR4, LGR5 or LGR6), LGR4-6 associate with phosphorylated LRP6 and frizzled receptors that are activated by extracellular Wnt receptors, triggering the canonical Wnt signaling pathway to increase expression of target genes. Also regulates the canonical Wnt/beta-catenin-dependent pathway and non-canonical Wnt signaling by acting as an inhibitor of ZNRF3, an important regulator of the Wnt signaling pathway. Probably also acts as a ligand for frizzled and LRP receptors.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.8 pg/mL |
Rspo2 sgRNA CRISPR Lentivector set (Rat) |
K7583201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rspo2 sgRNA CRISPR Lentivector set (Mouse) |
K4852701 |
ABM |
3 x 1.0 ug |
EUR 339 |
RSPO2 sgRNA CRISPR Lentivector set (Human) |
K2074501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human R-spondin-2(RSPO2) ELISA kit |
CSB-EL020551HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human R-spondin-2 (RSPO2) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human R-spondin-2(RSPO2) ELISA kit |
1-CSB-EL020551HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human R-spondin-2(RSPO2) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Mouse R-spondin-2(RSPO2) ELISA kit |
CSB-EL020551MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse R-spondin-2 (RSPO2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse R-spondin-2(RSPO2) ELISA kit |
1-CSB-EL020551MO |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse R-spondin-2(RSPO2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human R-Spondin 2 (RSPO2) ELISA Kit |
20-abx258155 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse R-Spondin 2 (RSPO2) ELISA Kit |
20-abx258663 |
Abbexa |
-
EUR 7504.00
-
EUR 3996.00
-
EUR 926.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human R-Spondin 2 (RSPO2) CLIA Kit |
20-abx496029 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse R-Spondin 2 (RSPO2) CLIA Kit |
20-abx496030 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Rspo2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7583202 |
ABM |
1.0 ug DNA |
EUR 154 |
Rspo2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7583203 |
ABM |
1.0 ug DNA |
EUR 154 |
Rspo2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7583204 |
ABM |
1.0 ug DNA |
EUR 154 |
Rspo2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4852702 |
ABM |
1.0 ug DNA |
EUR 154 |
Rspo2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4852703 |
ABM |
1.0 ug DNA |
EUR 154 |
Rspo2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4852704 |
ABM |
1.0 ug DNA |
EUR 154 |
RSPO2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2074502 |
ABM |
1.0 ug DNA |
EUR 154 |
RSPO2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2074503 |
ABM |
1.0 ug DNA |
EUR 154 |
RSPO2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2074504 |
ABM |
1.0 ug DNA |
EUR 154 |
RSPO2 Protein Vector (Rat) (pPB-C-His) |
PV302706 |
ABM |
500 ng |
EUR 603 |
RSPO2 Protein Vector (Rat) (pPB-N-His) |
PV302707 |
ABM |
500 ng |
EUR 603 |
RSPO2 Protein Vector (Rat) (pPM-C-HA) |
PV302708 |
ABM |
500 ng |
EUR 603 |
RSPO2 Protein Vector (Rat) (pPM-C-His) |
PV302709 |
ABM |
500 ng |
EUR 603 |
RSPO2 Protein Vector (Mouse) (pPB-C-His) |
PV225986 |
ABM |
500 ng |
EUR 603 |
RSPO2 Protein Vector (Mouse) (pPB-N-His) |
PV225987 |
ABM |
500 ng |
EUR 603 |
RSPO2 Protein Vector (Mouse) (pPM-C-HA) |
PV225988 |
ABM |
500 ng |
EUR 603 |
RSPO2 Protein Vector (Mouse) (pPM-C-His) |
PV225989 |
ABM |
500 ng |
EUR 603 |
Human R-Spondin 2 ELISA Kit (RSPO2) |
RK02215 |
Abclonal |
96 Tests |
EUR 521 |
RSPO2 Protein Vector (Human) (pPB-C-His) |
PV036457 |
ABM |
500 ng |
EUR 329 |
RSPO2 Protein Vector (Human) (pPB-N-His) |
PV036458 |
ABM |
500 ng |
EUR 329 |
RSPO2 Protein Vector (Human) (pPM-C-HA) |
PV036459 |
ABM |
500 ng |
EUR 329 |
RSPO2 Protein Vector (Human) (pPM-C-His) |
PV036460 |
ABM |
500 ng |
EUR 329 |
Rspo2 3'UTR Luciferase Stable Cell Line |
TU118225 |
ABM |
1.0 ml |
Ask for price |
Human R-Spondin 2 (RSPO2) ELISA Kit |
SEM172Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5189.65 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human R-Spondin 2 (RSPO2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human R-Spondin 2 (RSPO2) in serum, plasma, tissue homogenates and other biological fluids. |
Human R-Spondin 2 (RSPO2) ELISA Kit |
SEM172Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 515.03 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human R-Spondin 2 (RSPO2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human R-Spondin 2 (RSPO2) in serum, plasma, tissue homogenates and other biological fluids. |
Human R-Spondin 2 (RSPO2) ELISA Kit |
SEM172Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 692.9 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human R-Spondin 2 (RSPO2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human R-Spondin 2 (RSPO2) in serum, plasma, tissue homogenates and other biological fluids. |
Human R-Spondin 2 (RSPO2) ELISA Kit |
SEM172Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human R-Spondin 2 (RSPO2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human R-Spondin 2 (RSPO2) in serum, plasma, tissue homogenates and other biological fluids. |
Human R-Spondin 2 (RSPO2) ELISA Kit |
4-SEM172Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as R-Spondin 2 elisa. Alternative names of the recognized antigen: Roof plate-specific spondin-2
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human R-Spondin 2 (RSPO2) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse R-Spondin 2 (RSPO2) ELISA Kit |
SEM172Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5333.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse R-Spondin 2 (RSPO2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse R-Spondin 2 (RSPO2) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse R-Spondin 2 (RSPO2) ELISA Kit |
SEM172Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 526.89 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse R-Spondin 2 (RSPO2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse R-Spondin 2 (RSPO2) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse R-Spondin 2 (RSPO2) ELISA Kit |
SEM172Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 709.84 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse R-Spondin 2 (RSPO2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse R-Spondin 2 (RSPO2) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse R-Spondin 2 (RSPO2) ELISA Kit |
SEM172Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2894.28 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse R-Spondin 2 (RSPO2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse R-Spondin 2 (RSPO2) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse R-Spondin 2 (RSPO2) ELISA Kit |
4-SEM172Mu |
Cloud-Clone |
-
EUR 5384.00
-
EUR 2845.00
-
EUR 710.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as R-Spondin 2 elisa. Alternative names of the recognized antigen: Roof plate-specific spondin-2
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse R-Spondin 2 (RSPO2) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Rspo2 3'UTR GFP Stable Cell Line |
TU168225 |
ABM |
1.0 ml |
Ask for price |
Rspo2 3'UTR Luciferase Stable Cell Line |
TU219762 |
ABM |
1.0 ml |
Ask for price |
Rspo2 3'UTR GFP Stable Cell Line |
TU269762 |
ABM |
1.0 ml |
Ask for price |
RSPO2 3'UTR GFP Stable Cell Line |
TU072440 |
ABM |
1.0 ml |
EUR 1521 |
RSPO2 3'UTR Luciferase Stable Cell Line |
TU022440 |
ABM |
1.0 ml |
EUR 1521 |
ELISA kit for Human RSPO2 (R-Spondin 2) |
ELK7457 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to R-Spondin 2 (RSPO2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to R-Spondin 2 (R
- Show more
|
Description: A sandwich ELISA kit for detection of R-Spondin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Mouse RSPO2 (R-Spondin 2) |
ELK8153 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to R-Spondin 2 (RSPO2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to R-Spondin 2 (R
- Show more
|
Description: A sandwich ELISA kit for detection of R-Spondin 2 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
RSPO2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV649969 |
ABM |
1.0 ug DNA |
EUR 514 |
RSPO2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV649973 |
ABM |
1.0 ug DNA |
EUR 514 |
RSPO2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV649974 |
ABM |
1.0 ug DNA |
EUR 514 |
ELISA kit for Human R-spondin-2 (RSPO2) |
KTE60782-48T |
Abbkine |
48T |
EUR 332 |
- R-spondins (RSPOs), such as RSPO2, are secreted proteins that regulate beta-catenin (CTNNB1) signaling. Xenopus and human RSPO2 enhanced mouse Wnt3a signaling in transfected human embryonic kidney cells. C-terminally truncated Xenopus Rspo2, but not
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human R-spondin-2 (RSPO2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human R-spondin-2 (RSPO2) |
KTE60782-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- R-spondins (RSPOs), such as RSPO2, are secreted proteins that regulate beta-catenin (CTNNB1) signaling. Xenopus and human RSPO2 enhanced mouse Wnt3a signaling in transfected human embryonic kidney cells. C-terminally truncated Xenopus Rspo2, but not
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human R-spondin-2 (RSPO2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human R-spondin-2 (RSPO2) |
KTE60782-96T |
Abbkine |
96T |
EUR 539 |
- R-spondins (RSPOs), such as RSPO2, are secreted proteins that regulate beta-catenin (CTNNB1) signaling. Xenopus and human RSPO2 enhanced mouse Wnt3a signaling in transfected human embryonic kidney cells. C-terminally truncated Xenopus Rspo2, but not
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human R-spondin-2 (RSPO2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse R-spondin-2 (RSPO2) |
KTE70495-48T |
Abbkine |
48T |
EUR 332 |
- R-spondins (RSPOs), such as RSPO2, are secreted proteins that regulate beta-catenin (CTNNB1) signaling. Xenopus and human RSPO2 enhanced mouse Wnt3a signaling in transfected human embryonic kidney cells. C-terminally truncated Xenopus Rspo2, but not
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse R-spondin-2 (RSPO2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse R-spondin-2 (RSPO2) |
KTE70495-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- R-spondins (RSPOs), such as RSPO2, are secreted proteins that regulate beta-catenin (CTNNB1) signaling. Xenopus and human RSPO2 enhanced mouse Wnt3a signaling in transfected human embryonic kidney cells. C-terminally truncated Xenopus Rspo2, but not
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse R-spondin-2 (RSPO2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse R-spondin-2 (RSPO2) |
KTE70495-96T |
Abbkine |
96T |
EUR 539 |
- R-spondins (RSPOs), such as RSPO2, are secreted proteins that regulate beta-catenin (CTNNB1) signaling. Xenopus and human RSPO2 enhanced mouse Wnt3a signaling in transfected human embryonic kidney cells. C-terminally truncated Xenopus Rspo2, but not
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse R-spondin-2 (RSPO2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
RSPO2 Rabbit Polyclonal Antibody