OLR1 Rabbit Polyclonal Antibody
OLR1 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
OLR1 Polyclonal Antibody |
ABP59644-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human OLR1 protein at amino acid sequence of 60-140
- Applications tips:
|
Description: A polyclonal antibody for detection of OLR1 from Human, Mouse, Rat. This OLR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OLR1 protein at amino acid sequence of 60-140 |
OLR1 Polyclonal Antibody |
A53032 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
OLR1 Rabbit pAb |
A12060-100ul |
Abclonal |
100 ul |
EUR 308 |
OLR1 Rabbit pAb |
A12060-200ul |
Abclonal |
200 ul |
EUR 459 |
OLR1 Rabbit pAb |
A12060-20ul |
Abclonal |
20 ul |
EUR 183 |
OLR1 Rabbit pAb |
A12060-50ul |
Abclonal |
50 ul |
EUR 223 |
OLR1 Rabbit pAb |
A1639-100ul |
Abclonal |
100 ul |
EUR 308 |
OLR1 Rabbit pAb |
A1639-200ul |
Abclonal |
200 ul |
EUR 459 |
OLR1 Rabbit pAb |
A1639-20ul |
Abclonal |
20 ul |
EUR 183 |
OLR1 Rabbit pAb |
A1639-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal OLR1 Antibody (Center) |
APR08857G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OLR1 (Center). This antibody is tested and proven to work in the following applications: |
OLR1 Antibody |
32359-100ul |
SAB |
100ul |
EUR 252 |
OLR1 antibody |
70R-1739 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal OLR1 antibody |
OLR1 antibody |
70R-19041 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal OLR1 antibody |
OLR1 Antibody |
DF6522 |
Affbiotech |
200ul |
EUR 304 |
Description: OLR1 Antibody detects endogenous levels of total OLR1. |
OLR1 Antibody |
1-CSB-PA556674 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against OLR1. Recognizes OLR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100 |
OLR1 Antibody |
1-CSB-PA280628 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against OLR1. Recognizes OLR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200 |
OLR1 Antibody |
1-CSB-PA212407 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against OLR1. Recognizes OLR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:10-1:50 |
OLR1 Antibody |
1-CSB-PA133010 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against OLR1. Recognizes OLR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200 |
OLR1 Antibody |
1-CSB-PA187613 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against OLR1. Recognizes OLR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100 |
OLR1 Antibody |
1-CSB-PA016331GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against OLR1. Recognizes OLR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
OLR1 Antibody |
1-CSB-PA016331LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against OLR1. Recognizes OLR1 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:1000-1:2000, IF:1:50-1:500 |
OLR1 Polyclonal Antibody, Biotin Conjugated |
A53029 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
OLR1 Polyclonal Antibody, FITC Conjugated |
A53030 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
OLR1 Polyclonal Antibody, HRP Conjugated |
A53031 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
OLR1 ELISA Kit (Rabbit) (OKCD01607) |
OKCD01607 |
Aviva Systems Biology |
96 Wells |
EUR 857 |
Description: Description of target: Receptor that mediates the recognition, internalization and degradation of oxidatively modified low density lipoprotein (oxLDL) by vascular endothelial cells. OxLDL is a marker of atherosclerosis that induces vascular endothelial cell activation and dysfunction, resulting in pro-inflammatory responses, pro-oxidative conditions and apoptosis. Its association with oxLDL induces the activation of NF-kappa-B through an increased production of intracellular reactive oxygen and a variety of pro-atherogenic cellular responses including a reduction of nitric oxide (NO) release, monocyte adhesion and apoptosis. In addition to binding oxLDL, it acts as a receptor for the HSP70 protein involved in antigen cross-presentation to naive T-cells in dendritic cells, thereby participating in cell-mediated antigen cross-presentation. Also involved in inflammatory process, by acting as a leukocyte-adhesion molecule at the vascular interface in endotoxin-induced inflammation. Also acts as a receptor for advanced glycation end (AGE) products, activated platelets, monocytes, apoptotic cells and both Gram-negative and Gram-positive bacteria.;Species reactivity: Rabbit;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 24 pg/mL |
OLR1 Conjugated Antibody |
C32359 |
SAB |
100ul |
EUR 397 |
anti- OLR1 antibody |
FNab05990 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: oxidized low density lipoprotein (lectin-like) receptor 1
- Uniprot ID: P78380
- Gene ID: 4973
- Research Area: Immunology, Cardiovascular, Metabolism
|
Description: Antibody raised against OLR1 |
Anti-OLR1 antibody |
STJ24865 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a low density lipoprotein receptor that belongs to the C-type lectin superfamily. This gene is regulated through the cyclic AMP signaling pathway. The encoded protein binds, internalizes and degrades oxidized low-density lipoprotein. This protein may be involved in the regulation of Fas-induced apoptosis. This protein may play a role as a scavenger receptor. Mutations of this gene have been associated with atherosclerosis, risk of myocardial infarction, and may modify the risk of Alzheimer's disease. Alternate splicing results in multiple transcript variants. |
Anti-OLR1 antibody |
STJ113959 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a low density lipoprotein receptor that belongs to the C-type lectin superfamily. This gene is regulated through the cyclic AMP signaling pathway. The encoded protein binds, internalizes and degrades oxidized low-density lipoprotein. This protein may be involved in the regulation of Fas-induced apoptosis. This protein may play a role as a scavenger receptor. Mutations of this gene have been associated with atherosclerosis, risk of myocardial infarction, and may modify the risk of Alzheimer's disease. Alternate splicing results in multiple transcript variants. |
Anti-OLR1 antibody |
STJ192383 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to OLR1 |
OLR1 siRNA |
20-abx903747 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
OLR1 siRNA |
20-abx926927 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
OLR1 siRNA |
20-abx926928 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
OLR1 protein |
30R-2084 |
Fitzgerald |
100 ug |
EUR 322 |
Description: Recombinant human OLR1 protein |
OLR1 Antibody, HRP conjugated |
1-CSB-PA016331LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against OLR1. Recognizes OLR1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
OLR1 Antibody, FITC conjugated |
1-CSB-PA016331LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against OLR1. Recognizes OLR1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
OLR1 Antibody, Biotin conjugated |
1-CSB-PA016331LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against OLR1. Recognizes OLR1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
OLR1 cloning plasmid |
CSB-CL016331HU-10ug |
Cusabio |
10ug |
EUR 339 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 822
- Sequence: atgacttttgatgacctaaagatccagactgtgaaggaccagcctgatgagaagtcaaatggaaaaaaagctaaaggtcttcagtttctttactctccatggtggtgcctggctgctgcgactctaggggtcctttgcctgggattagtagtgaccattatggtgctgggcatgca
- Show more
|
Description: A cloning plasmid for the OLR1 gene. |
OLR1 Blocking Peptide |
33R-7471 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of OLR1 antibody, catalog no. 70R-1739 |
OLR1 Blocking Peptide |
DF6522-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-LOX-1/OLR1 Antibody |
A00760-1 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-LOX 1/Olr1 Antibody |
A00760-2 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-LOX 1/Olr1 Antibody |
A00760-3 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-LOX 1/OLR1 Antibody |
PA1832 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-LOX 1/OLR1 Antibody |
PA1833 |
BosterBio |
100ug/vial |
EUR 294 |
Mouse OLR1 shRNA Plasmid |
20-abx979878 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat OLR1 shRNA Plasmid |
20-abx987537 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human OLR1 shRNA Plasmid |
20-abx953299 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
OLR1 Recombinant Protein (Human) |
RP022120 |
ABM |
100 ug |
Ask for price |
OLR1 Recombinant Protein (Rat) |
RP215153 |
ABM |
100 ug |
Ask for price |
OLR1 Recombinant Protein (Mouse) |
RP159269 |
ABM |
100 ug |
Ask for price |
Rat OLR1 ELISA Kit |
STJ150190 |
St John's Laboratory |
1 kit |
EUR 412 |
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of OxLDL in Rat serum, plasma and other biological fluids |
Mouse OLR1 ELISA Kit |
STJ150267 |
St John's Laboratory |
1 kit |
EUR 412 |
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of OxLDL in Mouse serum, plasma and other biological fluids |
Rabbit Oxidized low- density lipoprotein receptor 1, OLR1 ELISA |
ELI-05975Ra |
Lifescience Market |
96 Tests |
EUR 928 |
Monoclonal OLR1 Antibody (monoclonal) (M08), Clone: 2C9 |
APR08858G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human OLR1 (monoclonal) (M08). The antibodies are raised in mouse and are from clone 2C9. This antibody is applicable in E |
Rabbit Oxidized low density lipoprotein receptor 1(OLR1) ELISA kit |
E04O0743-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Oxidized low density lipoprotein receptor 1(OLR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Oxidized low density lipoprotein receptor 1(OLR1) ELISA kit |
E04O0743-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Oxidized low density lipoprotein receptor 1(OLR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Oxidized low density lipoprotein receptor 1(OLR1) ELISA kit |
E04O0743-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Oxidized low density lipoprotein receptor 1(OLR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Oxidized low density lipoprotein receptor 1 (OLR1) ELISA Kit |
abx257038-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
OLR1 ORF Vector (Human) (pORF) |
ORF007374 |
ABM |
1.0 ug DNA |
EUR 95 |
Olr1 ORF Vector (Rat) (pORF) |
ORF071719 |
ABM |
1.0 ug DNA |
EUR 95 |
Olr1 ORF Vector (Mouse) (pORF) |
ORF053091 |
ABM |
1.0 ug DNA |
EUR 506 |
OLR1 ELISA Kit (Human) (OKAN05040) |
OKAN05040 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes a low density lipoprotein receptor that belongs to the C-type lectin superfamily. This gene is regulated through the cyclic AMP signaling pathway. The encoded protein binds, internalizes and degrades oxidized low-density lipoprotein. This protein may be involved in the regulation of Fas-induced apoptosis. This protein may play a role as a scavenger receptor. Mutations of this gene have been associated with atherosclerosis, risk of myocardial infarction, and may modify the risk of Alzheimer's disease. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL |
OLR1 ELISA Kit (Mouse) (OKAN06013) |
OKAN06013 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.4 pg/mL |
OLR1 ELISA Kit (Bovine) (OKCD07737) |
OKCD07737 |
Aviva Systems Biology |
96 Wells |
EUR 1105 |
Description: Description of target: Receptor that mediates the recognition, internalization and degradation of oxidatively modified low density lipoprotein (oxLDL) by vascular endothelial cells. OxLDL is a marker of atherosclerosis that induces vascular endothelial cell activation and dysfunction, resulting in pro-inflammatory responses, pro-oxidative conditions and apoptosis. Its association with oxLDL induces the activation of NF-kappa-B through an increased production of intracellular reactive oxygen and a variety of pro-atherogenic cellular responses including a reduction of nitric oxide (NO) release, monocyte adhesion and apoptosis. In addition to binding oxLDL, it acts as a receptor for the HSP70 protein involved in antigen cross-presentation to naive T-cells in dendritic cells, thereby participating in cell-mediated antigen cross-presentation. Also involved in inflammatory process, by acting as a leukocyte-adhesion molecule at the vascular interface in endotoxin-induced inflammation. Also acts as a receptor for advanced glycation end (AGE) products, activated platelets, monocytes, apoptotic cells and both Gram-negative and Gram-positive bacteria.;Species reactivity: Bovine;Application: ELISA;Assay info: ;Sensitivity: < 13.2pg/mL |
OLR1 ELISA Kit (Human) (OKCD07738) |
OKCD07738 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
Description: Description of target: OLR1 is a receptor protein which belongs to the C-type lectin superfamily. OLR1 binds, internalizes and degrades oxidized low-density lipoprotein. This protein may be involved in the regulation of Fas-induced apoptosis. This protein may play a role as a scavenger receptor. Mutations of its gene have been associated with atherosclerosis, risk of myocardial infarction, and may modify the risk of Alzheimer's disease.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.057ng/mL |
OLR1 ELISA Kit (Mouse) (OKCD07739) |
OKCD07739 |
Aviva Systems Biology |
96 Wells |
EUR 531 |
Description: Description of target: Oxidized low-density lipoprotein receptor 1 (Ox-LDL receptor 1) also known as lectin-type oxidized LDL receptor 1 (LOX-1) is a protein that in humans is encoded by the OLR1 gene. It belongs to the C-type lectin superfamily. The LOX1 gene is mapped to to 12p13-p12. The protein has got the amino acids of 363. It can be detected in various tissues, highly expressed in placenta. This protein may be involved in the regulation of Fas-induced apoptosis and play a role as a scavenger receptor. The standards of this kit are recombinant mouse LOX-1 (R60-I363), with molecular weight of 36.3kDa.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 5.4pg/mL |
OLR1 Rabbit Polyclonal Antibody