NIPA1 Rabbit Polyclonal Antibody

NIPA1 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

NIPA1 Polyclonal Antibody

ABP59468-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NIPA1 protein at amino acid sequence of 111-160
  • Applications tips:
Description: A polyclonal antibody for detection of NIPA1 from Human, Mouse. This NIPA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NIPA1 protein at amino acid sequence of 111-160

NIPA1 Antibody

43886-100ul 100ul
EUR 252

NIPA1 Conjugated Antibody

C43886 100ul
EUR 397

Anti-NIPA1 antibody

STJ192600 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NIPA1

NIPA1 siRNA

20-abx925917
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NIPA1 siRNA

20-abx925918
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Mouse Magnesium transporter NIPA1, Nipa1 ELISA KIT

ELI-15093m 96 Tests
EUR 865

Human Magnesium transporter NIPA1, NIPA1 ELISA KIT

ELI-44030h 96 Tests
EUR 824

NIPA1 cloning plasmid

CSB-CL742399HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 765
  • Sequence: atggctgttggccagattggaaacttcctggcttacacggcggtccccacggtcctggtaacccccctgggcgcccttggagtaccgttcgggtccattttagcttcctatctcctgaaggaaaagctcaacatcttgggcaagttggggtgcctgctaagctgtgcaggctccgt
  • Show more
Description: A cloning plasmid for the NIPA1 gene.

Human NIPA1 shRNA Plasmid

20-abx964733
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NIPA1 shRNA Plasmid

20-abx982047
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NIPA1 Recombinant Protein (Human)

RP021247 100 ug Ask for price

NIPA1 Recombinant Protein (Rat)

RP213947 100 ug Ask for price

pCMV-SPORT6-NIPA1 Plasmid

PVT16286 2 ug
EUR 325

NIPA1 Recombinant Protein (Mouse)

RP154127 100 ug Ask for price

NIPA1 ORF Vector (Human) (pORF)

ORF007083 1.0 ug DNA
EUR 95

Nipa1 ORF Vector (Rat) (pORF)

ORF071317 1.0 ug DNA
EUR 506

Nipa1 ORF Vector (Mouse) (pORF)

ORF051377 1.0 ug DNA
EUR 506

NIPA1 ELISA Kit (Human) (OKCD02024)

OKCD02024 96 Wells
EUR 831
Description: Description of target: Acts as a Mg2+ transporter. Can also transport other divalent cations such as Fe2+, Sr2+, Ba2+, Mn2+ and Co2+ but to a much less extent than Mg2+.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.059 ng/mL

NIPA1 sgRNA CRISPR Lentivector set (Human)

K1428001 3 x 1.0 ug
EUR 339

Nipa1 sgRNA CRISPR Lentivector set (Mouse)

K3745301 3 x 1.0 ug
EUR 339

Nipa1 sgRNA CRISPR Lentivector set (Rat)

K6714401 3 x 1.0 ug
EUR 339

NIPA1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1428002 1.0 ug DNA
EUR 154

NIPA1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1428003 1.0 ug DNA
EUR 154

NIPA1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1428004 1.0 ug DNA
EUR 154

Nipa1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3745302 1.0 ug DNA
EUR 154

Nipa1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3745303 1.0 ug DNA
EUR 154

Nipa1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3745304 1.0 ug DNA
EUR 154

Nipa1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6714402 1.0 ug DNA
EUR 154

Nipa1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6714403 1.0 ug DNA
EUR 154

Nipa1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6714404 1.0 ug DNA
EUR 154

NIPA1 Protein Vector (Rat) (pPB-C-His)

PV285266 500 ng
EUR 603

NIPA1 Protein Vector (Rat) (pPB-N-His)

PV285267 500 ng
EUR 603

NIPA1 Protein Vector (Rat) (pPM-C-HA)

PV285268 500 ng
EUR 603

NIPA1 Protein Vector (Rat) (pPM-C-His)

PV285269 500 ng
EUR 603

NIPA1 Protein Vector (Human) (pPB-C-His)

PV028329 500 ng
EUR 329

NIPA1 Protein Vector (Human) (pPB-N-His)

PV028330 500 ng
EUR 329

NIPA1 Protein Vector (Human) (pPM-C-HA)

PV028331 500 ng
EUR 329

NIPA1 Protein Vector (Human) (pPM-C-His)

PV028332 500 ng
EUR 329

NIPA1 Protein Vector (Mouse) (pPB-C-His)

PV205506 500 ng
EUR 603

NIPA1 Protein Vector (Mouse) (pPB-N-His)

PV205507 500 ng
EUR 603

NIPA1 Protein Vector (Mouse) (pPM-C-HA)

PV205508 500 ng
EUR 603

NIPA1 Protein Vector (Mouse) (pPM-C-His)

PV205509 500 ng
EUR 603

Nipa1 3'UTR GFP Stable Cell Line

TU164091 1.0 ml Ask for price

Nipa1 3'UTR Luciferase Stable Cell Line

TU213982 1.0 ml Ask for price

NIPA1 3'UTR Luciferase Stable Cell Line

TU015691 1.0 ml
EUR 4617

Nipa1 3'UTR Luciferase Stable Cell Line

TU114091 1.0 ml Ask for price

NIPA1 3'UTR GFP Stable Cell Line

TU065691 1.0 ml
EUR 4617

Nipa1 3'UTR GFP Stable Cell Line

TU263982 1.0 ml Ask for price

NIPA1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV659431 1.0 ug DNA
EUR 514

NIPA1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV659435 1.0 ug DNA
EUR 514

NIPA1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV659436 1.0 ug DNA
EUR 514

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NIPA1 Rabbit Polyclonal Antibody