LY86 Rabbit Polyclonal Antibody

LY86 Rabbit Polyclonal Antibody

To Order Now:

LY86 Polyclonal Antibody

ABP59168-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human LY86 protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of LY86 from Human, Mouse. This LY86 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LY86 protein at amino acid sequence of 80-160

LY86 Polyclonal Antibody

ES11209-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against LY86 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

LY86 Polyclonal Antibody

ES11209-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LY86 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Rabbit Anti-Mouse Ly86 Polyclonal Antibody

CPB-055RM 50µg
EUR 715

LY86 Rabbit pAb

A6185-100ul 100 ul
EUR 308

LY86 Rabbit pAb

A6185-200ul 200 ul
EUR 459

LY86 Rabbit pAb

A6185-20ul 20 ul
EUR 183

LY86 Rabbit pAb

A6185-50ul 50 ul
EUR 223

LY86 Polyclonal Conjugated Antibody

C30708 100ul
EUR 397

LY86 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LY86. Recognizes LY86 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Anti-LY86 antibody

STJ27946 100 µl
EUR 277

Anti-LY86 antibody

STJ192367 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LY86

LY86 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LY86 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Polyclonal MD-1 / LY86 Antibody (aa112-125)

APR02819G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MD-1 / LY86 (aa112-125). This antibody is tested and proven to work in the following applications:

LY86 cloning plasmid

CSB-CL013252HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 489
  • Sequence: atgaagggtttcacagccactctcttcctctggactctgatttttcccagctgcagtggaggcggcggtgggaaagcctggcccacacacgtggtctgtagcgacagcggcttggaagtgctctaccagagttgcgatccattacaagattttggcttttctgttgaaaagtgttc
  • Show more
Description: A cloning plasmid for the LY86 gene.

Lymphocyte Antigen 86 (LY86) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lymphocyte Antigen 86 (LY86) Antibody

abx028333-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Lymphocyte Antigen 86 (LY86) Antibody

abx028333-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Lymphocyte Antigen 86 (LY86) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lymphocyte Antigen 86 (LY86) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

LY86 protein (His tag)

80R-2922 100 ug
EUR 327
Description: Purified recombinant LY86 protein (His tag)

Human LY86 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse LY86 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6-LY86 Plasmid

PVT16733 2 ug
EUR 325

LY86 Recombinant Protein (Human)

RP018445 100 ug Ask for price

LY86 Recombinant Protein (Mouse)

RP148724 100 ug Ask for price

LY86 Recombinant Protein (Rat)

RP210377 100 ug Ask for price

Monoclonal LY86 Antibody (monoclonal) (M01), Clone: 1H3

AMM03756G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human LY86 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1H3. This antibody is applicable in WB, E

Lymphocyte Antigen 86 (LY86) Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Ly86 ORF Vector (Rat) (pORF)

ORF070127 1.0 ug DNA
EUR 506

LY86 ORF Vector (Human) (pORF)

ORF006149 1.0 ug DNA
EUR 95

Ly86 ORF Vector (Mouse) (pORF)

ORF049576 1.0 ug DNA
EUR 506

LY86 ELISA Kit (Human) (OKCA01341)

OKCA01341 96 Wells
EUR 846
Description: Description of target: May cooperate with CD180 and TLR4 to mediate the innate immune response to bacterial lipopolysaccharide (LPS) and cytokine production. Important for efficient CD180 cell surface expression.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7.81 pg/mL

Ly86 sgRNA CRISPR Lentivector set (Rat)

K6040501 3 x 1.0 ug
EUR 339

Ly86 sgRNA CRISPR Lentivector set (Mouse)

K3774901 3 x 1.0 ug
EUR 339

LY86 sgRNA CRISPR Lentivector set (Human)

K1246201 3 x 1.0 ug
EUR 339

LY86-AS1 ORF Vector (Human) (pORF)

ORF023191 1.0 ug DNA Ask for price

Human Lymphocyte antigen 86(LY86) ELISA kit

CSB-EL013252HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Lymphocyte antigen 86 (LY86) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Lymphocyte antigen 86(LY86) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Lymphocyte antigen 86(LY86) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Chicken Lymphocyte antigen 86, LY86 ELISA KIT

ELI-16431c 96 Tests
EUR 928

Mouse Lymphocyte antigen 86, Ly86 ELISA KIT

ELI-31493m 96 Tests
EUR 865

Ly86 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6040502 1.0 ug DNA
EUR 154

Ly86 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6040503 1.0 ug DNA
EUR 154

Ly86 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6040504 1.0 ug DNA
EUR 154

Human Lymphocyte antigen 86, LY86 ELISA KIT

ELI-39140h 96 Tests
EUR 824

Ly86 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3774902 1.0 ug DNA
EUR 154

Ly86 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3774903 1.0 ug DNA
EUR 154

Ly86 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3774904 1.0 ug DNA
EUR 154

LY86 sgRNA CRISPR Lentivector (Human) (Target 1)

K1246202 1.0 ug DNA
EUR 154

LY86 sgRNA CRISPR Lentivector (Human) (Target 2)

K1246203 1.0 ug DNA
EUR 154

LY86 sgRNA CRISPR Lentivector (Human) (Target 3)

K1246204 1.0 ug DNA
EUR 154

LY86 Lymphocyte Antigen 86 Human Recombinant Protein

PROTO95711 Regular: 20ug
EUR 317
Description: LY86 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 165 amino acids (21-162) and having a molecular mass of 18.1kDa.;LY86 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

LY86 Protein Vector (Human) (pPB-C-His)

PV024593 500 ng
EUR 329

LY86 Protein Vector (Human) (pPB-N-His)

PV024594 500 ng
EUR 329

LY86 Protein Vector (Human) (pPM-C-HA)

PV024595 500 ng
EUR 329

LY86 Protein Vector (Human) (pPM-C-His)

PV024596 500 ng
EUR 329

LY86 Protein Vector (Rat) (pPB-C-His)

PV280506 500 ng
EUR 603

LY86 Rabbit Polyclonal Antibody