CRTAM Rabbit Polyclonal Antibody
CRTAM Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
 CRTAM Polyclonal Antibody |
|
ABP58275-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human CRTAM protein at amino acid sequence of 260-340
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CRTAM from Human, Mouse. This CRTAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CRTAM protein at amino acid sequence of 260-340 |
CRTAM Polyclonal Antibody |
|
ABP58275-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human CRTAM protein at amino acid sequence of 260-340
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CRTAM from Human, Mouse. This CRTAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CRTAM protein at amino acid sequence of 260-340 |
CRTAM Polyclonal Antibody |
|
ABP58275-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CRTAM protein at amino acid sequence of 260-340
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CRTAM from Human, Mouse. This CRTAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CRTAM protein at amino acid sequence of 260-340 |
 CRTAM Antibody |
|
35697-100ul |
SAB |
100ul |
EUR 252 |
CRTAM Antibody |
|
1-CSB-PA243691 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against CRTAM. Recognizes CRTAM from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200 |
CRTAM Antibody |
|
1-CSB-PA725805 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against CRTAM. Recognizes CRTAM from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
 CRTAM Conjugated Antibody |
|
C35697 |
SAB |
100ul |
EUR 397 |
 Anti-CRTAM antibody |
|
STJ192377 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to CRTAM |
 CRTAM siRNA |
|
20-abx912846 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CRTAM siRNA |
|
20-abx912847 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-CRTAM |
|
YF-PA19986 |
Abfrontier |
50 ul |
EUR 363 |
|
Description: Mouse polyclonal to Anti-CRTAM |
anti-CRTAM |
|
YF-PA19987 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to Anti-CRTAM |
 CRTAM cloning plasmid |
|
CSB-CL005998HU-10ug |
Cusabio |
10ug |
EUR 440 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1182
- Sequence: atgtggtggagagttctcagcttgctggcatggttccccttgcaagaggcctctctgactaaccacacagaaaccatcaccgtggaggaaggccagacgctcactctaaagtgtgtcacttctctgaggaagaactcctccctccagtggctgaccccctcagggttcaccattt
- Show more
|
|
Description: A cloning plasmid for the CRTAM gene. |
 Recombinant human CRTAM |
|
P2399 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: O95727
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
|
Description: Recombinant protein for human CRTAM |
 Mouse CRTAM shRNA Plasmid |
|
20-abx974545 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human CRTAM shRNA Plasmid |
|
20-abx961115 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) CRTAM Recombinant Protein (Human) |
|
RP008068 |
ABM |
100 ug |
Ask for price |
) CRTAM Recombinant Protein (Rat) |
|
RP196361 |
ABM |
100 ug |
Ask for price |
) CRTAM Recombinant Protein (Mouse) |
|
RP126104 |
ABM |
100 ug |
Ask for price |
 (pORF)) CRTAM ORF Vector (Human) (pORF) |
|
ORF002690 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Crtam ORF Vector (Rat) (pORF) |
|
ORF065455 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Crtam ORF Vector (Mouse) (pORF) |
|
ORF042036 |
ABM |
1.0 ug DNA |
EUR 506 |
 ELISA kit) Rabbit Cytotoxic and regulatory T cell molecule(CRTAM) ELISA kit |
|
E04C2079-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cytotoxic and regulatory T cell molecule(CRTAM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cytotoxic and regulatory T cell molecule(CRTAM) ELISA kit |
|
E04C2079-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cytotoxic and regulatory T cell molecule(CRTAM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cytotoxic and regulatory T cell molecule(CRTAM) ELISA kit |
|
E04C2079-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cytotoxic and regulatory T cell molecule(CRTAM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Antibody) Cytotoxic And Regulatory T-Cell Molecule (CRTAM) Antibody |
|
abx145326-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
 Antibody) Cytotoxic and Regulatory T-cell Molecule (CRTAM) Antibody |
|
20-abx339839 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cytotoxic and Regulatory T-cell Molecule (CRTAM) Antibody |
|
20-abx210512 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
) CRTAM sgRNA CRISPR Lentivector set (Human) |
|
K0510301 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Crtam sgRNA CRISPR Lentivector set (Rat) |
|
K6125801 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Crtam sgRNA CRISPR Lentivector set (Mouse) |
|
K3986101 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) CRTAM sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0510302 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) CRTAM sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0510303 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) CRTAM sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0510304 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Crtam sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6125802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Crtam sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6125803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Crtam sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6125804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Crtam sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3986102 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Crtam sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3986103 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Crtam sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3986104 |
ABM |
1.0 ug DNA |
EUR 154 |
 Recombinant Human CRTAM Protein, His, Insect-10ug |
|
QP11515-10ug |
EnQuireBio |
10ug |
EUR 201 |
 Recombinant Human CRTAM Protein, His, Insect-1mg |
|
QP11515-1mg |
EnQuireBio |
1mg |
EUR 5251 |
 Recombinant Human CRTAM Protein, His, Insect-2ug |
|
QP11515-2ug |
EnQuireBio |
2ug |
EUR 155 |
 (pPB-C-His)) CRTAM Protein Vector (Human) (pPB-C-His) |
|
PV010757 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) CRTAM Protein Vector (Human) (pPB-N-His) |
|
PV010758 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) CRTAM Protein Vector (Human) (pPM-C-HA) |
|
PV010759 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) CRTAM Protein Vector (Human) (pPM-C-His) |
|
PV010760 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) CRTAM Protein Vector (Mouse) (pPB-C-His) |
|
PV168142 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) CRTAM Protein Vector (Mouse) (pPB-N-His) |
|
PV168143 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) CRTAM Protein Vector (Mouse) (pPM-C-HA) |
|
PV168144 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) CRTAM Protein Vector (Mouse) (pPM-C-His) |
|
PV168145 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) CRTAM Protein Vector (Rat) (pPB-C-His) |
|
PV261818 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) CRTAM Protein Vector (Rat) (pPB-N-His) |
|
PV261819 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) CRTAM Protein Vector (Rat) (pPM-C-HA) |
|
PV261820 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) CRTAM Protein Vector (Rat) (pPM-C-His) |
|
PV261821 |
ABM |
500 ng |
EUR 603 |
 Crtam 3'UTR Luciferase Stable Cell Line |
|
TU202814 |
ABM |
1.0 ml |
Ask for price |
 Crtam 3'UTR GFP Stable Cell Line |
|
TU154388 |
ABM |
1.0 ml |
Ask for price |
 CRTAM 3'UTR Luciferase Stable Cell Line |
|
TU005046 |
ABM |
1.0 ml |
EUR 1394 |
Crtam 3'UTR Luciferase Stable Cell Line |
|
TU104388 |
ABM |
1.0 ml |
Ask for price |
 CRTAM 3'UTR GFP Stable Cell Line |
|
TU055046 |
ABM |
1.0 ml |
EUR 1394 |
Crtam 3'UTR GFP Stable Cell Line |
|
TU252814 |
ABM |
1.0 ml |
Ask for price |
 (CMV) (pLenti-GIII-CMV)) CRTAM Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV651355 |
ABM |
1.0 ug DNA |
EUR 514 |
 (UbC) (pLenti-GIII-UbC)) CRTAM Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV651359 |
ABM |
1.0 ug DNA |
EUR 514 |
 (EF1a) (pLenti-GIII-EF1a)) CRTAM Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV651360 |
ABM |
1.0 ug DNA |
EUR 514 |
 [Fc]) Recombinant CRTAM Protein (Ser 18-Gly 287) [Fc] |
|
VAng-1416Lsx-100g |
Creative Biolabs |
100 µg |
EUR 848 |
|
Description: Human CRTAM, human IgG1 Fc tag, is expressed in HEK 293 cells. (Uniprot ID: XP_005580021.1) |
Recombinant CRTAM Protein (Ser 18-Gly 287) [Fc] |
|
VAng-1416Lsx-1mg |
Creative Biolabs |
1 mg |
EUR 4999 |
|
Description: Human CRTAM, human IgG1 Fc tag, is expressed in HEK 293 cells. (Uniprot ID: XP_005580021.1) |
 [His]) Recombinant CRTAM Protein (Ser 18-Gly 287) [His] |
|
VAng-1417Lsx-100g |
Creative Biolabs |
100 µg |
EUR 875 |
|
Description: Human CRTAM, His tag, is expressed in HEK 293 cells. (Uniprot ID: O95727-1) |
CRTAM Rabbit Polyclonal Antibody
