CRTAM Rabbit Polyclonal Antibody

CRTAM Rabbit Polyclonal Antibody

To Order Now:

CRTAM Polyclonal Antibody

ABP58275-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CRTAM protein at amino acid sequence of 260-340
  • Applications tips:
Description: A polyclonal antibody for detection of CRTAM from Human, Mouse. This CRTAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CRTAM protein at amino acid sequence of 260-340

CRTAM Polyclonal Antibody

ABP58275-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CRTAM protein at amino acid sequence of 260-340
  • Applications tips:
Description: A polyclonal antibody for detection of CRTAM from Human, Mouse. This CRTAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CRTAM protein at amino acid sequence of 260-340

CRTAM Polyclonal Antibody

ABP58275-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CRTAM protein at amino acid sequence of 260-340
  • Applications tips:
Description: A polyclonal antibody for detection of CRTAM from Human, Mouse. This CRTAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CRTAM protein at amino acid sequence of 260-340

CRTAM Antibody

35697-100ul 100ul
EUR 252

CRTAM Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CRTAM. Recognizes CRTAM from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

CRTAM Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CRTAM. Recognizes CRTAM from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

CRTAM Conjugated Antibody

C35697 100ul
EUR 397

Anti-CRTAM antibody

STJ192377 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CRTAM


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA19986 50 ul
EUR 363
Description: Mouse polyclonal to Anti-CRTAM


YF-PA19987 50 ug
EUR 363
Description: Mouse polyclonal to Anti-CRTAM

CRTAM cloning plasmid

CSB-CL005998HU-10ug 10ug
EUR 440
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1182
  • Sequence: atgtggtggagagttctcagcttgctggcatggttccccttgcaagaggcctctctgactaaccacacagaaaccatcaccgtggaggaaggccagacgctcactctaaagtgtgtcacttctctgaggaagaactcctccctccagtggctgaccccctcagggttcaccattt
  • Show more
Description: A cloning plasmid for the CRTAM gene.

Recombinant human CRTAM

P2399 100ug Ask for price
  • Uniprot ID: O95727
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human CRTAM

Mouse CRTAM shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF004829 96 Tests
EUR 689

Human CRTAM shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CRTAM Recombinant Protein (Human)

RP008068 100 ug Ask for price

CRTAM Recombinant Protein (Rat)

RP196361 100 ug Ask for price

CRTAM Recombinant Protein (Mouse)

RP126104 100 ug Ask for price

CRTAM ORF Vector (Human) (pORF)

ORF002690 1.0 ug DNA
EUR 95

Crtam ORF Vector (Rat) (pORF)

ORF065455 1.0 ug DNA
EUR 506

Crtam ORF Vector (Mouse) (pORF)

ORF042036 1.0 ug DNA
EUR 506

Rabbit Cytotoxic and regulatory T cell molecule(CRTAM) ELISA kit

E04C2079-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cytotoxic and regulatory T cell molecule(CRTAM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cytotoxic and regulatory T cell molecule(CRTAM) ELISA kit

E04C2079-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cytotoxic and regulatory T cell molecule(CRTAM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cytotoxic and regulatory T cell molecule(CRTAM) ELISA kit

E04C2079-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cytotoxic and regulatory T cell molecule(CRTAM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Cytotoxic And Regulatory T-Cell Molecule (CRTAM) Antibody

abx145326-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Cytotoxic and Regulatory T-cell Molecule (CRTAM) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cytotoxic and Regulatory T-cell Molecule (CRTAM) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

CRTAM sgRNA CRISPR Lentivector set (Human)

K0510301 3 x 1.0 ug
EUR 339

Crtam sgRNA CRISPR Lentivector set (Rat)

K6125801 3 x 1.0 ug
EUR 339

Crtam sgRNA CRISPR Lentivector set (Mouse)

K3986101 3 x 1.0 ug
EUR 339

CRTAM sgRNA CRISPR Lentivector (Human) (Target 1)

K0510302 1.0 ug DNA
EUR 154

CRTAM sgRNA CRISPR Lentivector (Human) (Target 2)

K0510303 1.0 ug DNA
EUR 154

CRTAM sgRNA CRISPR Lentivector (Human) (Target 3)

K0510304 1.0 ug DNA
EUR 154

Crtam sgRNA CRISPR Lentivector (Rat) (Target 1)

K6125802 1.0 ug DNA
EUR 154

Crtam sgRNA CRISPR Lentivector (Rat) (Target 2)

K6125803 1.0 ug DNA
EUR 154

Crtam sgRNA CRISPR Lentivector (Rat) (Target 3)

K6125804 1.0 ug DNA
EUR 154

Crtam sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3986102 1.0 ug DNA
EUR 154

Crtam sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3986103 1.0 ug DNA
EUR 154

Crtam sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3986104 1.0 ug DNA
EUR 154

Recombinant Human CRTAM Protein, His, Insect-10ug

QP11515-10ug 10ug
EUR 201

Recombinant Human CRTAM Protein, His, Insect-1mg

QP11515-1mg 1mg
EUR 5251

Recombinant Human CRTAM Protein, His, Insect-2ug

QP11515-2ug 2ug
EUR 155

CRTAM Protein Vector (Human) (pPB-C-His)

PV010757 500 ng
EUR 329

CRTAM Protein Vector (Human) (pPB-N-His)

PV010758 500 ng
EUR 329

CRTAM Protein Vector (Human) (pPM-C-HA)

PV010759 500 ng
EUR 329

CRTAM Protein Vector (Human) (pPM-C-His)

PV010760 500 ng
EUR 329

CRTAM Protein Vector (Mouse) (pPB-C-His)

PV168142 500 ng
EUR 603

CRTAM Protein Vector (Mouse) (pPB-N-His)

PV168143 500 ng
EUR 603

CRTAM Protein Vector (Mouse) (pPM-C-HA)

PV168144 500 ng
EUR 603

CRTAM Protein Vector (Mouse) (pPM-C-His)

PV168145 500 ng
EUR 603

CRTAM Protein Vector (Rat) (pPB-C-His)

PV261818 500 ng
EUR 603

CRTAM Protein Vector (Rat) (pPB-N-His)

PV261819 500 ng
EUR 603

CRTAM Protein Vector (Rat) (pPM-C-HA)

PV261820 500 ng
EUR 603

CRTAM Protein Vector (Rat) (pPM-C-His)

PV261821 500 ng
EUR 603

Crtam 3'UTR Luciferase Stable Cell Line

TU202814 1.0 ml Ask for price

Crtam 3'UTR GFP Stable Cell Line

TU154388 1.0 ml Ask for price

CRTAM 3'UTR Luciferase Stable Cell Line

TU005046 1.0 ml
EUR 1394

Crtam 3'UTR Luciferase Stable Cell Line

TU104388 1.0 ml Ask for price

CRTAM 3'UTR GFP Stable Cell Line

TU055046 1.0 ml
EUR 1394

Crtam 3'UTR GFP Stable Cell Line

TU252814 1.0 ml Ask for price

CRTAM Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV651355 1.0 ug DNA
EUR 514

CRTAM Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV651359 1.0 ug DNA
EUR 514

CRTAM Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV651360 1.0 ug DNA
EUR 514

Recombinant CRTAM Protein (Ser 18-Gly 287) [Fc]

VAng-1416Lsx-100g 100 µg
EUR 848
Description: Human CRTAM, human IgG1 Fc tag, is expressed in HEK 293 cells. (Uniprot ID: XP_005580021.1)

Recombinant CRTAM Protein (Ser 18-Gly 287) [Fc]

VAng-1416Lsx-1mg 1 mg
EUR 4999
Description: Human CRTAM, human IgG1 Fc tag, is expressed in HEK 293 cells. (Uniprot ID: XP_005580021.1)

Recombinant CRTAM Protein (Ser 18-Gly 287) [His]

VAng-1417Lsx-100g 100 µg
EUR 875
Description: Human CRTAM, His tag, is expressed in HEK 293 cells. (Uniprot ID: O95727-1)

CRTAM Rabbit Polyclonal Antibody