CRHBP Rabbit Polyclonal Antibody
CRHBP Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
CRHBP Polyclonal Antibody |
ES11268-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CRHBP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CRHBP Polyclonal Antibody |
ES11268-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CRHBP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CRHBP Rabbit pAb |
A13027-100ul |
Abclonal |
100 ul |
EUR 308 |
CRHBP Rabbit pAb |
A13027-200ul |
Abclonal |
200 ul |
EUR 459 |
CRHBP Rabbit pAb |
A13027-20ul |
Abclonal |
20 ul |
EUR 183 |
CRHBP Rabbit pAb |
A13027-50ul |
Abclonal |
50 ul |
EUR 223 |
CRHBP Rabbit pAb |
A13028-100ul |
Abclonal |
100 ul |
EUR 308 |
CRHBP Rabbit pAb |
A13028-200ul |
Abclonal |
200 ul |
EUR 459 |
CRHBP Rabbit pAb |
A13028-20ul |
Abclonal |
20 ul |
EUR 183 |
CRHBP Rabbit pAb |
A13028-50ul |
Abclonal |
50 ul |
EUR 223 |
CRHBP Rabbit pAb |
A6568-100ul |
Abclonal |
100 ul |
EUR 308 |
CRHBP Rabbit pAb |
A6568-200ul |
Abclonal |
200 ul |
EUR 459 |
CRHBP Rabbit pAb |
A6568-20ul |
Abclonal |
20 ul |
EUR 183 |
CRHBP Rabbit pAb |
A6568-50ul |
Abclonal |
50 ul |
EUR 223 |
Human Corticotropin Releasing Hormone Binding Protein (CRHBP) ELISA Kit |
DLR-CRHBP-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Corticotropin Releasing Hormone Binding Protein (CRHBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Corticotropin Releasing Hormone Binding Protein (CRHBP) in samples from serum, plasma or other biological fluids. |
Human Corticotropin Releasing Hormone Binding Protein (CRHBP) ELISA Kit |
DLR-CRHBP-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Corticotropin Releasing Hormone Binding Protein (CRHBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Corticotropin Releasing Hormone Binding Protein (CRHBP) in samples from serum, plasma or other biological fluids. |
Rat Corticotropin Releasing Hormone Binding Protein (CRHBP) ELISA Kit |
DLR-CRHBP-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat Corticotropin Releasing Hormone Binding Protein (CRHBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Corticotropin Releasing Hormone Binding Protein (CRHBP) in samples from serum, plasma or other biological fluids. |
Rat Corticotropin Releasing Hormone Binding Protein (CRHBP) ELISA Kit |
DLR-CRHBP-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat Corticotropin Releasing Hormone Binding Protein (CRHBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Corticotropin Releasing Hormone Binding Protein (CRHBP) in samples from serum, plasma or other biological fluids. |
Human Corticotropin Releasing Hormone Binding Protein (CRHBP) ELISA Kit |
RDR-CRHBP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Corticotropin Releasing Hormone Binding Protein (CRHBP) ELISA Kit |
RDR-CRHBP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Rat Corticotropin Releasing Hormone Binding Protein (CRHBP) ELISA Kit |
RDR-CRHBP-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Corticotropin Releasing Hormone Binding Protein (CRHBP) ELISA Kit |
RDR-CRHBP-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
Human Corticotropin Releasing Hormone Binding Protein (CRHBP) ELISA Kit |
RD-CRHBP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Corticotropin Releasing Hormone Binding Protein (CRHBP) ELISA Kit |
RD-CRHBP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Rat Corticotropin Releasing Hormone Binding Protein (CRHBP) ELISA Kit |
RD-CRHBP-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Corticotropin Releasing Hormone Binding Protein (CRHBP) ELISA Kit |
RD-CRHBP-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
CRHBP antibody |
39014-100ul |
SAB |
100ul |
EUR 252 |
Polyclonal CRHBP Antibody (N-term) |
APR03753G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CRHBP (N-term). This antibody is tested and proven to work in the following applications: |
CRHBP Conjugated Antibody |
C39014 |
SAB |
100ul |
EUR 397 |
Anti-CRHBP antibody |
STJ28651 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Corticotropin-releasing hormone is a potent stimulator of synthesis and secretion of preopiomelanocortin-derived peptides. Although CRH concentrations in the human peripheral circulation are normally low, they increase throughout pregnancy and fall rapidly after parturition. Maternal plasma CRH probably originates from the placenta. Human plasma contains a CRH-binding protein which inactivates CRH and which may prevent inappropriate pituitary-adrenal stimulation in pregnancy. |
Anti-CRHBP antibody |
STJ114994 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Corticotropin-releasing hormone is a potent stimulator of synthesis and secretion of preopiomelanocortin-derived peptides. Although CRH concentrations in the human peripheral circulation are normally low, they increase throughout pregnancy and fall rapidly after parturition. Maternal plasma CRH probably originates from the placenta. Human plasma contains a CRH-binding protein which inactivates CRH and which may prevent inappropriate pituitary-adrenal stimulation in pregnancy. |
Anti-CRHBP antibody |
STJ114995 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Corticotropin-releasing hormone is a potent stimulator of synthesis and secretion of preopiomelanocortin-derived peptides. Although CRH concentrations in the human peripheral circulation are normally low, they increase throughout pregnancy and fall rapidly after parturition. Maternal plasma CRH probably originates from the placenta. Human plasma contains a CRH-binding protein which inactivates CRH and which may prevent inappropriate pituitary-adrenal stimulation in pregnancy. |
Anti-CRHBP antibody |
STJ192426 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to CRHBP |
CRHBP siRNA |
20-abx912791 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CRHBP siRNA |
20-abx912792 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-CRHBP |
YF-PA11083 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to CRHBP |
anti-CRHBP |
YF-PA11084 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to CRHBP |
anti-CRHBP |
YF-PA11085 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to CRHBP |
anti-CRHBP |
YF-PA11086 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to CRHBP |
CRHBP cloning plasmid |
CSB-CL005964HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 969
- Sequence: atgtcgcccaacttcaaacttcagtgtcacttcattctcatcttcctgacggctctaagaggggaaagccggtacctagagctgagggaagcggcggactacgatcctttcctgctcttcagcgccaacctgaagcgggagctggctggggagcagccgtaccgccgcgctctgcg
- Show more
|
Description: A cloning plasmid for the CRHBP gene. |
Anti-CRHBP (3D9) |
YF-MA12529 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to CRHBP |
Corticotropin Releasing Hormone Binding Protein (CRHBP) Polyclonal Antibody (Rat) |
4-PAC401Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CRHBP (Tyr25~Leu322)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Corticotropin Releasing Hormone Binding Protein (CRHBP) |
Corticotropin Releasing Hormone Binding Protein (CRHBP) Polyclonal Antibody (Rat), APC |
4-PAC401Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CRHBP (Tyr25~Leu322)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Corticotropin Releasing Hormone Binding Protein (CRHBP). This antibody is labeled with APC. |
Corticotropin Releasing Hormone Binding Protein (CRHBP) Polyclonal Antibody (Rat), Biotinylated |
4-PAC401Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CRHBP (Tyr25~Leu322)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Corticotropin Releasing Hormone Binding Protein (CRHBP). This antibody is labeled with Biotin. |
Corticotropin Releasing Hormone Binding Protein (CRHBP) Polyclonal Antibody (Rat), Cy3 |
4-PAC401Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CRHBP (Tyr25~Leu322)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Corticotropin Releasing Hormone Binding Protein (CRHBP). This antibody is labeled with Cy3. |
Corticotropin Releasing Hormone Binding Protein (CRHBP) Polyclonal Antibody (Rat), FITC |
4-PAC401Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CRHBP (Tyr25~Leu322)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Corticotropin Releasing Hormone Binding Protein (CRHBP). This antibody is labeled with FITC. |
Corticotropin Releasing Hormone Binding Protein (CRHBP) Polyclonal Antibody (Rat), HRP |
4-PAC401Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CRHBP (Tyr25~Leu322)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Corticotropin Releasing Hormone Binding Protein (CRHBP). This antibody is labeled with HRP. |
Corticotropin Releasing Hormone Binding Protein (CRHBP) Polyclonal Antibody (Rat), PE |
4-PAC401Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CRHBP (Tyr25~Leu322)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Corticotropin Releasing Hormone Binding Protein (CRHBP). This antibody is labeled with PE. |
CRHBP protein (His tag) |
80R-3690 |
Fitzgerald |
100 ug |
EUR 349 |
Description: Purified recombinant CRHBP protein (His tag) |
Mouse CRHBP shRNA Plasmid |
20-abx969807 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human CRHBP shRNA Plasmid |
20-abx950978 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CRHBP Recombinant Protein (Human) |
RP008008 |
ABM |
100 ug |
Ask for price |
CRHBP Recombinant Protein (Rat) |
RP196286 |
ABM |
100 ug |
Ask for price |
CRHBP Recombinant Protein (Mouse) |
RP126005 |
ABM |
100 ug |
Ask for price |
Rabbit Corticotropin releasing factor binding protein(CRHBP) ELISA kit |
E04C2055-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Corticotropin releasing factor binding protein(CRHBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Corticotropin releasing factor binding protein(CRHBP) ELISA kit |
E04C2055-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Corticotropin releasing factor binding protein(CRHBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Corticotropin releasing factor binding protein(CRHBP) ELISA kit |
E04C2055-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Corticotropin releasing factor binding protein(CRHBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Corticotropin Releasing Hormone Bingding Protein (CRHBP) ELISA Kit |
abx363494-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Corticotropin Releasing Hormone Binding Protein (CRHBP) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAC401Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CRHBP (Tyr25~Leu322)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Corticotropin Releasing Hormone Binding Protein (CRHBP). This antibody is labeled with APC-Cy7. |
Corticotropin Releasing Hormone Bingding Protein (CRHBP) Antibody |
20-abx005040 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Corticotropin Releasing Hormone Bingding Protein (CRHBP) Antibody |
abx027081-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Corticotropin Releasing Hormone Bingding Protein (CRHBP) Antibody |
abx027081-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Corticotropin Releasing Hormone Binding Protein (CRHBP) Antibody |
20-abx176024 |
Abbexa |
|
|
|
Corticotropin Releasing Hormone Binding Protein (CRHBP) Antibody |
20-abx130399 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Corticotropin Releasing Hormone Binding Protein (CRHBP) Antibody |
20-abx132414 |
Abbexa |
-
EUR 356.00
-
EUR 913.00
-
EUR 467.00
-
EUR 154.00
-
EUR 272.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Corticotropin Releasing Hormone Bingding Protein (CRHBP) Antibody |
abx145362-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Corticotropin Releasing Hormone Binding Protein (CRHBP) Antibody |
20-abx171931 |
Abbexa |
|
|
|
Crhbp ORF Vector (Rat) (pORF) |
ORF065430 |
ABM |
1.0 ug DNA |
EUR 506 |
CRHBP ORF Vector (Human) (pORF) |
ORF002670 |
ABM |
1.0 ug DNA |
EUR 95 |
Crhbp ORF Vector (Mouse) (pORF) |
ORF042003 |
ABM |
1.0 ug DNA |
EUR 506 |
CRHBP ELISA Kit (Mouse) (OKCA02362) |
OKCA02362 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: Binds CRF and inactivates it. May prevent inappropriate pituitary-adrenal stimulation in pregnancy. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 3.9 pg/mL |
CRHBP ELISA Kit (Human) (OKCD08113) |
OKCD08113 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: Purified Rabbit Polyclonal Antibody (Pab);Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 25.7pg/mL |
CRHBP ELISA Kit (Rat) (OKCD08114) |
OKCD08114 |
Aviva Systems Biology |
96 Wells |
EUR 1053 |
Description: Description of target: Binds CRF and inactivates it. May prevent inappropriate pituitary-adrenal stimulation in pregnancy. ;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 6.3pg/mL |
Crhbp ELISA Kit (Rat) (OKEH04789) |
OKEH04789 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Binds corticotropin releasing hormone and modulates CRH action; may act as a reservoir of endogenous CRH in the brain ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.084 ng/mL |
CRHBP ELISA Kit (Human) (OKEH04790) |
OKEH04790 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Corticotropin-releasing hormone is a potent stimulator of synthesis and secretion of preopiomelanocortin-derived peptides. Although CRH concentrations in the human peripheral circulation are normally low, they increase throughout pregnancy and fall rapidly after parturition. Maternal plasma CRH probably originates from the placenta. Human plasma contains a CRH-binding protein which inactivates CRH and which may prevent inappropriate pituitary-adrenal stimulation in pregnancy.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 24 pg/mL |
CRHBP ELISA Kit (Mouse) (OKEH05230) |
OKEH05230 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Binds CRF and inactivates it. May prevent inappropriate pituitary-adrenal stimulation in pregnancy. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.083 ng/mL |
Corticotropin Releasing Hormone Binding Protein (CRHBP) Antibody (Biotin) |
20-abx274421 |
Abbexa |
-
EUR 481.00
-
EUR 244.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
CRHBP sgRNA CRISPR Lentivector set (Human) |
K0506901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Crhbp sgRNA CRISPR Lentivector set (Rat) |
K6791001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Crhbp sgRNA CRISPR Lentivector set (Mouse) |
K3331601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Corticotropin Releasing Hormone Binding Protein (CRHBP) Monoclonal Antibody (Rat) |
4-MAC401Ra21 |
Cloud-Clone |
-
EUR 268.00
-
EUR 2840.00
-
EUR 700.00
-
EUR 340.00
-
EUR 223.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Tyr25~Leu322
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Rat Corticotropin Releasing Hormone Binding Protein (CRHBP) |
CRHBP sgRNA CRISPR Lentivector (Human) (Target 1) |
K0506902 |
ABM |
1.0 ug DNA |
EUR 154 |
CRHBP sgRNA CRISPR Lentivector (Human) (Target 2) |
K0506903 |
ABM |
1.0 ug DNA |
EUR 154 |
CRHBP sgRNA CRISPR Lentivector (Human) (Target 3) |
K0506904 |
ABM |
1.0 ug DNA |
EUR 154 |
Crhbp sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6791002 |
ABM |
1.0 ug DNA |
EUR 154 |
Crhbp sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6791003 |
ABM |
1.0 ug DNA |
EUR 154 |
Crhbp sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6791004 |
ABM |
1.0 ug DNA |
EUR 154 |
Crhbp sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3331602 |
ABM |
1.0 ug DNA |
EUR 154 |
Crhbp sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3331603 |
ABM |
1.0 ug DNA |
EUR 154 |
Crhbp sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3331604 |
ABM |
1.0 ug DNA |
EUR 154 |
CRHBP Protein Vector (Mouse) (pPB-C-His) |
PV168010 |
ABM |
500 ng |
EUR 603 |
CRHBP Protein Vector (Mouse) (pPB-N-His) |
PV168011 |
ABM |
500 ng |
EUR 603 |
CRHBP Protein Vector (Mouse) (pPM-C-HA) |
PV168012 |
ABM |
500 ng |
EUR 603 |
CRHBP Protein Vector (Mouse) (pPM-C-His) |
PV168013 |
ABM |
500 ng |
EUR 603 |
CRHBP Protein Vector (Rat) (pPB-C-His) |
PV261718 |
ABM |
500 ng |
EUR 603 |
CRHBP Protein Vector (Rat) (pPB-N-His) |
PV261719 |
ABM |
500 ng |
EUR 603 |
CRHBP Protein Vector (Rat) (pPM-C-HA) |
PV261720 |
ABM |
500 ng |
EUR 603 |
CRHBP Protein Vector (Rat) (pPM-C-His) |
PV261721 |
ABM |
500 ng |
EUR 603 |
CRHBP Protein Vector (Human) (pPB-C-His) |
PV010677 |
ABM |
500 ng |
EUR 329 |
CRHBP Protein Vector (Human) (pPB-N-His) |
PV010678 |
ABM |
500 ng |
EUR 329 |
CRHBP Protein Vector (Human) (pPM-C-HA) |
PV010679 |
ABM |
500 ng |
EUR 329 |
CRHBP Protein Vector (Human) (pPM-C-His) |
PV010680 |
ABM |
500 ng |
EUR 329 |
Recombinant Corticotropin Releasing Hormone Binding Protein (CRHBP) |
4-RPC401Hu01 |
Cloud-Clone |
-
EUR 413.60
-
EUR 214.00
-
EUR 1276.00
-
EUR 492.00
-
EUR 884.00
-
EUR 340.00
-
EUR 3040.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Inquire
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 37.0kDa
- Isoelectric Point: 6.0
|
Description: Recombinant Human Recombinant Corticotropin Releasing Hormone Binding Protein (CRHBP) expressed in: E.coli |
Recombinant Corticotropin Releasing Hormone Binding Protein (CRHBP) |
4-RPC401Ra01 |
Cloud-Clone |
-
EUR 519.33
-
EUR 242.00
-
EUR 1672.48
-
EUR 624.16
-
EUR 1148.32
-
EUR 410.00
-
EUR 4031.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P24388
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 63.4kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Corticotropin Releasing Hormone Binding Protein expressed in: E.coli |
Recombinant Human CRHBP Protein, His, E.coli-10ug |
QP11503-10ug |
EnQuireBio |
10ug |
EUR 201 |
Recombinant Human CRHBP Protein, His, E.coli-1mg |
QP11503-1mg |
EnQuireBio |
1mg |
EUR 5251 |
Recombinant Human CRHBP Protein, His, E.coli-2ug |
QP11503-2ug |
EnQuireBio |
2ug |
EUR 155 |
Crhbp 3'UTR GFP Stable Cell Line |
TU154361 |
ABM |
1.0 ml |
Ask for price |
Crhbp 3'UTR Luciferase Stable Cell Line |
TU104361 |
ABM |
1.0 ml |
Ask for price |
Crhbp 3'UTR Luciferase Stable Cell Line |
TU202789 |
ABM |
1.0 ml |
Ask for price |
CRHBP Rabbit Polyclonal Antibody