CRHBP Rabbit Polyclonal Antibody

CRHBP Rabbit Polyclonal Antibody

To Order Now:

CRHBP Polyclonal Antibody

ABP58267-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CRHBP protein at amino acid sequence of 70-150
  • Applications tips:
Description: A polyclonal antibody for detection of CRHBP from Human, Mouse, Rat. This CRHBP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CRHBP protein at amino acid sequence of 70-150

CRHBP Polyclonal Antibody

ABP58267-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CRHBP protein at amino acid sequence of 70-150
  • Applications tips:
Description: A polyclonal antibody for detection of CRHBP from Human, Mouse, Rat. This CRHBP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CRHBP protein at amino acid sequence of 70-150

CRHBP Rabbit pAb

A13027-100ul 100 ul
EUR 308

CRHBP Rabbit pAb

A13027-200ul 200 ul
EUR 459

CRHBP Rabbit pAb

A13027-20ul 20 ul
EUR 183

CRHBP Rabbit pAb

A13027-50ul 50 ul
EUR 223

CRHBP Rabbit pAb

A13028-100ul 100 ul
EUR 308

CRHBP Rabbit pAb

A13028-200ul 200 ul
EUR 459

CRHBP Rabbit pAb

A13028-20ul 20 ul
EUR 183

CRHBP Rabbit pAb

A13028-50ul 50 ul
EUR 223

CRHBP Rabbit pAb

A6568-100ul 100 ul
EUR 308

CRHBP Rabbit pAb

A6568-200ul 200 ul
EUR 459

CRHBP Rabbit pAb

A6568-20ul 20 ul
EUR 183

CRHBP Rabbit pAb

A6568-50ul 50 ul
EUR 223

Human Corticotropin Releasing Hormone Binding Protein (CRHBP) ELISA Kit

EUR 517
  • Should the Human Corticotropin Releasing Hormone Binding Protein (CRHBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Corticotropin Releasing Hormone Binding Protein (CRHBP) in samples from serum, plasma or other biological fluids.

Human Corticotropin Releasing Hormone Binding Protein (CRHBP) ELISA Kit

EUR 673
  • Should the Human Corticotropin Releasing Hormone Binding Protein (CRHBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Corticotropin Releasing Hormone Binding Protein (CRHBP) in samples from serum, plasma or other biological fluids.

Rat Corticotropin Releasing Hormone Binding Protein (CRHBP) ELISA Kit

EUR 549
  • Should the Rat Corticotropin Releasing Hormone Binding Protein (CRHBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Corticotropin Releasing Hormone Binding Protein (CRHBP) in samples from serum, plasma or other biological fluids.

Rat Corticotropin Releasing Hormone Binding Protein (CRHBP) ELISA Kit

EUR 718
  • Should the Rat Corticotropin Releasing Hormone Binding Protein (CRHBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Corticotropin Releasing Hormone Binding Protein (CRHBP) in samples from serum, plasma or other biological fluids.

Human Corticotropin Releasing Hormone Binding Protein (CRHBP) ELISA Kit

RDR-CRHBP-Hu-48Tests 48 Tests
EUR 544

Human Corticotropin Releasing Hormone Binding Protein (CRHBP) ELISA Kit

RDR-CRHBP-Hu-96Tests 96 Tests
EUR 756

Rat Corticotropin Releasing Hormone Binding Protein (CRHBP) ELISA Kit

RDR-CRHBP-Ra-48Tests 48 Tests
EUR 583

Rat Corticotropin Releasing Hormone Binding Protein (CRHBP) ELISA Kit

RDR-CRHBP-Ra-96Tests 96 Tests
EUR 811

Human Corticotropin Releasing Hormone Binding Protein (CRHBP) ELISA Kit

RD-CRHBP-Hu-48Tests 48 Tests
EUR 521

Human Corticotropin Releasing Hormone Binding Protein (CRHBP) ELISA Kit

RD-CRHBP-Hu-96Tests 96 Tests
EUR 723

Rat Corticotropin Releasing Hormone Binding Protein (CRHBP) ELISA Kit

RD-CRHBP-Ra-48Tests 48 Tests
EUR 557

Rat Corticotropin Releasing Hormone Binding Protein (CRHBP) ELISA Kit

RD-CRHBP-Ra-96Tests 96 Tests
EUR 775

Polyclonal CRHBP Antibody (N-term)

APR03753G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CRHBP (N-term). This antibody is tested and proven to work in the following applications:

CRHBP antibody

39014-100ul 100ul
EUR 252

CRHBP Conjugated Antibody

C39014 100ul
EUR 397

Anti-CRHBP antibody

STJ28651 100 µl
EUR 277
Description: Corticotropin-releasing hormone is a potent stimulator of synthesis and secretion of preopiomelanocortin-derived peptides. Although CRH concentrations in the human peripheral circulation are normally low, they increase throughout pregnancy and fall rapidly after parturition. Maternal plasma CRH probably originates from the placenta. Human plasma contains a CRH-binding protein which inactivates CRH and which may prevent inappropriate pituitary-adrenal stimulation in pregnancy.

Anti-CRHBP antibody

STJ114994 100 µl
EUR 277
Description: Corticotropin-releasing hormone is a potent stimulator of synthesis and secretion of preopiomelanocortin-derived peptides. Although CRH concentrations in the human peripheral circulation are normally low, they increase throughout pregnancy and fall rapidly after parturition. Maternal plasma CRH probably originates from the placenta. Human plasma contains a CRH-binding protein which inactivates CRH and which may prevent inappropriate pituitary-adrenal stimulation in pregnancy.

Anti-CRHBP antibody

STJ114995 100 µl
EUR 277
Description: Corticotropin-releasing hormone is a potent stimulator of synthesis and secretion of preopiomelanocortin-derived peptides. Although CRH concentrations in the human peripheral circulation are normally low, they increase throughout pregnancy and fall rapidly after parturition. Maternal plasma CRH probably originates from the placenta. Human plasma contains a CRH-binding protein which inactivates CRH and which may prevent inappropriate pituitary-adrenal stimulation in pregnancy.

Anti-CRHBP antibody

STJ192426 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CRHBP


ELA-E2166r 96 Tests
EUR 886

Crhbp/ Rat Crhbp ELISA Kit

ELI-06954r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA11083 50 ul
EUR 363
Description: Mouse polyclonal to CRHBP


YF-PA11084 50 ug
EUR 363
Description: Mouse polyclonal to CRHBP


YF-PA11085 100 ul
EUR 403
Description: Rabbit polyclonal to CRHBP


YF-PA11086 100 ug
EUR 403
Description: Rabbit polyclonal to CRHBP

CRHBP cloning plasmid

CSB-CL005964HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 969
  • Sequence: atgtcgcccaacttcaaacttcagtgtcacttcattctcatcttcctgacggctctaagaggggaaagccggtacctagagctgagggaagcggcggactacgatcctttcctgctcttcagcgccaacctgaagcgggagctggctggggagcagccgtaccgccgcgctctgcg
  • Show more
Description: A cloning plasmid for the CRHBP gene.

pBluescriptR-CRHBP Plasmid

PVT15850 2 ug
EUR 325

Anti-CRHBP (3D9)

YF-MA12529 100 ug
EUR 363
Description: Mouse monoclonal to CRHBP

Corticotropin Releasing Hormone Binding Protein (CRHBP) Polyclonal Antibody (Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRHBP (Tyr25~Leu322)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Corticotropin Releasing Hormone Binding Protein (CRHBP)

Corticotropin Releasing Hormone Binding Protein (CRHBP) Polyclonal Antibody (Rat), APC

  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRHBP (Tyr25~Leu322)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Corticotropin Releasing Hormone Binding Protein (CRHBP). This antibody is labeled with APC.

Corticotropin Releasing Hormone Binding Protein (CRHBP) Polyclonal Antibody (Rat), Biotinylated

  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRHBP (Tyr25~Leu322)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Corticotropin Releasing Hormone Binding Protein (CRHBP). This antibody is labeled with Biotin.

Corticotropin Releasing Hormone Binding Protein (CRHBP) Polyclonal Antibody (Rat), Cy3

  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRHBP (Tyr25~Leu322)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Corticotropin Releasing Hormone Binding Protein (CRHBP). This antibody is labeled with Cy3.

Corticotropin Releasing Hormone Binding Protein (CRHBP) Polyclonal Antibody (Rat), FITC

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRHBP (Tyr25~Leu322)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Corticotropin Releasing Hormone Binding Protein (CRHBP). This antibody is labeled with FITC.

Corticotropin Releasing Hormone Binding Protein (CRHBP) Polyclonal Antibody (Rat), HRP

  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRHBP (Tyr25~Leu322)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Corticotropin Releasing Hormone Binding Protein (CRHBP). This antibody is labeled with HRP.

Corticotropin Releasing Hormone Binding Protein (CRHBP) Polyclonal Antibody (Rat), PE

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRHBP (Tyr25~Leu322)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Corticotropin Releasing Hormone Binding Protein (CRHBP). This antibody is labeled with PE.


ELA-E2166h 96 Tests
EUR 824

Mouse Crhbp ELISA KIT

ELI-06952m 96 Tests
EUR 865


ELI-06953h 96 Tests
EUR 824


EF006208 96 Tests
EUR 689

Human CRHBP shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CRHBP protein (His tag)

80R-3690 100 ug
EUR 349
Description: Purified recombinant CRHBP protein (His tag)

Mouse CRHBP shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CRHBP Recombinant Protein (Human)

RP008008 100 ug Ask for price

CRHBP Recombinant Protein (Rat)

RP196286 100 ug Ask for price

CRHBP Recombinant Protein (Mouse)

RP126005 100 ug Ask for price

Rabbit Corticotropin Releasing Hormone Bingding Protein (CRHBP) ELISA Kit

abx363494-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Corticotropin releasing factor binding protein(CRHBP) ELISA kit

E04C2055-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Corticotropin releasing factor binding protein(CRHBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Corticotropin releasing factor binding protein(CRHBP) ELISA kit

E04C2055-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Corticotropin releasing factor binding protein(CRHBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Corticotropin releasing factor binding protein(CRHBP) ELISA kit

E04C2055-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Corticotropin releasing factor binding protein(CRHBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Corticotropin Releasing Hormone Binding Protein (CRHBP) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRHBP (Tyr25~Leu322)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Corticotropin Releasing Hormone Binding Protein (CRHBP). This antibody is labeled with APC-Cy7.

Corticotropin Releasing Hormone Binding Protein (CRHBP) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Corticotropin Releasing Hormone Bingding Protein (CRHBP) Antibody

abx145362-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Corticotropin Releasing Hormone Binding Protein (CRHBP) Antibody

  • EUR 356.00
  • EUR 913.00
  • EUR 467.00
  • EUR 154.00
  • EUR 272.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Corticotropin Releasing Hormone Bingding Protein (CRHBP) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Corticotropin Releasing Hormone Bingding Protein (CRHBP) Antibody

abx027081-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Corticotropin Releasing Hormone Bingding Protein (CRHBP) Antibody

abx027081-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Corticotropin Releasing Hormone Binding Protein (CRHBP) Antibody

  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Corticotropin Releasing Hormone Binding Protein (CRHBP) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

CRHBP ORF Vector (Human) (pORF)

ORF002670 1.0 ug DNA
EUR 95

Crhbp ORF Vector (Rat) (pORF)

ORF065430 1.0 ug DNA
EUR 506

Crhbp ORF Vector (Mouse) (pORF)

ORF042003 1.0 ug DNA
EUR 506

CRHBP ELISA Kit (Human) (OKCD08113)

OKCD08113 96 Wells
EUR 975
Description: Description of target: Purified Rabbit Polyclonal Antibody (Pab);Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 25.7pg/mL

CRHBP ELISA Kit (Rat) (OKCD08114)

OKCD08114 96 Wells
EUR 1053
Description: Description of target: Binds CRF and inactivates it. May prevent inappropriate pituitary-adrenal stimulation in pregnancy. ;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 6.3pg/mL

CRHBP ELISA Kit (Mouse) (OKCA02362)

OKCA02362 96 Wells
EUR 846
Description: Description of target: Binds CRF and inactivates it. May prevent inappropriate pituitary-adrenal stimulation in pregnancy. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 3.9 pg/mL

Crhbp ELISA Kit (Rat) (OKEH04789)

OKEH04789 96 Wells
EUR 662
Description: Description of target: Binds corticotropin releasing hormone and modulates CRH action; may act as a reservoir of endogenous CRH in the brain ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.084 ng/mL

CRHBP ELISA Kit (Human) (OKEH04790)

OKEH04790 96 Wells
EUR 662
Description: Description of target: Corticotropin-releasing hormone is a potent stimulator of synthesis and secretion of preopiomelanocortin-derived peptides. Although CRH concentrations in the human peripheral circulation are normally low, they increase throughout pregnancy and fall rapidly after parturition. Maternal plasma CRH probably originates from the placenta. Human plasma contains a CRH-binding protein which inactivates CRH and which may prevent inappropriate pituitary-adrenal stimulation in pregnancy.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 24 pg/mL

CRHBP ELISA Kit (Mouse) (OKEH05230)

OKEH05230 96 Wells
EUR 662
Description: Description of target: Binds CRF and inactivates it. May prevent inappropriate pituitary-adrenal stimulation in pregnancy. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.083 ng/mL

Corticotropin Releasing Hormone Binding Protein (CRHBP) Antibody (Biotin)

  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

CRHBP sgRNA CRISPR Lentivector set (Human)

K0506901 3 x 1.0 ug
EUR 339

Crhbp sgRNA CRISPR Lentivector set (Mouse)

K3331601 3 x 1.0 ug
EUR 339

Crhbp sgRNA CRISPR Lentivector set (Rat)

K6791001 3 x 1.0 ug
EUR 339

Corticotropin Releasing Hormone Binding Protein (CRHBP) Monoclonal Antibody (Rat)

  • EUR 268.00
  • EUR 2840.00
  • EUR 700.00
  • EUR 340.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Tyr25~Leu322
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Rat Corticotropin Releasing Hormone Binding Protein (CRHBP)

CRHBP sgRNA CRISPR Lentivector (Human) (Target 1)

K0506902 1.0 ug DNA
EUR 154

CRHBP sgRNA CRISPR Lentivector (Human) (Target 2)

K0506903 1.0 ug DNA
EUR 154

CRHBP sgRNA CRISPR Lentivector (Human) (Target 3)

K0506904 1.0 ug DNA
EUR 154

Crhbp sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3331602 1.0 ug DNA
EUR 154

Crhbp sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3331603 1.0 ug DNA
EUR 154

Crhbp sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3331604 1.0 ug DNA
EUR 154

Crhbp sgRNA CRISPR Lentivector (Rat) (Target 1)

K6791002 1.0 ug DNA
EUR 154

Crhbp sgRNA CRISPR Lentivector (Rat) (Target 2)

K6791003 1.0 ug DNA
EUR 154

Crhbp sgRNA CRISPR Lentivector (Rat) (Target 3)

K6791004 1.0 ug DNA
EUR 154

Recombinant Corticotropin Releasing Hormone Binding Protein (CRHBP)

  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 37.0kDa
  • Isoelectric Point: 6.0
Description: Recombinant Human Recombinant Corticotropin Releasing Hormone Binding Protein (CRHBP) expressed in: E.coli

Recombinant Corticotropin Releasing Hormone Binding Protein (CRHBP)

  • EUR 519.33
  • EUR 242.00
  • EUR 1672.48
  • EUR 624.16
  • EUR 1148.32
  • EUR 410.00
  • EUR 4031.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P24388
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 63.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Corticotropin Releasing Hormone Binding Protein expressed in: E.coli

Recombinant Human CRHBP Protein, His, E.coli-10ug

QP11503-10ug 10ug
EUR 201

Recombinant Human CRHBP Protein, His, E.coli-1mg

QP11503-1mg 1mg
EUR 5251

Recombinant Human CRHBP Protein, His, E.coli-2ug

QP11503-2ug 2ug
EUR 155

CRHBP Protein Vector (Human) (pPB-C-His)

PV010677 500 ng
EUR 329

CRHBP Protein Vector (Human) (pPB-N-His)

PV010678 500 ng
EUR 329

CRHBP Protein Vector (Human) (pPM-C-HA)

PV010679 500 ng
EUR 329

CRHBP Protein Vector (Human) (pPM-C-His)

PV010680 500 ng
EUR 329

CRHBP Protein Vector (Mouse) (pPB-C-His)

PV168010 500 ng
EUR 603

CRHBP Protein Vector (Mouse) (pPB-N-His)

PV168011 500 ng
EUR 603

CRHBP Protein Vector (Mouse) (pPM-C-HA)

PV168012 500 ng
EUR 603

CRHBP Protein Vector (Mouse) (pPM-C-His)

PV168013 500 ng
EUR 603

CRHBP Protein Vector (Rat) (pPB-C-His)

PV261718 500 ng
EUR 603

CRHBP Protein Vector (Rat) (pPB-N-His)

PV261719 500 ng
EUR 603

CRHBP Protein Vector (Rat) (pPM-C-HA)

PV261720 500 ng
EUR 603

CRHBP Protein Vector (Rat) (pPM-C-His)

PV261721 500 ng
EUR 603

Crhbp 3'UTR Luciferase Stable Cell Line

TU202789 1.0 ml Ask for price

Crhbp 3'UTR GFP Stable Cell Line

TU154361 1.0 ml Ask for price

CRHBP 3'UTR Luciferase Stable Cell Line

TU005012 1.0 ml
EUR 1394

CRHBP Rabbit Polyclonal Antibody