CNDP1 Rabbit Polyclonal Antibody

CNDP1 Rabbit Polyclonal Antibody

To Order Now:

CNDP1 Polyclonal Antibody
ES11310-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CNDP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
CNDP1 Polyclonal Antibody
ABP58202-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CNDP1 protein at amino acid sequence of 330-410
  • Applications tips:
Description: A polyclonal antibody for detection of CNDP1 from Human, Mouse, Rat. This CNDP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CNDP1 protein at amino acid sequence of 330-410
CNDP1 Polyclonal Antibody
ABP58202-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CNDP1 protein at amino acid sequence of 330-410
  • Applications tips:
Description: A polyclonal antibody for detection of CNDP1 from Human, Mouse, Rat. This CNDP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CNDP1 protein at amino acid sequence of 330-410
CNDP1 Polyclonal Antibody
ABP58202-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CNDP1 protein at amino acid sequence of 330-410
  • Applications tips:
Description: A polyclonal antibody for detection of CNDP1 from Human, Mouse, Rat. This CNDP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CNDP1 protein at amino acid sequence of 330-410
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
DLR-CNDP1-Hu-48T 48T
EUR 517
  • Should the Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carnosine Dipeptidase 1 (CNDP1) in samples from serum, plasma, cerebrospinal fluid or other biological fluids.
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
DLR-CNDP1-Hu-96T 96T
EUR 673
  • Should the Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carnosine Dipeptidase 1 (CNDP1) in samples from serum, plasma, cerebrospinal fluid or other biological fluids.
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
RDR-CNDP1-Hu-48Tests 48 Tests
EUR 544
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
RDR-CNDP1-Hu-96Tests 96 Tests
EUR 756
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
RD-CNDP1-Hu-48Tests 48 Tests
EUR 521
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
RD-CNDP1-Hu-96Tests 96 Tests
EUR 723
CNDP1 Rabbit pAb
A7485-100ul 100 ul
EUR 308
CNDP1 Rabbit pAb
A7485-200ul 200 ul
EUR 459
CNDP1 Rabbit pAb
A7485-20ul 20 ul
EUR 183
CNDP1 Rabbit pAb
A7485-50ul 50 ul
EUR 223
Polyclonal CNDP1 Antibody (Center)
APR04238G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CNDP1 (Center). This antibody is tested and proven to work in the following applications:
Polyclonal CNDP1 Antibody (Center)
APR04637G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CNDP1 (Center). This antibody is tested and proven to work in the following applications:
Polyclonal CNDP1 Antibody (C-term)
APR06148G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CNDP1 (C-term). This antibody is tested and proven to work in the following applications:
CNDP1 Antibody
36359-100ul 100ul
EUR 252
CNDP1 antibody
10R-3701 100 ul
EUR 691
Description: Mouse monoclonal CNDP1 antibody
CNDP1 antibody
70R-10125 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CNDP1 antibody
CNDP1 Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CNDP1. Recognizes CNDP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200
CNDP1 Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CNDP1. Recognizes CNDP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000
CNDP1 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CNDP1. Recognizes CNDP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200
CNDP1 Conjugated Antibody
C36359 100ul
EUR 397
anti- CNDP1 antibody
FNab01794 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IF: 1:20-1:200
  • Immunogen: carnosine dipeptidase 1(metallopeptidase M20 family)
  • Uniprot ID: Q96KN2
  • Gene ID: 84735
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against CNDP1
Anti-CNDP1 antibody
PAab01794 100 ug
EUR 355
Anti-CNDP1 antibody
STJ29621 100 µl
EUR 277
Description: This gene encodes a member of the M20 metalloprotease family. The encoded protein is specifically expressed in the brain, is a homodimeric dipeptidase which was identified as human carnosinase. This gene contains trinucleotide (CTG) repeat length polymorphism in the coding region.
Anti-CNDP1 antibody
STJ192468 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CNDP1
Cndp1/ Rat Cndp1 ELISA Kit
ELI-03928r 96 Tests
EUR 886
Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human)
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNDP1 (Asp332~His507)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1)
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CNDP1 protein
80R-4374 50 ug
EUR 457
Description: Purified Recombinant CNDP1 protein (His tagged)
YF-PA21472 50 ug
EUR 363
Description: Mouse polyclonal to CNDP1
YF-PA21473 100 ul
EUR 403
Description: Rabbit polyclonal to CNDP1
YF-PA21474 100 ug
EUR 403
Description: Rabbit polyclonal to CNDP1
Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNDP1 (Asp332~His507)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with APC.
Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), Biotinylated
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNDP1 (Asp332~His507)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with Biotin.
Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNDP1 (Asp332~His507)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with Cy3.
Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNDP1 (Asp332~His507)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with FITC.
Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNDP1 (Asp332~His507)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with HRP.
Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNDP1 (Asp332~His507)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with PE.
CNDP1 Blocking Peptide
33R-3591 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CNDP1 antibody, catalog no. 70R-10125
CNDP1 cloning plasmid
CSB-CL836242HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 933
  • Sequence: atggaagaggctggctctgttgccctggaggaacttgtggaaaaagaaaaggaccgattcttctctggtgtggactacattgtaatttcagataacctgtggatcagccaaaggaagccagcaatcacttatggaacccgggggaacagctacttcatggtggaggtgaaatgcag
  • Show more
Description: A cloning plasmid for the CNDP1 gene.
CNDP1 cloning plasmid
CSB-CL836242HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1527
  • Sequence: atggatcccaaactcgggagaatggctgcgtccctgctggctgtgctgctgctgctgctgctggagcgcggcatgttctcctcaccctccccgcccccggcgctgttagagaaagtcttccagtacattgacctccatcaggatgaatttgtgcagacgctgaaggagtgggtgg
  • Show more
Description: A cloning plasmid for the CNDP1 gene.
CNDP1 cloning plasmid
CSB-CL836242HU3-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1524
  • Sequence: atggatcccaaactcgggagaatggctgcgtccctgctggctgtgctgctgctgctgctggagcgcggcatgttctcctcaccctccccgcccccggcgctgttagagaaagtcttccagtacattgacctccatcaggatgaatttgtgcagacgctgaaggagtgggtggcca
  • Show more
Description: A cloning plasmid for the CNDP1 gene.
Carnosine Dipeptidase 1 (CNDP1) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Carnosine Dipeptidase 1 (CNDP1) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNDP1 (Asp332~His507)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with APC-Cy7.
Rabbit β Ala His dipeptidase(CNDP1) ELISA kit
E04B0887-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit β Ala His dipeptidase(CNDP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit β Ala His dipeptidase(CNDP1) ELISA kit
E04B0887-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit β Ala His dipeptidase(CNDP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit β Ala His dipeptidase(CNDP1) ELISA kit
E04B0887-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit β Ala His dipeptidase(CNDP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Beta-Ala-His Dipeptidase (CNDP1) Antibody
abx145510-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Beta-Ala-His Dipeptidase (CNDP1) Antibody
abx145513-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Beta-Ala-His Dipeptidase (CNDP1) Antibody
abx034256-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Beta-Ala-His Dipeptidase (CNDP1) Antibody
abx034256-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Beta-Ala-His Dipeptidase (CNDP1) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Beta-Ala-His Dipeptidase (CNDP1) Antibody
abx029702-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Beta-Ala-His Dipeptidase (CNDP1) Antibody
abx029702-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Beta-Ala-His Dipeptidase (CNDP1) Antibody
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Beta-Ala-His Dipeptidase (CNDP1) Antibody
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Beta-Ala-His Dipeptidase (CNDP1) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Beta-Ala-His Dipeptidase (CNDP1) Antibody
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Beta-Ala-His Dipeptidase (CNDP1) Antibody
abx231794-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Rat CNDP1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse CNDP1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human CNDP1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ELA-E1190h 96 Tests
EUR 824
EF004193 96 Tests
EUR 689
CNDP1 Recombinant Protein (Human)
RP038161 100 ug Ask for price
CNDP1 Recombinant Protein (Human)
RP038164 100 ug Ask for price
CNDP1 Recombinant Protein (Human)
RP007471 100 ug Ask for price
CNDP1 Recombinant Protein (Rat)
RP195557 100 ug Ask for price
CNDP1 Recombinant Protein (Mouse)
RP124946 100 ug Ask for price
Human CNDP1 PicoKine ELISA Kit
EK1957 96 wells
EUR 425
Description: For quantitative detection of human CNDP1 in cell culture supernates, serum and plasma (heparin, EDTA).
CNDP1 ORF Vector (Human) (pORF)
ORF002491 1.0 ug DNA
EUR 95
Human CellExp? CNDP1, Human recombinant
EUR 207
Human CellExp? CNDP1, Human recombinant
EUR 838
Cndp1 ORF Vector (Rat) (pORF)
ORF065187 1.0 ug DNA
EUR 506
Cndp1 ORF Vector (Mouse) (pORF)
ORF041650 1.0 ug DNA
EUR 506
CNDP1 ORF Vector (Human) (pORF)
ORF012721 1.0 ug DNA
EUR 354
CNDP1 ORF Vector (Human) (pORF)
ORF012722 1.0 ug DNA
EUR 354
Recombinant Carnosine Dipeptidase 1 (CNDP1)
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q96KN2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 23.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Carnosine Dipeptidase 1 expressed in: E.coli
CNDP1 ELISA Kit (Human) (OKAN05716)
OKAN05716 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the M20 metalloprotease family. The encoded protein is specifically expressed in the brain, is a homodimeric dipeptidase which was identified as human carnosinase. This gene contains trinucleotide (CTG) repeat length polymorphism in the coding region.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.064 ng/mL
CNDP1 ELISA Kit (Human) (OKCD08784)
OKCD08784 96 Wells
EUR 975
Description: Description of target: CNDP1 is a member of the M20 metalloprotease family. The protein is specifically expressed in the brain, is a homodimeric dipeptidase which was identified as human carnosinase. CNDP1 gene contains trinucleotide (CTG) repeat length polymorphism in the coding region.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.064ng/mL
CNDP1 ELISA Kit (Human) (OKEH00851)
OKEH00851 96 Wells
EUR 662
Description: Description of target: This gene encodes a member of the M20 metalloprotease family. The encoded protein is specifically expressed in the brain, is a homodimeric dipeptidase which was identified as human carnosinase. This gene contains trinucleotide (CTG) repeat length polymorphism in the coding region.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL
CNDP1 ELISA Kit (Human) (OKBB01334)
OKBB01334 96 Wells
EUR 505
Description: Description of target: Beta-Ala-His dipeptidase is an enzyme that in humans is encoded by the CNDP1 gene. It is mapped to 18q22.3. This gene encodes a member of the M20 metalloprotease family. The encoded protein is specifically expressed in the brain, is a homodimeric dipeptidase which was identified as human carnosinase. This gene contains trinucleotide (CTG) repeat length polymorphism in the coding region.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml
CNDP1 ELISA Kit (Mouse) (OKEH05624)
OKEH05624 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.43 ng/mL
CNDP1 ELISA Kit (Rat) (OKEH06209)
OKEH06209 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.401 ng/mL
CNDP1 sgRNA CRISPR Lentivector set (Human)
K0474101 3 x 1.0 ug
EUR 339
Human Carnosine Dipeptidase 1 (CNDP1) Protein
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Cndp1 sgRNA CRISPR Lentivector set (Mouse)
K3698401 3 x 1.0 ug
EUR 339
Cndp1 sgRNA CRISPR Lentivector set (Rat)
K7238601 3 x 1.0 ug
EUR 339
CNDP1 CNDP Dipeptidase 1 HumanRecombinant Protein
PROTQ96KN2 Regular: 10ug
EUR 317
Description: CNDP1 produced in Sf9 Insect cells is a single, glycosylated polypeptide chain containing 489 amino acids (27-507a.a.) and having a molecular mass of 54.9kDa. (Molecular size on SDS-PAGE will appear at approximately 50-70kDa).;CNDP1 is expressed with an 8 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.
CNDP1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0474102 1.0 ug DNA
EUR 154
CNDP1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0474103 1.0 ug DNA
EUR 154
CNDP1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0474104 1.0 ug DNA
EUR 154
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Carnosine Dipeptidase 1 (CNDP1) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Cndp1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3698402 1.0 ug DNA
EUR 154
Cndp1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3698403 1.0 ug DNA
EUR 154
Cndp1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3698404 1.0 ug DNA
EUR 154
Cndp1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7238602 1.0 ug DNA
EUR 154
Cndp1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7238603 1.0 ug DNA
EUR 154
Cndp1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7238604 1.0 ug DNA
EUR 154
CNDP1 Protein Vector (Human) (pPB-C-His)
PV050881 500 ng
EUR 481
CNDP1 Protein Vector (Human) (pPB-N-His)
PV050882 500 ng
EUR 481
CNDP1 Protein Vector (Human) (pPM-C-HA)
PV050883 500 ng
EUR 481
CNDP1 Protein Vector (Human) (pPM-C-His)
PV050884 500 ng
EUR 481
CNDP1 Protein Vector (Human) (pPB-C-His)
PV050885 500 ng
EUR 481
CNDP1 Protein Vector (Human) (pPB-N-His)
PV050886 500 ng
EUR 481
CNDP1 Protein Vector (Human) (pPM-C-HA)
PV050887 500 ng
EUR 481
CNDP1 Protein Vector (Human) (pPM-C-His)
PV050888 500 ng
EUR 481
CNDP1 Protein Vector (Mouse) (pPB-C-His)
PV166598 500 ng
EUR 603
CNDP1 Protein Vector (Mouse) (pPB-N-His)
PV166599 500 ng
EUR 603
CNDP1 Protein Vector (Mouse) (pPM-C-HA)
PV166600 500 ng
EUR 603
CNDP1 Protein Vector (Mouse) (pPM-C-His)
PV166601 500 ng
EUR 603
Human Carnosine Dipeptidase 1 ELISA Kit (CNDP1)
RK01137 96 Tests
EUR 521
Human Carnosine Dipeptidase 1(CNDP1)ELISA Kit
QY-E03019 96T
EUR 400
Recombinant Human CNDP1 Protein, His, Insect-1mg
QP11466-1mg 1mg
EUR 5251
Recombinant Mouse CNDP1 Protein, His, Insect-10ug
QP11467-10ug 10ug
EUR 201
Recombinant Mouse CNDP1 Protein, His, Insect-1mg
QP11467-1mg 1mg
EUR 5251
Recombinant Mouse CNDP1 Protein, His, Insect-2ug
QP11467-2ug 2ug
EUR 155
Recombinant Human CNDP1 Protein, His, Insect-100ug
QP10557-100ug 100ug
EUR 1261
Recombinant Human CNDP1 Protein, His, Insect-10ug
QP10557-10ug 10ug
EUR 201
Recombinant Human CNDP1 Protein, His, Insect-2ug
QP10557-2ug 2ug
EUR 155
CNDP1 CNDP Dipeptidase 1 Mouse Recombinant Protein
PROTQ8BUG2 Regular: 10ug
EUR 317
Description: CNDP1 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 500 amino acids (1-492 a.a.) and having a molecular mass of 56.1kDa (Molecular size on SDS-PAGE will appear at approximately 50-70kDa). CNDP1 is expressed with an 8 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.
CNDP1 Protein Vector (Human) (pPB-C-His)
PV009961 500 ng
EUR 329
CNDP1 Protein Vector (Human) (pPB-N-His)
PV009962 500 ng
EUR 329
CNDP1 Protein Vector (Human) (pPM-C-HA)
PV009963 500 ng
EUR 329
CNDP1 Protein Vector (Human) (pPM-C-His)
PV009964 500 ng
EUR 329
CNDP1 Protein Vector (Rat) (pPB-C-His)
PV260746 500 ng
EUR 603
CNDP1 Protein Vector (Rat) (pPB-N-His)
PV260747 500 ng
EUR 603
CNDP1 Protein Vector (Rat) (pPM-C-HA)
PV260748 500 ng
EUR 603
CNDP1 Protein Vector (Rat) (pPM-C-His)
PV260749 500 ng
EUR 603
Cndp1 3'UTR Luciferase Stable Cell Line
TU202532 1.0 ml Ask for price
Cndp1 3'UTR GFP Stable Cell Line
TU154085 1.0 ml Ask for price
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
SEF388Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carnosine Dipeptidase 1 (CNDP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carnosine Dipeptidase 1 (CNDP1) in serum, plasma, cerebrospinal fluid and other biological fluids.
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
SEF388Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carnosine Dipeptidase 1 (CNDP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carnosine Dipeptidase 1 (CNDP1) in serum, plasma, cerebrospinal fluid and other biological fluids.
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
SEF388Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carnosine Dipeptidase 1 (CNDP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carnosine Dipeptidase 1 (CNDP1) in serum, plasma, cerebrospinal fluid and other biological fluids.
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
SEF388Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carnosine Dipeptidase 1 (CNDP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carnosine Dipeptidase 1 (CNDP1) in serum, plasma, cerebrospinal fluid and other biological fluids.
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Carnosine Dipeptidase 1 elisa. Alternative names of the recognized antigen: CN1
  • CPGL2
  • Beta-Ala-His Dipeptidase
  • Metallopeptidase M20
  • Carnosinase 1
  • Serum carnosinase
  • Glutamate Carboxypeptidase-Like Protein 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Carnosine Dipeptidase 1 (CNDP1) in samples from Serum, plasma, cerebrospinal fluid and other biological fluids with no significant corss-reactivity with analogues from other species.
CNDP1 3'UTR Luciferase Stable Cell Line
TU004673 1.0 ml
EUR 1394
Cndp1 3'UTR Luciferase Stable Cell Line
TU104085 1.0 ml Ask for price
CNDP1 3'UTR GFP Stable Cell Line
TU054673 1.0 ml
EUR 1394
Cndp1 3'UTR GFP Stable Cell Line
TU252532 1.0 ml Ask for price
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

CNDP1 Rabbit Polyclonal Antibody