CNDP1 Rabbit Polyclonal Antibody
CNDP1 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
CNDP1 Polyclonal Antibody |
ABP58202-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human CNDP1 protein at amino acid sequence of 330-410
- Applications tips:
|
Description: A polyclonal antibody for detection of CNDP1 from Human, Mouse, Rat. This CNDP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CNDP1 protein at amino acid sequence of 330-410 |
CNDP1 Polyclonal Antibody |
ABP58202-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CNDP1 protein at amino acid sequence of 330-410
- Applications tips:
|
Description: A polyclonal antibody for detection of CNDP1 from Human, Mouse, Rat. This CNDP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CNDP1 protein at amino acid sequence of 330-410 |
CNDP1 Polyclonal Antibody |
ES11310-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CNDP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CNDP1 Polyclonal Antibody |
ES11310-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CNDP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit |
DLR-CNDP1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carnosine Dipeptidase 1 (CNDP1) in samples from serum, plasma, cerebrospinal fluid or other biological fluids. |
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit |
DLR-CNDP1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carnosine Dipeptidase 1 (CNDP1) in samples from serum, plasma, cerebrospinal fluid or other biological fluids. |
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit |
RDR-CNDP1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit |
RDR-CNDP1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit |
RD-CNDP1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit |
RD-CNDP1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
CNDP1 Rabbit pAb |
A7485-100ul |
Abclonal |
100 ul |
EUR 308 |
CNDP1 Rabbit pAb |
A7485-200ul |
Abclonal |
200 ul |
EUR 459 |
CNDP1 Rabbit pAb |
A7485-20ul |
Abclonal |
20 ul |
EUR 183 |
CNDP1 Rabbit pAb |
A7485-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal CNDP1 Antibody (Center) |
APR04238G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CNDP1 (Center). This antibody is tested and proven to work in the following applications: |
Polyclonal CNDP1 Antibody (Center) |
APR04637G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CNDP1 (Center). This antibody is tested and proven to work in the following applications: |
CNDP1 antibody |
70R-10125 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal CNDP1 antibody |
CNDP1 Antibody |
36359-100ul |
SAB |
100ul |
EUR 252 |
CNDP1 antibody |
10R-3701 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal CNDP1 antibody |
CNDP1 Antibody |
1-CSB-PA836242ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against CNDP1. Recognizes CNDP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
CNDP1 Antibody |
1-CSB-PA836242ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against CNDP1. Recognizes CNDP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000 |
CNDP1 Antibody |
1-CSB-PA439589 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CNDP1. Recognizes CNDP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
Polyclonal CNDP1 Antibody (C-term) |
APR06148G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CNDP1 (C-term). This antibody is tested and proven to work in the following applications: |
CNDP1 Conjugated Antibody |
C36359 |
SAB |
100ul |
EUR 397 |
anti- CNDP1 antibody |
FNab01794 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500-1:1000
- IF: 1:20-1:200
- Immunogen: carnosine dipeptidase 1(metallopeptidase M20 family)
- Uniprot ID: Q96KN2
- Gene ID: 84735
- Research Area: Cardiovascular, Metabolism
|
Description: Antibody raised against CNDP1 |
Anti-CNDP1 antibody |
STJ29621 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the M20 metalloprotease family. The encoded protein is specifically expressed in the brain, is a homodimeric dipeptidase which was identified as human carnosinase. This gene contains trinucleotide (CTG) repeat length polymorphism in the coding region. |
Anti-CNDP1 antibody |
STJ192468 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to CNDP1 |
Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human) |
4-PAF388Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNDP1 (Asp332~His507)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1) |
CNDP1 protein |
80R-4374 |
Fitzgerald |
50 ug |
EUR 457 |
Description: Purified Recombinant CNDP1 protein (His tagged) |
CNDP1 siRNA |
20-abx901140 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CNDP1 siRNA |
20-abx912223 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CNDP1 siRNA |
20-abx912224 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-CNDP1 |
YF-PA21472 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to CNDP1 |
anti-CNDP1 |
YF-PA21473 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to CNDP1 |
anti-CNDP1 |
YF-PA21474 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to CNDP1 |
Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), APC |
4-PAF388Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNDP1 (Asp332~His507)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with APC. |
Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), Biotinylated |
4-PAF388Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNDP1 (Asp332~His507)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with Biotin. |
Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), Cy3 |
4-PAF388Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNDP1 (Asp332~His507)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with Cy3. |
Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), FITC |
4-PAF388Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNDP1 (Asp332~His507)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with FITC. |
Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), HRP |
4-PAF388Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNDP1 (Asp332~His507)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with HRP. |
Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), PE |
4-PAF388Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNDP1 (Asp332~His507)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with PE. |
CNDP1 Blocking Peptide |
33R-3591 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CNDP1 antibody, catalog no. 70R-10125 |
CNDP1 cloning plasmid |
CSB-CL836242HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 933
- Sequence: atggaagaggctggctctgttgccctggaggaacttgtggaaaaagaaaaggaccgattcttctctggtgtggactacattgtaatttcagataacctgtggatcagccaaaggaagccagcaatcacttatggaacccgggggaacagctacttcatggtggaggtgaaatgcag
- Show more
|
Description: A cloning plasmid for the CNDP1 gene. |
CNDP1 cloning plasmid |
CSB-CL836242HU2-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1527
- Sequence: atggatcccaaactcgggagaatggctgcgtccctgctggctgtgctgctgctgctgctgctggagcgcggcatgttctcctcaccctccccgcccccggcgctgttagagaaagtcttccagtacattgacctccatcaggatgaatttgtgcagacgctgaaggagtgggtgg
- Show more
|
Description: A cloning plasmid for the CNDP1 gene. |
CNDP1 cloning plasmid |
CSB-CL836242HU3-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1524
- Sequence: atggatcccaaactcgggagaatggctgcgtccctgctggctgtgctgctgctgctgctggagcgcggcatgttctcctcaccctccccgcccccggcgctgttagagaaagtcttccagtacattgacctccatcaggatgaatttgtgcagacgctgaaggagtgggtggcca
- Show more
|
Description: A cloning plasmid for the CNDP1 gene. |
Carnosine Dipeptidase 1 (CNDP1) Antibody |
20-abx128272 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Carnosine Dipeptidase 1 (CNDP1) Antibody |
20-abx171590 |
Abbexa |
|
|
|
Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAF388Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNDP1 (Asp332~His507)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with APC-Cy7. |
Rabbit β Ala His dipeptidase(CNDP1) ELISA kit |
E04B0887-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit β Ala His dipeptidase(CNDP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit β Ala His dipeptidase(CNDP1) ELISA kit |
E04B0887-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit β Ala His dipeptidase(CNDP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit β Ala His dipeptidase(CNDP1) ELISA kit |
E04B0887-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit β Ala His dipeptidase(CNDP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Beta-Ala-His Dipeptidase (CNDP1) Antibody |
20-abx006984 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Beta-Ala-His Dipeptidase (CNDP1) Antibody |
abx145510-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Beta-Ala-His Dipeptidase (CNDP1) Antibody |
abx145513-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Beta-Ala-His Dipeptidase (CNDP1) Antibody |
abx029702-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Beta-Ala-His Dipeptidase (CNDP1) Antibody |
abx029702-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Beta-Ala-His Dipeptidase (CNDP1) Antibody |
abx034256-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Beta-Ala-His Dipeptidase (CNDP1) Antibody |
abx034256-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Beta-Ala-His Dipeptidase (CNDP1) Antibody |
20-abx242083 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Beta-Ala-His Dipeptidase (CNDP1) Antibody |
20-abx321533 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Beta-Ala-His Dipeptidase (CNDP1) Antibody |
20-abx321603 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Beta-Ala-His Dipeptidase (CNDP1) Antibody |
20-abx225117 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Beta-Ala-His Dipeptidase (CNDP1) Antibody |
abx231794-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Rat CNDP1 shRNA Plasmid |
20-abx989428 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse CNDP1 shRNA Plasmid |
20-abx983699 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human CNDP1 shRNA Plasmid |
20-abx963606 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CNDP1 Recombinant Protein (Human) |
RP038161 |
ABM |
100 ug |
Ask for price |
CNDP1 Recombinant Protein (Human) |
RP038164 |
ABM |
100 ug |
Ask for price |
CNDP1 Recombinant Protein (Human) |
RP007471 |
ABM |
100 ug |
Ask for price |
CNDP1 Recombinant Protein (Rat) |
RP195557 |
ABM |
100 ug |
Ask for price |
CNDP1 Recombinant Protein (Mouse) |
RP124946 |
ABM |
100 ug |
Ask for price |
Human CNDP1 PicoKine ELISA Kit |
EK1957 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human CNDP1 in cell culture supernates, serum and plasma (heparin, EDTA). |
Human CellExp? CNDP1, Human recombinant |
P1125-10 |
Biovision |
|
EUR 207 |
Human CellExp? CNDP1, Human recombinant |
P1125-50 |
Biovision |
|
EUR 838 |
Cndp1 ORF Vector (Rat) (pORF) |
ORF065187 |
ABM |
1.0 ug DNA |
EUR 506 |
CNDP1 ORF Vector (Human) (pORF) |
ORF002491 |
ABM |
1.0 ug DNA |
EUR 95 |
CNDP1 ORF Vector (Human) (pORF) |
ORF012721 |
ABM |
1.0 ug DNA |
EUR 354 |
CNDP1 ORF Vector (Human) (pORF) |
ORF012722 |
ABM |
1.0 ug DNA |
EUR 354 |
Cndp1 ORF Vector (Mouse) (pORF) |
ORF041650 |
ABM |
1.0 ug DNA |
EUR 506 |
Recombinant Carnosine Dipeptidase 1 (CNDP1) |
4-RPF388Hu01 |
Cloud-Clone |
-
EUR 467.36
-
EUR 228.00
-
EUR 1477.60
-
EUR 559.20
-
EUR 1018.40
-
EUR 376.00
-
EUR 3544.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q96KN2
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 23.6kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Carnosine Dipeptidase 1 expressed in: E.coli |
CNDP1 ELISA Kit (Human) (OKAN05716) |
OKAN05716 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes a member of the M20 metalloprotease family. The encoded protein is specifically expressed in the brain, is a homodimeric dipeptidase which was identified as human carnosinase. This gene contains trinucleotide (CTG) repeat length polymorphism in the coding region.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.064 ng/mL |
CNDP1 ELISA Kit (Human) (OKBB01334) |
OKBB01334 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Beta-Ala-His dipeptidase is an enzyme that in humans is encoded by the CNDP1 gene. It is mapped to 18q22.3. This gene encodes a member of the M20 metalloprotease family. The encoded protein is specifically expressed in the brain, is a homodimeric dipeptidase which was identified as human carnosinase. This gene contains trinucleotide (CTG) repeat length polymorphism in the coding region.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml |
CNDP1 ELISA Kit (Human) (OKCD08784) |
OKCD08784 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: CNDP1 is a member of the M20 metalloprotease family. The protein is specifically expressed in the brain, is a homodimeric dipeptidase which was identified as human carnosinase. CNDP1 gene contains trinucleotide (CTG) repeat length polymorphism in the coding region.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.064ng/mL |
CNDP1 ELISA Kit (Human) (OKEH00851) |
OKEH00851 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: This gene encodes a member of the M20 metalloprotease family. The encoded protein is specifically expressed in the brain, is a homodimeric dipeptidase which was identified as human carnosinase. This gene contains trinucleotide (CTG) repeat length polymorphism in the coding region.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL |
CNDP1 ELISA Kit (Mouse) (OKEH05624) |
OKEH05624 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.43 ng/mL |
CNDP1 ELISA Kit (Rat) (OKEH06209) |
OKEH06209 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.401 ng/mL |
Human Carnosine Dipeptidase 1 (CNDP1) Protein |
20-abx166606 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
CNDP1 sgRNA CRISPR Lentivector set (Human) |
K0474101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cndp1 sgRNA CRISPR Lentivector set (Rat) |
K7238601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cndp1 sgRNA CRISPR Lentivector set (Mouse) |
K3698401 |
ABM |
3 x 1.0 ug |
EUR 339 |
CNDP1 CNDP Dipeptidase 1 HumanRecombinant Protein |
PROTQ96KN2 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: CNDP1 produced in Sf9 Insect cells is a single, glycosylated polypeptide chain containing 489 amino acids (27-507a.a.) and having a molecular mass of 54.9kDa. (Molecular size on SDS-PAGE will appear at approximately 50-70kDa).;CNDP1 is expressed with an 8 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques. |
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit |
20-abx151101 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Carnosine Dipeptidase 1 (CNDP1) CLIA Kit |
20-abx494890 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
CNDP1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0474102 |
ABM |
1.0 ug DNA |
EUR 154 |
CNDP1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0474103 |
ABM |
1.0 ug DNA |
EUR 154 |
CNDP1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0474104 |
ABM |
1.0 ug DNA |
EUR 154 |
Cndp1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7238602 |
ABM |
1.0 ug DNA |
EUR 154 |
Cndp1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7238603 |
ABM |
1.0 ug DNA |
EUR 154 |
Cndp1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7238604 |
ABM |
1.0 ug DNA |
EUR 154 |
Cndp1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3698402 |
ABM |
1.0 ug DNA |
EUR 154 |
Cndp1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3698403 |
ABM |
1.0 ug DNA |
EUR 154 |
Cndp1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3698404 |
ABM |
1.0 ug DNA |
EUR 154 |
CNDP1 CNDP Dipeptidase 1 Mouse Recombinant Protein |
PROTQ8BUG2 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: CNDP1 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 500 amino acids (1-492 a.a.) and having a molecular mass of 56.1kDa (Molecular size on SDS-PAGE will appear at approximately 50-70kDa). CNDP1 is expressed with an 8 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques. |
CNDP1 Protein Vector (Mouse) (pPB-C-His) |
PV166598 |
ABM |
500 ng |
EUR 603 |
CNDP1 Protein Vector (Mouse) (pPB-N-His) |
PV166599 |
ABM |
500 ng |
EUR 603 |
CNDP1 Protein Vector (Mouse) (pPM-C-HA) |
PV166600 |
ABM |
500 ng |
EUR 603 |
CNDP1 Protein Vector (Mouse) (pPM-C-His) |
PV166601 |
ABM |
500 ng |
EUR 603 |
CNDP1 Protein Vector (Rat) (pPB-C-His) |
PV260746 |
ABM |
500 ng |
EUR 603 |
CNDP1 Protein Vector (Rat) (pPB-N-His) |
PV260747 |
ABM |
500 ng |
EUR 603 |
CNDP1 Protein Vector (Rat) (pPM-C-HA) |
PV260748 |
ABM |
500 ng |
EUR 603 |
CNDP1 Protein Vector (Rat) (pPM-C-His) |
PV260749 |
ABM |
500 ng |
EUR 603 |
CNDP1 Protein Vector (Human) (pPB-C-His) |
PV050881 |
ABM |
500 ng |
EUR 481 |
CNDP1 Protein Vector (Human) (pPB-N-His) |
PV050882 |
ABM |
500 ng |
EUR 481 |
CNDP1 Protein Vector (Human) (pPM-C-HA) |
PV050883 |
ABM |
500 ng |
EUR 481 |
CNDP1 Protein Vector (Human) (pPM-C-His) |
PV050884 |
ABM |
500 ng |
EUR 481 |
CNDP1 Protein Vector (Human) (pPB-C-His) |
PV050885 |
ABM |
500 ng |
EUR 481 |
CNDP1 Protein Vector (Human) (pPB-N-His) |
PV050886 |
ABM |
500 ng |
EUR 481 |
CNDP1 Protein Vector (Human) (pPM-C-HA) |
PV050887 |
ABM |
500 ng |
EUR 481 |
CNDP1 Protein Vector (Human) (pPM-C-His) |
PV050888 |
ABM |
500 ng |
EUR 481 |
Human Carnosine Dipeptidase 1 ELISA Kit (CNDP1) |
RK01137 |
Abclonal |
96 Tests |
EUR 521 |
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit |
SEF388Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carnosine Dipeptidase 1 (CNDP1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carnosine Dipeptidase 1 (CNDP1) in serum, plasma, cerebrospinal fluid and other biological fluids. |
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit |
SEF388Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carnosine Dipeptidase 1 (CNDP1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carnosine Dipeptidase 1 (CNDP1) in serum, plasma, cerebrospinal fluid and other biological fluids. |
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit |
SEF388Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carnosine Dipeptidase 1 (CNDP1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carnosine Dipeptidase 1 (CNDP1) in serum, plasma, cerebrospinal fluid and other biological fluids. |
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit |
SEF388Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carnosine Dipeptidase 1 (CNDP1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carnosine Dipeptidase 1 (CNDP1) in serum, plasma, cerebrospinal fluid and other biological fluids. |
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit |
4-SEF388Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Carnosine Dipeptidase 1 elisa. Alternative names of the recognized antigen: CN1
- CPGL2
- Beta-Ala-His Dipeptidase
- Metallopeptidase M20
- Carnosinase 1
- Serum carnosinase
- Glutamate Carboxypeptidase-Like Protein 2
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Carnosine Dipeptidase 1 (CNDP1) in samples from Serum, plasma, cerebrospinal fluid and other biological fluids with no significant corss-reactivity with analogues from other species. |
CNDP1 Protein Vector (Human) (pPB-C-His) |
PV009961 |
ABM |
500 ng |
EUR 329 |
CNDP1 Protein Vector (Human) (pPB-N-His) |
PV009962 |
ABM |
500 ng |
EUR 329 |
CNDP1 Protein Vector (Human) (pPM-C-HA) |
PV009963 |
ABM |
500 ng |
EUR 329 |
CNDP1 Protein Vector (Human) (pPM-C-His) |
PV009964 |
ABM |
500 ng |
EUR 329 |
Recombinant Human CNDP1 Protein, His, Insect-1mg |
QP11466-1mg |
EnQuireBio |
1mg |
EUR 5251 |
Recombinant Mouse CNDP1 Protein, His, Insect-10ug |
QP11467-10ug |
EnQuireBio |
10ug |
EUR 201 |
Recombinant Mouse CNDP1 Protein, His, Insect-1mg |
QP11467-1mg |
EnQuireBio |
1mg |
EUR 5251 |
Recombinant Mouse CNDP1 Protein, His, Insect-2ug |
QP11467-2ug |
EnQuireBio |
2ug |
EUR 155 |
Recombinant Human CNDP1 Protein, His, Insect-100ug |
QP10557-100ug |
EnQuireBio |
100ug |
EUR 1261 |
Recombinant Human CNDP1 Protein, His, Insect-10ug |
QP10557-10ug |
EnQuireBio |
10ug |
EUR 201 |
Recombinant Human CNDP1 Protein, His, Insect-2ug |
QP10557-2ug |
EnQuireBio |
2ug |
EUR 155 |
Cndp1 3'UTR GFP Stable Cell Line |
TU154085 |
ABM |
1.0 ml |
Ask for price |
Cndp1 3'UTR Luciferase Stable Cell Line |
TU104085 |
ABM |
1.0 ml |
Ask for price |
Cndp1 3'UTR Luciferase Stable Cell Line |
TU202532 |
ABM |
1.0 ml |
Ask for price |
Cndp1 3'UTR GFP Stable Cell Line |
TU252532 |
ABM |
1.0 ml |
Ask for price |
CNDP1 3'UTR GFP Stable Cell Line |
TU054673 |
ABM |
1.0 ml |
EUR 1394 |
CNDP1 3'UTR Luciferase Stable Cell Line |
TU004673 |
ABM |
1.0 ml |
EUR 1394 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
CNDP1 Rabbit Polyclonal Antibody