LDB3 Rabbit Polyclonal Antibody

LDB3 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

LDB3 Polyclonal Antibody
30932-50ul 50ul
EUR 187
LDB3 Polyclonal Antibody
ABP59101-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human LDB3 protein at amino acid sequence of 41-90
  • Applications tips:
Description: A polyclonal antibody for detection of LDB3 from Human, Mouse. This LDB3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LDB3 protein at amino acid sequence of 41-90
LDB3 Polyclonal Antibody
ABP59101-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human LDB3 protein at amino acid sequence of 41-90
  • Applications tips:
Description: A polyclonal antibody for detection of LDB3 from Human, Mouse. This LDB3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LDB3 protein at amino acid sequence of 41-90
LDB3 Polyclonal Antibody
ABP59101-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human LDB3 protein at amino acid sequence of 41-90
  • Applications tips:
Description: A polyclonal antibody for detection of LDB3 from Human, Mouse. This LDB3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LDB3 protein at amino acid sequence of 41-90
LDB3 Polyclonal Antibody
ES11419-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against LDB3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
LDB3 Polyclonal Antibody
ES11419-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LDB3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
LDB3 Rabbit pAb
A7462-100ul 100 ul
EUR 308
LDB3 Rabbit pAb
A7462-200ul 200 ul
EUR 459
LDB3 Rabbit pAb
A7462-20ul 20 ul
EUR 183
LDB3 Rabbit pAb
A7462-50ul 50 ul
EUR 223
Polyclonal LDB3 Antibody (Center)
APR17180G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LDB3 (Center). This antibody is tested and proven to work in the following applications:
LDB3 Polyclonal Conjugated Antibody
C30932 100ul
EUR 397
LDB3 antibody
70R-18235 50 ul
EUR 435
Description: Rabbit polyclonal LDB3 antibody
LDB3 antibody
70R-1141 100 ug
EUR 377
Description: Rabbit polyclonal LDB3 antibody raised against the N terminal of LDB3
LDB3 Antibody
DF12652 200ul
EUR 304
Description: LDB3 Antibody detects endogenous levels of LDB3.
LDB3 Antibody
1-CSB-PA012831ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LDB3. Recognizes LDB3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
LDB3 Antibody
1-CSB-PA012831ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LDB3. Recognizes LDB3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
LDB3 Antibody
1-CSB-PA012831GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against LDB3. Recognizes LDB3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
Polyclonal LDB3 Antibody (N-term)
APR17183G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LDB3 (N-term). This antibody is tested and proven to work in the following applications:
anti- LDB3 antibody
FNab04734 100µg
EUR 548.75
  • Immunogen: LIM domain binding 3
  • Uniprot ID: O75112
  • Gene ID: 11155
  • Research Area: Developmental biology
Description: Antibody raised against LDB3
Anti-LDB3 antibody
PAab04734 100 ug
EUR 386
Anti-LDB3 antibody
STJ29598 100 µl
EUR 277
Description: This gene encodes a PDZ domain-containing protein. PDZ motifs are modular protein-protein interaction domains consisting of 80-120 amino acid residues. PDZ domain-containing proteins interact with each other in cytoskeletal assembly or with other proteins involved in targeting and clustering of membrane proteins. The protein encoded by this gene interacts with alpha-actinin-2 through its N-terminal PDZ domain and with protein kinase C via its C-terminal LIM domains. The LIM domain is a cysteine-rich motif defined by 50-60 amino acids containing two zinc-binding modules. This protein also interacts with all three members of the myozenin family. Mutations in this gene have been associated with myofibrillar myopathy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been identified; all isoforms have N-terminal PDZ domains while only longer isoforms (1, 2 and 5) have C-terminal LIM domains.
Anti-LDB3 antibody
STJ192577 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LDB3
LDB3 siRNA
20-abx922381
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
LDB3 siRNA
20-abx922382
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-LDB3
YF-PA17478 50 ul
EUR 363
Description: Mouse polyclonal to LDB3
anti-LDB3
YF-PA27498 50 ug
EUR 363
Description: Mouse polyclonal to LDB3
Polyclonal Goat Anti-ZASP/ CYPHER / LDB3 Antibody
APR16432G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-ZASP/ CYPHER / LDB3 . This antibody is tested and proven to work in the following applications:
LDB3 Blocking Peptide
33R-7412 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LDB3 antibody, catalog no. 70R-1141
LDB3 Blocking Peptide
DF12652-BP 1mg
EUR 195
LDB3 cloning plasmid
CSB-CL012831HU-10ug 10ug
EUR 348
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 852
  • Sequence: atgtcttacagtgtgaccctgactgggcccgggccctggggcttccgtctgcaggggggcaaggacttcaacatgcccctcactatctcccggatcacaccaggcagcaaggcagcccagtcccagctcagccagggtgacctcgtggtggccattgacggcgtcaacacagacac
  • Show more
Description: A cloning plasmid for the LDB3 gene.
Anti-LDB3 (2C1)
YF-MA17645 100 ug
EUR 363
Description: Mouse monoclonal to LDB3
Anti-LDB3 (3C8)
YF-MA17646 50 ug
EUR 363
Description: Mouse monoclonal to LDB3
Anti-LDB3 (3C8)
YF-MA17647 200 ul
EUR 363
Description: Mouse monoclonal to LDB3

LDB3 Rabbit Polyclonal Antibody