MEPE Rabbit Polyclonal Antibody
MEPE Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
MEPE Polyclonal Antibody |
ABP59263-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human MEPE protein at amino acid sequence of 20-100
- Applications tips:
|
Description: A polyclonal antibody for detection of MEPE from Human. This MEPE antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MEPE protein at amino acid sequence of 20-100 |
MEPE Polyclonal Antibody |
ABP59263-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human MEPE protein at amino acid sequence of 20-100
- Applications tips:
|
Description: A polyclonal antibody for detection of MEPE from Human. This MEPE antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MEPE protein at amino acid sequence of 20-100 |
MEPE Polyclonal Antibody |
ABP59263-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human MEPE protein at amino acid sequence of 20-100
- Applications tips:
|
Description: A polyclonal antibody for detection of MEPE from Human. This MEPE antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MEPE protein at amino acid sequence of 20-100 |
Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
DLR-MEPE-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Matrix Extracellular Phosphoglycoprotein (MEPE) in samples from serum, plasma or other biological fluids. |
Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
DLR-MEPE-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Matrix Extracellular Phosphoglycoprotein (MEPE) in samples from serum, plasma or other biological fluids. |
Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
DLR-MEPE-Mu-48T |
DL Develop |
48T |
EUR 508 |
- Should the Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) in samples from serum, plasma or other biological fluids. |
Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
DLR-MEPE-Mu-96T |
DL Develop |
96T |
EUR 661 |
- Should the Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) in samples from serum, plasma or other biological fluids. |
Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
DLR-MEPE-Ra-48T |
DL Develop |
48T |
EUR 528 |
- Should the Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Matrix Extracellular Phosphoglycoprotein (MEPE) in samples from serum, plasma or other biological fluids. |
Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
DLR-MEPE-Ra-96T |
DL Develop |
96T |
EUR 690 |
- Should the Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Matrix Extracellular Phosphoglycoprotein (MEPE) in samples from serum, plasma or other biological fluids. |
Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
RD-MEPE-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
RD-MEPE-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
RD-MEPE-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
RD-MEPE-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
RD-MEPE-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
RD-MEPE-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
RDR-MEPE-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
RDR-MEPE-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
RDR-MEPE-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
RDR-MEPE-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
RDR-MEPE-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 558 |
Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
RDR-MEPE-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 776 |
MEPE antibody |
70R-8188 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal MEPE antibody |
MEPE antibody |
70R-18478 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal MEPE antibody |
MEPE Antibody |
1-CSB-PA013704GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against MEPE. Recognizes MEPE from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Rabbit MEPE ELISA Kit |
ERTM0266 |
Abclonal |
96Tests |
EUR 521 |
anti- MEPE antibody |
FNab05128 |
FN Test |
100µg |
EUR 585 |
- Immunogen: matrix extracellular phosphoglycoprotein
- Uniprot ID: Q9NQ76
- Gene ID: 56955
- Research Area: Stem Cells, Cardiovascular
|
Description: Antibody raised against MEPE |
anti- MEPE antibody |
FNab05129 |
FN Test |
100µg |
EUR 585 |
- Immunogen: matrix extracellular phosphoglycoprotein
- Uniprot ID: Q9NQ76
- Gene ID: 56955
- Research Area: Stem Cells, Cardiovascular
|
Description: Antibody raised against MEPE |
Anti-MEPE antibody |
STJ192466 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to MEPE |
Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Human) |
4-PAB232Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MEPE (Ser212~Asn445)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Matrix Extracellular Phosphoglycoprotein (MEPE) |
Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Rat) |
4-PAB232Ra01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MEPE (Gly28~Ser224)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Matrix Extracellular Phosphoglycoprotein (MEPE) |
MEPE siRNA |
20-abx923938 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Human), APC |
4-PAB232Hu01-APC |
Cloud-Clone |
-
EUR 333.00
-
EUR 3113.00
-
EUR 872.00
-
EUR 423.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MEPE (Ser212~Asn445)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with APC. |
Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Human), Biotinylated |
4-PAB232Hu01-Biotin |
Cloud-Clone |
-
EUR 303.00
-
EUR 2341.00
-
EUR 697.00
-
EUR 369.00
-
EUR 216.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MEPE (Ser212~Asn445)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with Biotin. |
Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Human), Cy3 |
4-PAB232Hu01-Cy3 |
Cloud-Clone |
-
EUR 403.00
-
EUR 4109.00
-
EUR 1121.00
-
EUR 523.00
-
EUR 245.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MEPE (Ser212~Asn445)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with Cy3. |
Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Human), FITC |
4-PAB232Hu01-FITC |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MEPE (Ser212~Asn445)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with FITC. |
Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Human), HRP |
4-PAB232Hu01-HRP |
Cloud-Clone |
-
EUR 305.00
-
EUR 2714.00
-
EUR 772.00
-
EUR 383.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MEPE (Ser212~Asn445)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with HRP. |
Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Human), PE |
4-PAB232Hu01-PE |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MEPE (Ser212~Asn445)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with PE. |
Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Rat), APC |
4-PAB232Ra01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MEPE (Gly28~Ser224)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with APC. |
Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Rat), Biotinylated |
4-PAB232Ra01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MEPE (Gly28~Ser224)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with Biotin. |
Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Rat), Cy3 |
4-PAB232Ra01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MEPE (Gly28~Ser224)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with Cy3. |
Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Rat), FITC |
4-PAB232Ra01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MEPE (Gly28~Ser224)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with FITC. |
Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Rat), HRP |
4-PAB232Ra01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MEPE (Gly28~Ser224)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with HRP. |
Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Rat), PE |
4-PAB232Ra01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MEPE (Gly28~Ser224)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with PE. |
Rabbit Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
abx363264-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
MEPE cloning plasmid |
CSB-CL013704HU-10ug |
Cusabio |
10ug |
EUR 552 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1578
- Sequence: ATGCGAGTTTTCTGTGTGGGACTACTCCTTTTCAGTGTGACCTGGGCAGCACCAACATTTCAACCACAGACTGAGAAAACTAAGCAAAGCTGTGTGGAAGAGCAGAGGCAGGAAGAAAAAAACAAAGACAATATTGGTTTTCACCATTTGGGCAAGAGAATAAATCAAGAGCTAT
- Show more
|
Description: A cloning plasmid for the MEPE gene. |
MEPE Blocking Peptide |
33R-5267 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MEPE antibody, catalog no. 70R-8188 |
Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody |
20-abx123885 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody |
20-abx113618 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody |
20-abx104132 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody |
20-abx104133 |
Abbexa |
-
EUR 314.00
-
EUR 133.00
-
EUR 829.00
-
EUR 439.00
-
EUR 272.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody |
abx026780-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody |
abx026780-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody |
20-abx173468 |
Abbexa |
|
|
|
Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody |
20-abx173469 |
Abbexa |
|
|
|
Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody |
20-abx177464 |
Abbexa |
|
|
|
Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody |
20-abx177465 |
Abbexa |
|
|
|
Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody |
abx235128-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody |
abx235129-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Human), APC-Cy7 |
4-PAB232Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 547.00
-
EUR 6106.00
-
EUR 1624.00
-
EUR 727.00
-
EUR 310.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MEPE (Ser212~Asn445)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with APC-Cy7. |
Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAB232Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MEPE (Gly28~Ser224)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with APC-Cy7. |
Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody Pair |
20-abx370519 |
Abbexa |
|
-
10 × 96 tests
-
5 × 96 tests
|
- Shipped within 5-15 working days.
|
Human MEPE ELISA Kit |
EHM0266 |
Abclonal |
96Tests |
EUR 521 |
Goat MEPE ELISA Kit |
EGTM0266 |
Abclonal |
96Tests |
EUR 521 |
Bovine MEPE ELISA Kit |
EBM0266 |
Abclonal |
96Tests |
EUR 521 |
Canine MEPE ELISA Kit |
ECM0266 |
Abclonal |
96Tests |
EUR 521 |
Anserini MEPE ELISA Kit |
EAM0266 |
Abclonal |
96Tests |
EUR 521 |
Porcine MEPE ELISA Kit |
EPM0266 |
Abclonal |
96Tests |
EUR 521 |
Rat MEPE ELISA Kit |
ERM0266 |
Abclonal |
96Tests |
EUR 521 |
Sheep MEPE ELISA Kit |
ESM0266 |
Abclonal |
96Tests |
EUR 521 |
Monkey MEPE ELISA Kit |
EMKM0266 |
Abclonal |
96Tests |
EUR 521 |
Mouse MEPE ELISA Kit |
EMM0266 |
Abclonal |
96Tests |
EUR 521 |
Human MEPE shRNA Plasmid |
20-abx961253 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MEPE Recombinant Protein (Human) |
RP041302 |
ABM |
100 ug |
Ask for price |
MEPE Recombinant Protein (Rat) |
RP211391 |
ABM |
100 ug |
Ask for price |
MEPE Recombinant Protein (Mouse) |
RP150233 |
ABM |
100 ug |
Ask for price |
Guinea Pig MEPE ELISA Kit |
EGM0266 |
Abclonal |
96Tests |
EUR 521 |
Mepe ORF Vector (Mouse) (pORF) |
ORF050079 |
ABM |
1.0 ug DNA |
EUR 506 |
MEPE ORF Vector (Human) (pORF) |
ORF013768 |
ABM |
1.0 ug DNA |
EUR 354 |
Mepe ORF Vector (Rat) (pORF) |
ORF070465 |
ABM |
1.0 ug DNA |
EUR 506 |
Recombinant Matrix Extracellular Phosphoglycoprotein (MEPE) |
4-RPB232Hu01 |
Cloud-Clone |
-
EUR 377.76
-
EUR 204.00
-
EUR 1141.60
-
EUR 447.20
-
EUR 794.40
-
EUR 316.00
-
EUR 2704.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9NQ76
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 29.2kDa
- Isoelectric Point: 6.2
|
Description: Recombinant Human Matrix Extracellular Phosphoglycoprotein expressed in: E.coli |
Recombinant Matrix Extracellular Phosphoglycoprotein (MEPE) |
4-RPB232Ra01 |
Cloud-Clone |
-
EUR 519.33
-
EUR 242.00
-
EUR 1672.48
-
EUR 624.16
-
EUR 1148.32
-
EUR 410.00
-
EUR 4031.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: D6C6P2
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 25.0kDa
- Isoelectric Point: 6.4
|
Description: Recombinant Rat Matrix Extracellular Phosphoglycoprotein expressed in: E.coli |
MEPE ELISA Kit (Rat) (OKCD00669) |
OKCD00669 |
Aviva Systems Biology |
96 Wells |
EUR 857 |
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.62 ng/mL |
MEPE ELISA Kit (Mouse) (OKCD04240) |
OKCD04240 |
Aviva Systems Biology |
96 Wells |
EUR 818 |
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.22 ng/mL |
MEPE ELISA Kit (Human) (OKCD07233) |
OKCD07233 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
Description: Description of target: MEPE seems to play a role in mineralization.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.137ng/mL |
MEPE ELISA Kit (Human) (OKEH04666) |
OKEH04666 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: This gene encodes a secreted calcium-binding phosphoprotein that belongs to the small integrin-binding ligand, N-linked glycoprotein (SIBLING) family of proteins. Members of this family are components of the extracellular matrix of bone and dentin and regulate bone mineralization. Deficiency of a similar protein in mouse results in increased bone mass. Mice lacking this gene are resistant to aging-related trabecular bone loss. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.43 ng/mL |
Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) Protein |
20-abx654281 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) Protein |
20-abx654282 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Rat Matrix Extracellular Phosphoglycoprotein (MEPE) Protein |
20-abx067932 |
Abbexa |
-
EUR 718.00
-
EUR 286.00
-
EUR 2249.00
-
EUR 857.00
-
EUR 509.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Matrix Extracellular Phosphoglycoprotein (MEPE) Protein |
20-abx067934 |
Abbexa |
-
EUR 537.00
-
EUR 244.00
-
EUR 1553.00
-
EUR 634.00
-
EUR 398.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
MEPE sgRNA CRISPR Lentivector set (Human) |
K1291301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Mepe sgRNA CRISPR Lentivector set (Mouse) |
K4424501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Mepe sgRNA CRISPR Lentivector set (Rat) |
K7118401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Monkey Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
abx359615-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Pig Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
abx361390-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Sheep Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
abx364222-96tests |
Abbexa |
96 tests |
EUR 926 |
- Shipped within 5-12 working days.
|
Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
abx573663-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human MEPE/ Matrix extracellular phosphoglycoprotein ELISA Kit |
E2804Hu |
Sunlong |
1 Kit |
EUR 571 |
Human MEPE(Matrix extracellular phosphoglycoprotein) ELISA Kit |
EH1407 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.938-60 ng/ml
- Uniprot ID: Q9NQ76
- Alias: MEPE(Matrix Extracellular Phosphoglycoprotein)/OF45/Osteoregulin/extracellular phosphoglycoprotein with ASARM motif(bone)
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.563 ng/ml |
Human Matrix extracellular phosphoglycoprotein, MEPE ELISA KIT |
ELI-04077h |
Lifescience Market |
96 Tests |
EUR 824 |
Human matrix extracellular phosphoglycoprotein(MEPE)ELISA Kit |
GA-E1502HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human matrix extracellular phosphoglycoprotein(MEPE)ELISA Kit |
GA-E1502HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
20-abx155813 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
20-abx154371 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
20-abx152307 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Chicken Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
abx356250-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Matrix Extracellular Phosphoglycoprotein (MEPE) CLIA Kit |
20-abx492522 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) CLIA Kit |
20-abx492523 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Rat Matrix Extracellular Phosphoglycoprotein (MEPE) CLIA Kit |
20-abx492524 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Matrix Extracellular Phosphoglycoprotein (MEPE) CLIA Kit |
abx197266-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
abx250682-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human matrix extracellular phosphoglycoprotein,MEPE ELISA Kit |
201-12-1486 |
SunredBio |
96 tests |
EUR 440 |
- This matrix extracellular phosphoglycoprotein ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
MEPE sgRNA CRISPR Lentivector (Human) (Target 1) |
K1291302 |
ABM |
1.0 ug DNA |
EUR 154 |
MEPE sgRNA CRISPR Lentivector (Human) (Target 2) |
K1291303 |
ABM |
1.0 ug DNA |
EUR 154 |
MEPE sgRNA CRISPR Lentivector (Human) (Target 3) |
K1291304 |
ABM |
1.0 ug DNA |
EUR 154 |
Mepe sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4424502 |
ABM |
1.0 ug DNA |
EUR 154 |
Mepe sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4424503 |
ABM |
1.0 ug DNA |
EUR 154 |
Mepe sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4424504 |
ABM |
1.0 ug DNA |
EUR 154 |
Human matrix extracellular phosphoglycoprotein,MEPE ELISA Kit |
CN-04327H1 |
ChemNorm |
96T |
EUR 471 |
Human matrix extracellular phosphoglycoprotein,MEPE ELISA Kit |
CN-04327H2 |
ChemNorm |
48T |
EUR 322 |
Human matrix extracellular phosphoglycoprotein, MEPE ELISA Kit |
CSB-E09173h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human matrix extracellular phosphoglycoprotein, MEPE in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human matrix extracellular phosphoglycoprotein, MEPE ELISA Kit |
1-CSB-E09173h |
Cusabio |
-
EUR 900.00
-
EUR 5476.00
-
EUR 2900.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human matrix extracellular phosphoglycoprotein, MEPE in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Mepe sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7118402 |
ABM |
1.0 ug DNA |
EUR 154 |
Mepe sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7118403 |
ABM |
1.0 ug DNA |
EUR 154 |
Mepe sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7118404 |
ABM |
1.0 ug DNA |
EUR 154 |
MEPE Protein Vector (Human) (pPB-C-His) |
PV055069 |
ABM |
500 ng |
EUR 481 |
MEPE Protein Vector (Human) (pPB-N-His) |
PV055070 |
ABM |
500 ng |
EUR 481 |
MEPE Protein Vector (Human) (pPM-C-HA) |
PV055071 |
ABM |
500 ng |
EUR 481 |
MEPE Protein Vector (Human) (pPM-C-His) |
PV055072 |
ABM |
500 ng |
EUR 481 |
Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
SEB232Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4502.43 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrix Extracellular Phosphoglycoprotein (MEPE) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- I
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrix Extracellular Phosphoglycoprotein (MEPE) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
SEB232Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 458.44 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrix Extracellular Phosphoglycoprotein (MEPE) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- I
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrix Extracellular Phosphoglycoprotein (MEPE) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
SEB232Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 612.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrix Extracellular Phosphoglycoprotein (MEPE) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- I
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrix Extracellular Phosphoglycoprotein (MEPE) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
SEB232Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2454.23 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrix Extracellular Phosphoglycoprotein (MEPE) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- I
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrix Extracellular Phosphoglycoprotein (MEPE) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
4-SEB232Hu |
Cloud-Clone |
-
EUR 4553.00
-
EUR 2405.00
-
EUR 613.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Matrix Extracellular Phosphoglycoprotein elisa. Alternative names of the recognized antigen: OF45
- Asarm Motif-Containing
- Osteoblast/Osteocyte Factor 45
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Matrix Extracellular Phosphoglycoprotein (MEPE) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
SEB232Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4626.78 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- I
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) in serum, plasma and other biological fluids. |
Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
SEB232Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 468.68 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- I
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) in serum, plasma and other biological fluids. |
Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
SEB232Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 626.68 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- I
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) in serum, plasma and other biological fluids. |
Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
SEB232Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2520.06 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- I
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) in serum, plasma and other biological fluids. |
Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
4-SEB232Mu |
Cloud-Clone |
-
EUR 4677.00
-
EUR 2471.00
-
EUR 627.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Matrix Extracellular Phosphoglycoprotein elisa. Alternative names of the recognized antigen: OF45
- Asarm Motif-Containing
- Osteoblast/Osteocyte Factor 45
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
SEB232Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4875.49 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Matrix Extracellular Phosphoglycoprotein (MEPE) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Int
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Matrix Extracellular Phosphoglycoprotein (MEPE) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
SEB232Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 489.16 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Matrix Extracellular Phosphoglycoprotein (MEPE) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Int
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Matrix Extracellular Phosphoglycoprotein (MEPE) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
SEB232Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 655.94 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Matrix Extracellular Phosphoglycoprotein (MEPE) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Int
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Matrix Extracellular Phosphoglycoprotein (MEPE) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
SEB232Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2651.73 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Matrix Extracellular Phosphoglycoprotein (MEPE) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Int
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Matrix Extracellular Phosphoglycoprotein (MEPE) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit |
4-SEB232Ra |
Cloud-Clone |
-
EUR 4926.00
-
EUR 2602.00
-
EUR 656.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Matrix Extracellular Phosphoglycoprotein elisa. Alternative names of the recognized antigen: OF45
- Asarm Motif-Containing
- Osteoblast/Osteocyte Factor 45
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Matrix Extracellular Phosphoglycoprotein (MEPE) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Rat Matrix Extracellular Phosphoglycoprotein ELISA Kit (MEPE) |
RK03810 |
Abclonal |
96 Tests |
EUR 521 |
Human matrix extracellular phosphoglycoprotein(MEPE)ELISA Kit |
QY-E00952 |
Qayee Biotechnology |
96T |
EUR 361 |
MEPE Protein Vector (Rat) (pPB-C-His) |
PV281858 |
ABM |
500 ng |
EUR 603 |
MEPE Protein Vector (Rat) (pPB-N-His) |
PV281859 |
ABM |
500 ng |
EUR 603 |
MEPE Protein Vector (Rat) (pPM-C-HA) |
PV281860 |
ABM |
500 ng |
EUR 603 |
MEPE Protein Vector (Rat) (pPM-C-His) |
PV281861 |
ABM |
500 ng |
EUR 603 |
MEPE Protein Vector (Mouse) (pPB-C-His) |
PV200314 |
ABM |
500 ng |
EUR 603 |
MEPE Protein Vector (Mouse) (pPB-N-His) |
PV200315 |
ABM |
500 ng |
EUR 603 |
MEPE Protein Vector (Mouse) (pPM-C-HA) |
PV200316 |
ABM |
500 ng |
EUR 603 |
MEPE Rabbit Polyclonal Antibody