STC2 Rabbit Polyclonal Antibody

STC2 Rabbit Polyclonal Antibody

To Order Now:

STC2 Polyclonal Antibody

ABP60538-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human STC2 protein at amino acid sequence of 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of STC2 from Human, Mouse, Rat. This STC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STC2 protein at amino acid sequence of 170-250

STC2 Polyclonal Antibody

ABP60538-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human STC2 protein at amino acid sequence of 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of STC2 from Human, Mouse, Rat. This STC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STC2 protein at amino acid sequence of 170-250

Human Stanniocalcin 2 (STC2) ELISA Kit

DLR-STC2-Hu-48T 48T
EUR 517
  • Should the Human Stanniocalcin 2 (STC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Stanniocalcin 2 (STC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Stanniocalcin 2 (STC2) ELISA Kit

DLR-STC2-Hu-96T 96T
EUR 673
  • Should the Human Stanniocalcin 2 (STC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Stanniocalcin 2 (STC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Stanniocalcin 2 (STC2) ELISA Kit

RD-STC2-Hu-48Tests 48 Tests
EUR 521

Human Stanniocalcin 2 (STC2) ELISA Kit

RD-STC2-Hu-96Tests 96 Tests
EUR 723

Human Stanniocalcin 2 (STC2) ELISA Kit

RDR-STC2-Hu-48Tests 48 Tests
EUR 544

Human Stanniocalcin 2 (STC2) ELISA Kit

RDR-STC2-Hu-96Tests 96 Tests
EUR 756

STC2 Rabbit pAb

A10397-100ul 100 ul
EUR 308

STC2 Rabbit pAb

A10397-200ul 200 ul
EUR 459

STC2 Rabbit pAb

A10397-20ul 20 ul
EUR 183

STC2 Rabbit pAb

A10397-50ul 50 ul
EUR 223

STC2 Rabbit pAb

A8626-100ul 100 ul
EUR 308

STC2 Rabbit pAb

A8626-200ul 200 ul
EUR 459

STC2 Rabbit pAb

A8626-20ul 20 ul Ask for price

STC2 Rabbit pAb

A8626-50ul 50 ul Ask for price

STC2 Antibody

40339-100ul 100ul
EUR 252

STC2 antibody

70R-20583 50 ul
EUR 435
Description: Rabbit polyclonal STC2 antibody

STC2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against STC2. Recognizes STC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

STC2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against STC2. Recognizes STC2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

STC2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against STC2. Recognizes STC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Polyclonal STC2 Antibody (C-term)

AMM08001G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STC2 (C-term). This antibody is tested and proven to work in the following applications:

Stanniocalcin 2 Polyclonal (STC2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Polyclonal STC2 antibody - C-terminal region

AMM08002G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STC2 - C-terminal region. This antibody is tested and proven to work in the following applications:

Polyclonal STC2 antibody - C-terminal region

AMM08003G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STC2 - C-terminal region. This antibody is tested and proven to work in the following applications:

STC2 Conjugated Antibody

C40339 100ul
EUR 397

Anti-STC2 antibody

STJ111349 100 µl
EUR 277
Description: This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers.

Anti-STC2 antibody

STJ112433 100 µl
EUR 277
Description: This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers.

Anti-STC2 antibody

STJ192398 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to STC2

Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC2 (Ile53~Gln294)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2)


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT18772 2 ug
EUR 231

Stanniocalcin-2 (STC2) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Stanniocalcin-2 (STC2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Stanniocalcin-2 (STC2) Antibody

abx145695-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Stanniocalcin 2 (STC2) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Stanniocalcin-2 (STC2) Antibody

abx025328-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Stanniocalcin-2 (STC2) Antibody

abx025328-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Stanniocalcin-2 (STC2) Antibody

abx027961-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Stanniocalcin-2 (STC2) Antibody

abx027961-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Stanniocalcin 2 (STC2) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Stanniocalcin-2 (STC2) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Stanniocalcin 2 (STC2) Antibody

abx238286-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Stanniocalcin 2 (STC2) Antibody

abx238287-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Stanniocalcin 2 (STC2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC2 (Ile53~Gln294)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with APC.

Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC2 (Ile53~Gln294)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with Biotin.

Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC2 (Ile53~Gln294)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with Cy3.

Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC2 (Ile53~Gln294)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with FITC.

Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC2 (Ile53~Gln294)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with HRP.

Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC2 (Ile53~Gln294)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with PE.

STC2 cloning plasmid

CSB-CL022822HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 909
  • Sequence: atgtgtgccgagcggctgggccagttcatgaccctggctttggtgttggccacctttgacccggcgcgggggaccgacgccaccaacccacccgagggtccccaagacaggagctcccagcagaaaggccgcctgtccctgcagaatacagcggagatccagcactgtttggtcaa
  • Show more
Description: A cloning plasmid for the STC2 gene.

Monoclonal STC2 Antibody, Clone: 339CT13.2.6

AMM08000G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human STC2 . The antibodies are raised in Mouse and are from clone 339CT13.2.6. This antibody is applicable in WB, E

Stanniocalcin 2 (STC2) Antibody Pair

  • EUR 1748.00
  • EUR 1121.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Anti-Stanniocalcin 2/STC2 Antibody

PA1998 100ug/vial
EUR 294

Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC2 (Ile53~Gln294)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with APC-Cy7.

Rat STC2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human STC2 ELISA Kit

ELA-E12206h 96 Tests
EUR 824


EF000312 96 Tests
EUR 689

Human STC2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

STC2 protein (His tag)

80R-2847 100 ug
EUR 327
Description: Purified recombinant STC2 protein (His tag)

Mouse STC2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Stanniocalcin 2 (STC2)

  • EUR 521.12
  • EUR 242.00
  • EUR 1679.20
  • EUR 626.40
  • EUR 1152.80
  • EUR 412.00
  • EUR 4048.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O76061
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.2kDa
  • Isoelectric Point: 7.1
Description: Recombinant Human Stanniocalcin 2 expressed in: E.coli

STC2 Recombinant Protein (Human)

RP030379 100 ug Ask for price

STC2 Recombinant Protein (Rat)

RP231401 100 ug Ask for price

STC2 Recombinant Protein (Mouse)

RP175991 100 ug Ask for price

Human STC2 PicoKine ELISA Kit

EK1988 96 wells
EUR 425
Description: For quantitative detection of human STC2 in cell culture supernates, serum.

Mouse STC2 PicoKine ELISA Kit

EK1989 96 wells
EUR 425
Description: For quantitative detection of mouse STC2 in cell culture supernates, serum and plasma (heparin).

Rat STC2 PicoKine ELISA Kit

EK1995 96 wells
EUR 425
Description: For quantitative detection of rat STC2 in cell culture supernates, serum and plasma (heparin).

Human Stanniocalcin 2 (STC2) Protein

  • EUR 732.00
  • EUR 286.00
  • EUR 2263.00
  • EUR 871.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Stc2 ORF Vector (Mouse) (pORF)

ORF058665 1.0 ug DNA
EUR 506

STC2 ORF Vector (Human) (pORF)

ORF010127 1.0 ug DNA
EUR 95

Stc2 ORF Vector (Rat) (pORF)

ORF077135 1.0 ug DNA
EUR 506

STC2 ELISA Kit (Human) (OKCD08862)

OKCD08862 96 Wells
EUR 975
Description: Description of target: Recombinant Human Stanniocalcin-2;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 13.6pg/mL

STC2 ELISA Kit (Human) (OKEH02212)

OKEH02212 96 Wells
EUR 662
Description: Description of target: This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 12 pg/mL

STC2 ELISA Kit (Human) (OKBB01358)

OKBB01358 96 Wells
EUR 505
Description: Description of target: Stanniocalcin-2 is a protein that in humans is encoded by the STC2 gene. It is mapped to 5q35.2. This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <5pg/ml

Stc2 ELISA Kit (Mouse) (OKBB01359)

OKBB01359 96 Wells
EUR 505
Description: Description of target: Stanniocalcin-2 is a protein that in humans is encoded by the STC2 gene. It is mapped to 11; 11 A4. This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

Stc2 ELISA Kit (Rat) (OKBB01365)

OKBB01365 96 Wells
EUR 505
Description: Description of target: Stanniocalcin-2 is a protein that in humans is encoded by the STC2 gene. It is mapped to 10q12. This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers. STC2 has opposite effects on calcium and phosphate homeostasis as compared to Stc1.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

STC2 ELISA Kit (Mouse) (OKEH05607)

OKEH05607 96 Wells
EUR 779
Description: Description of target: Has an anti-hypocalcemic action on calcium and phosphate homeostasis. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39 pg/mL

Mouse Stanniocalcin-2 (STC2) ELISA Kit

abx515852-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Stanniocalcin-2 (STC2) ELISA Kit

abx515853-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human Stanniocalcin-2 (STC2) ELISA Kit

abx575647-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Stc2/ Stanniocalcin-2 ELISA Kit

E0948Ra 1 Kit
EUR 646

Mouse Stc2/ Stanniocalcin-2 ELISA Kit

E1422Mo 1 Kit
EUR 632

Human STC2/ Stanniocalcin-2 ELISA Kit

E2413Hu 1 Kit
EUR 605

Human STC2(Stanniocalcin-2) ELISA Kit

EH1394 96T
EUR 567.6
  • Detection range: 31.2-2000 pg/ml
  • Uniprot ID: O76061
  • Alias: STC2/Stanniocalcin-2/STC-2/Stanniocalcin-related protein/STC-related protein/STCRP
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Stanniocalcin- 2, STC2 ELISA KIT

ELI-23671h 96 Tests
EUR 824

STC2 Rabbit Polyclonal Antibody