DKKL1 Rabbit Polyclonal Antibody

DKKL1 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

DKKL1 Polyclonal Antibody

ES11193-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DKKL1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DKKL1 Polyclonal Antibody

ES11193-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DKKL1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DKKL1 Antibody

47058-100ul 100ul
EUR 252

DKKL1 Antibody

46552-100ul 100ul
EUR 252

DKKL1 Antibody

1-CSB-PA892450LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DKKL1. Recognizes DKKL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

DKKL1 antibody

70R-7515 50 ug
EUR 467
Description: Rabbit polyclonal DKKL1 antibody

Polyclonal DKKL1 Antibody (C-term)

AMM08616G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DKKL1 (C-term). This antibody is tested and proven to work in the following applications:

DKKL1 Polyclonal Antibody, HRP Conjugated

A68135 100 µg
EUR 570.55
Description: Ask the seller for details

DKKL1 Polyclonal Antibody, FITC Conjugated

A68136 100 µg
EUR 570.55
Description: The best epigenetics products

DKKL1 Polyclonal Antibody, Biotin Conjugated

A68137 100 µg
EUR 570.55
Description: kits suitable for this type of research

DKKL1 Conjugated Antibody

C46552 100ul
EUR 397

DKKL1 Conjugated Antibody

C47058 100ul
EUR 397

Anti-DKKL1 antibody

STJ192351 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DKKL1

DKKL1 siRNA

20-abx914204
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DKKL1 siRNA

20-abx914205
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-DKKL1

YF-PA18380 50 ul
EUR 363
Description: Mouse polyclonal to DKKL1

DKKL1 Antibody, HRP conjugated

1-CSB-PA892450LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DKKL1. Recognizes DKKL1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DKKL1 Antibody, FITC conjugated

1-CSB-PA892450LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DKKL1. Recognizes DKKL1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DKKL1 Antibody, Biotin conjugated

1-CSB-PA892450LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DKKL1. Recognizes DKKL1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

DKKL1 Blocking Peptide

33R-1858 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DKKL1 antibody, catalog no. 70R-7515

DKKL1 cloning plasmid

CSB-CL892450HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 729
  • Sequence: atgggagaagcctccccacctgcccccgcaaggcggcatctgctggtcctgctgctgctcctctctaccctggtgatcccctccgctgcagctcctatccatgatgctgacgcccaagagagctccttgggtctcacaggcctccagagcctactccaaggcttcagccgactttt
  • Show more
Description: A cloning plasmid for the DKKL1 gene.

Dickkopf-Like 1 (DKKL1) Antibody

abx028492-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Dickkopf-Like 1 (DKKL1) Antibody

abx028492-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Dickkopf-Like 1 (DKKL1) Antibody

20-abx312308
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat)

4-PAP091Ra01
  • EUR 275.00
  • EUR 2958.00
  • EUR 727.00
  • EUR 350.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKKL1 (Val21~Leu230)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1)

Human DKKL1 ELISA Kit

ELA-E4999h 96 Tests
EUR 824

DKKL1 ELISA KIT|Human

EF006365 96 Tests
EUR 689

Mouse DKKL1 shRNA Plasmid

20-abx974096
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DKKL1 shRNA Plasmid

20-abx958974
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DKKL1 Recombinant Protein (Human)

RP009406 100 ug Ask for price

DKKL1 Recombinant Protein (Rat)

RP198122 100 ug Ask for price

DKKL1 Recombinant Protein (Mouse)

RP129140 100 ug Ask for price

Dickkopf Like Protein 1 (DKKL1) Antibody

20-abx130376
  • EUR 481.00
  • EUR 133.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Dickkopf-Like 1 (DKKL1) Antibody (HRP)

20-abx312309
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dickkopf-Like 1 (DKKL1) Antibody (FITC)

20-abx312310
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dickkopf-Like 1 (DKKL1) Antibody (Biotin)

20-abx312311
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat), APC

4-PAP091Ra01-APC
  • EUR 388.00
  • EUR 3887.00
  • EUR 1065.00
  • EUR 501.00
  • EUR 237.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKKL1 (Val21~Leu230)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1). This antibody is labeled with APC.

Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat), Biotinylated

4-PAP091Ra01-Biotin
  • EUR 343.00
  • EUR 2908.00
  • EUR 839.00
  • EUR 425.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKKL1 (Val21~Leu230)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1). This antibody is labeled with Biotin.

Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat), Cy3

4-PAP091Ra01-Cy3
  • EUR 476.00
  • EUR 5141.00
  • EUR 1379.00
  • EUR 626.00
  • EUR 275.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKKL1 (Val21~Leu230)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1). This antibody is labeled with Cy3.

Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat), FITC

4-PAP091Ra01-FITC
  • EUR 330.00
  • EUR 3129.00
  • EUR 872.00
  • EUR 420.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKKL1 (Val21~Leu230)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1). This antibody is labeled with FITC.

Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat), HRP

4-PAP091Ra01-HRP
  • EUR 353.00
  • EUR 3385.00
  • EUR 940.00
  • EUR 451.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKKL1 (Val21~Leu230)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1). This antibody is labeled with HRP.

Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat), PE

4-PAP091Ra01-PE
  • EUR 330.00
  • EUR 3129.00
  • EUR 872.00
  • EUR 420.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKKL1 (Val21~Leu230)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1). This antibody is labeled with PE.

DKKL1 Rabbit Polyclonal Antibody