CDX4 Rabbit Polyclonal Antibody

CDX4 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

CDX4 Polyclonal Antibody

ABP58099-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CDX4 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of CDX4 from Human, Mouse. This CDX4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CDX4 protein at amino acid sequence of 30-110

CDX4 Polyclonal Antibody

ABP58099-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CDX4 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of CDX4 from Human, Mouse. This CDX4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CDX4 protein at amino acid sequence of 30-110

CDX4 Polyclonal Antibody

ABP58099-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CDX4 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of CDX4 from Human, Mouse. This CDX4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CDX4 protein at amino acid sequence of 30-110

CDX4 Rabbit pAb

A2704-100ul 100 ul
EUR 308

CDX4 Rabbit pAb

A2704-200ul 200 ul
EUR 459

CDX4 Rabbit pAb

A2704-20ul 20 ul
EUR 183

CDX4 Rabbit pAb

A2704-50ul 50 ul
EUR 223

Polyclonal CDX4 Antibody (Center)

AMM08762G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CDX4 (Center). This antibody is tested and proven to work in the following applications:

CDX4 Antibody

ABD8285 100 ug
EUR 438

CDX4 Antibody

45262-100ul 100ul
EUR 252

CDX4 Antibody

45262-50ul 50ul
EUR 187

CDX4 Antibody

46947-100ul 100ul
EUR 252

CDX4 Antibody

DF8285 200ul
EUR 304
Description: CDX4 Antibody detects endogenous levels of total CDX4.

CDX4 Antibody

1-CSB-PA005129LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDX4. Recognizes CDX4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

Polyclonal CDX4 Antibody (C-term)

AMM08761G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CDX4 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal Cdx4 antibody - C-terminal region

AMM08763G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Cdx4 - C-terminal region. This antibody is tested and proven to work in the following applications:

CDX4 Conjugated Antibody

C45262 100ul
EUR 397

CDX4 Conjugated Antibody

C46947 100ul
EUR 397

anti- CDX4 antibody

FNab01574 100µg
EUR 505.25
  • Immunogen: caudal type homeobox 4
  • Uniprot ID: O14627
  • Gene ID: 1046
  • Research Area: Epigenetics, Metabolism, Developmental biology
Description: Antibody raised against CDX4

Anti-CDX4 antibody

PAab01574 100 ug
EUR 355

Anti-CDX4 antibody

STJ116185 100 µl
EUR 277
Description: This gene encodes a member of a small subfamily of homeobox containing transcription factors. The encoded protein may regulate homeobox gene expression during anteroposterior patterning and hematopoiesis.

Anti-CDX4 antibody

STJ192425 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CDX4

CDX4 siRNA

20-abx911366
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CDX4 siRNA

20-abx911367
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CDX4 Antibody, HRP conjugated

1-CSB-PA005129LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDX4. Recognizes CDX4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CDX4 Antibody, FITC conjugated

1-CSB-PA005129LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDX4. Recognizes CDX4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CDX4 Antibody, Biotin conjugated

1-CSB-PA005129LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDX4. Recognizes CDX4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CDX4 cloning plasmid

CSB-CL005129HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 855
  • Sequence: ATGTACGGAAGCTGTCTTTTGGAGAAAGAAGCAGGCATGTACCCGGGCACTCTCATGAGCCCTGGGGGCGACGGCACAGCTGGGACAGGCGGCACAGGGGGCGGTGGGAGTCCGATGCCAGCCTCCAATTTCGCTGCGGCACCGGCTTTCTCGCACTATATGGGGTATCCTCATAT
  • Show more
Description: A cloning plasmid for the CDX4 gene.

CDX4 Blocking Peptide

DF8285-BP 1mg
EUR 195

Anti-Cdx4 (1G12)

YF-MA12403 100 ug
EUR 363
Description: Mouse monoclonal to Cdx4

Anti-Cdx4 (1G12)

YF-MA12404 200 ul
EUR 363
Description: Mouse monoclonal to Cdx4

Anti-Cdx4 (1H7)

YF-MA12405 100 ug
EUR 363
Description: Mouse monoclonal to Cdx4

Anti-Cdx4 (2E11)

YF-MA12406 100 ug
EUR 363
Description: Mouse monoclonal to Cdx4

Anti-Cdx4 (2G12)

YF-MA12407 100 ug
EUR 363
Description: Mouse monoclonal to Cdx4

Anti-Cdx4 (3H3)

YF-MA12408 100 ug
EUR 363
Description: Mouse monoclonal to Cdx4

Anti-Cdx4 (3F3)

YF-MA12409 100 ug
EUR 363
Description: Mouse monoclonal to Cdx4

Anti-Cdx4 (1A11)

YF-MA12410 100 ug
EUR 363
Description: Mouse monoclonal to Cdx4

Anti-Cdx4 (2F8)

YF-MA12411 100 ug
EUR 363
Description: Mouse monoclonal to Cdx4

Anti-Cdx4 (3H8)

YF-MA12412 100 ug
EUR 363
Description: Mouse monoclonal to Cdx4

Anti-Cdx4 (1H4)

YF-MA12413 100 ug
EUR 363
Description: Mouse monoclonal to Cdx4

Anti-Cdx4 (2H7)

YF-MA12414 100 ug
EUR 363
Description: Mouse monoclonal to Cdx4

Anti-Cdx4 (1E9)

YF-MA12415 100 ug
EUR 363
Description: Mouse monoclonal to Cdx4

Anti-Cdx4 (3F11)

YF-MA12416 100 ug
EUR 363
Description: Mouse monoclonal to Cdx4

Anti-Cdx4 (1E11)

YF-MA12417 100 ug
EUR 363
Description: Mouse monoclonal to Cdx4

CDX4 ELISA KIT|Human

EF008580 96 Tests
EUR 689

Human CDX4 shRNA Plasmid

20-abx950755
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CDX4 shRNA Plasmid

20-abx969634
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CDX4 Recombinant Protein (Human)

RP037975 100 ug Ask for price

CDX4 Recombinant Protein (Rat)

RP194420 100 ug Ask for price

CDX4 Recombinant Protein (Mouse)

RP123266 100 ug Ask for price

Homeobox Protein CDX-4 (CDX4) Antibody

20-abx149178
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Homeobox Protein CDX-4 (CDX4) Antibody

20-abx005973
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Homeobox Protein CDX-4 (CDX4) Antibody

20-abx318143
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Caudal Type Homeobox 4 (CDX4) Antibody

abx231574-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Caudal type homeo box transcription factor 4 (CDX4) polyclonal antibody

ABP-PAB-10470 100 ug Ask for price
    • Product line: Transcription Factors
    • Brand:

Monoclonal CDX4 Antibody (monoclonal) (M06), Clone: 3F3

APR15399G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human CDX4 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 3F3. This antibody is applicable in WB, E

Monoclonal CDX4 Antibody (monoclonal) (M08), Clone: 2F8

APR15400G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human CDX4 (monoclonal) (M08). The antibodies are raised in mouse and are from clone 2F8. This antibody is applicable in WB, E

Homeobox Protein CDX-4 (CDX4) Antibody (HRP)

20-abx315635
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00