CLN8 Rabbit Polyclonal Antibody
CLN8 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
CLN8 Polyclonal Antibody |
ABP58192-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human CLN8 protein at amino acid sequence of 231-280
- Applications tips:
|
Description: A polyclonal antibody for detection of CLN8 from Human. This CLN8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CLN8 protein at amino acid sequence of 231-280 |
CLN8 Polyclonal Antibody |
ABP58192-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CLN8 protein at amino acid sequence of 231-280
- Applications tips:
|
Description: A polyclonal antibody for detection of CLN8 from Human. This CLN8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CLN8 protein at amino acid sequence of 231-280 |
CLN8 Polyclonal Antibody |
ES11417-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CLN8 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CLN8 Polyclonal Antibody |
ES11417-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CLN8 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Protein CLN8 (CLN8) Antibody |
abx030518-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Protein CLN8 (CLN8) Antibody |
abx030518-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
CLN8 Rabbit pAb |
A16843-100ul |
Abclonal |
100 ul |
EUR 308 |
CLN8 Rabbit pAb |
A16843-200ul |
Abclonal |
200 ul |
EUR 459 |
CLN8 Rabbit pAb |
A16843-20ul |
Abclonal |
20 ul |
EUR 183 |
CLN8 Rabbit pAb |
A16843-50ul |
Abclonal |
50 ul |
EUR 223 |
CLN8 Polyclonal Conjugated Antibody |
C29954 |
SAB |
100ul |
EUR 397 |
CLN8 Antibody |
1-CSB-PA866210LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CLN8. Recognizes CLN8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
CLN8 antibody |
70R-7114 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal CLN8 antibody |
CLN8 antibody |
70R-7115 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal CLN8 antibody |
Polyclonal CLN8 Antibody (C-term) |
APG02662G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CLN8 (C-term). This antibody is tested and proven to work in the following applications: |
Anti-CLN8 antibody |
STJ192575 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to CLN8 |
CLN8 siRNA |
20-abx901117 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CLN8 siRNA |
20-abx912107 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CLN8 siRNA |
20-abx912108 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CLN8 Antibody, HRP conjugated |
1-CSB-PA866210LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CLN8. Recognizes CLN8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
CLN8 Antibody, FITC conjugated |
1-CSB-PA866210LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CLN8. Recognizes CLN8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
CLN8 Antibody, Biotin conjugated |
1-CSB-PA866210LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CLN8. Recognizes CLN8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
CLN8 Blocking Peptide |
33R-9526 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CLN8 antibody, catalog no. 70R-7115 |
CLN8 Blocking Peptide |
33R-6257 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CLN8 antibody, catalog no. 70R-7114 |
CLN8 cloning plasmid |
CSB-CL866210HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 861
- Sequence: atgaatcctgcgagcgatgggggcacatcagagagcatttttgacctggactatgcatcctgggggatccgctccacgctgatggtcgctggctttgtcttctacttgggcgtctttgtggtctgccaccagctgtcctcttccctgaatgccacttaccgttctttggtggccag
- Show more
|
Description: A cloning plasmid for the CLN8 gene. |
Rat CLN8 shRNA Plasmid |
20-abx989401 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse CLN8 shRNA Plasmid |
20-abx973766 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CLN8 Rabbit Polyclonal Antibody