CLN8 Rabbit Polyclonal Antibody

CLN8 Rabbit Polyclonal Antibody

To Order Now:

CLN8 Polyclonal Antibody

ABP58192-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CLN8 protein at amino acid sequence of 231-280
  • Applications tips:
Description: A polyclonal antibody for detection of CLN8 from Human. This CLN8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CLN8 protein at amino acid sequence of 231-280

CLN8 Polyclonal Antibody

ABP58192-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CLN8 protein at amino acid sequence of 231-280
  • Applications tips:
Description: A polyclonal antibody for detection of CLN8 from Human. This CLN8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CLN8 protein at amino acid sequence of 231-280

CLN8 Polyclonal Antibody

29954-100ul 100ul
EUR 252

CLN8 Polyclonal Antibody

29954-50ul 50ul
EUR 187

Protein CLN8 (CLN8) Antibody

abx030518-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Protein CLN8 (CLN8) Antibody

abx030518-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

CLN8 Rabbit pAb

A16843-100ul 100 ul
EUR 308

CLN8 Rabbit pAb

A16843-200ul 200 ul
EUR 459

CLN8 Rabbit pAb

A16843-20ul 20 ul
EUR 183

CLN8 Rabbit pAb

A16843-50ul 50 ul
EUR 223

CLN8 Polyclonal Conjugated Antibody

C29954 100ul
EUR 397

CLN8 antibody

70R-7114 50 ug
EUR 467
Description: Rabbit polyclonal CLN8 antibody

CLN8 antibody

70R-7115 50 ug
EUR 467
Description: Rabbit polyclonal CLN8 antibody

CLN8 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CLN8. Recognizes CLN8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Polyclonal CLN8 Antibody (C-term)

APG02662G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CLN8 (C-term). This antibody is tested and proven to work in the following applications:

Cln8/ Rat Cln8 ELISA Kit

ELI-10196r 96 Tests
EUR 886

Anti-CLN8 antibody

STJ119214 100 µl
EUR 277

Anti-CLN8 antibody

STJ192575 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CLN8

Human Protein CLN8, CLN8 ELISA KIT

ELI-31913h 96 Tests
EUR 824

Mouse Protein CLN8, Cln8 ELISA KIT

ELI-50182m 96 Tests
EUR 865


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CLN8 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CLN8. Recognizes CLN8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CLN8 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CLN8. Recognizes CLN8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CLN8 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CLN8. Recognizes CLN8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CLN8 Blocking Peptide

33R-6257 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CLN8 antibody, catalog no. 70R-7114

CLN8 Blocking Peptide

33R-9526 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CLN8 antibody, catalog no. 70R-7115

CLN8 cloning plasmid

CSB-CL866210HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 861
  • Sequence: atgaatcctgcgagcgatgggggcacatcagagagcatttttgacctggactatgcatcctgggggatccgctccacgctgatggtcgctggctttgtcttctacttgggcgtctttgtggtctgccaccagctgtcctcttccctgaatgccacttaccgttctttggtggccag
  • Show more
Description: A cloning plasmid for the CLN8 gene.

Mouse CLN8 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat CLN8 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-25817d 96 Tests
EUR 928

CLN8 Rabbit Polyclonal Antibody