POSTN Rabbit Polyclonal Antibody

POSTN Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

POSTN Polyclonal Antibody
ABP59973-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human POSTN protein
  • Applications tips:
Description: A polyclonal antibody for detection of POSTN from Human, Mouse. This POSTN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human POSTN protein

POSTN Polyclonal Antibody
ES11309-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against POSTN from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

POSTN Polyclonal Antibody
ES11309-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against POSTN from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Periostin (POSTN) ELISA Kit
DLR-POSTN-Hu-48T 48T
EUR 517
  • Should the Human Periostin (POSTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Periostin (POSTN) in samples from serum, plasma or other biological fluids.

Human Periostin (POSTN) ELISA Kit
DLR-POSTN-Hu-96T 96T
EUR 673
  • Should the Human Periostin (POSTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Periostin (POSTN) in samples from serum, plasma or other biological fluids.

Mouse Periostin (POSTN) ELISA Kit
DLR-POSTN-Mu-48T 48T
EUR 527
  • Should the Mouse Periostin (POSTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Periostin (POSTN) in samples from serum, plasma or other biological fluids.

Mouse Periostin (POSTN) ELISA Kit
DLR-POSTN-Mu-96T 96T
EUR 688
  • Should the Mouse Periostin (POSTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Periostin (POSTN) in samples from serum, plasma or other biological fluids.

Rat Periostin (POSTN) ELISA Kit
DLR-POSTN-Ra-48T 48T
EUR 549
  • Should the Rat Periostin (POSTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Periostin (POSTN) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Periostin (POSTN) ELISA Kit
DLR-POSTN-Ra-96T 96T
EUR 718
  • Should the Rat Periostin (POSTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Periostin (POSTN) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Periostin (POSTN) ELISA Kit
RDR-POSTN-Hu-48Tests 48 Tests
EUR 544

Human Periostin (POSTN) ELISA Kit
RDR-POSTN-Hu-96Tests 96 Tests
EUR 756

Mouse Periostin (POSTN) ELISA Kit
RDR-POSTN-Mu-48Tests 48 Tests
EUR 557

Mouse Periostin (POSTN) ELISA Kit
RDR-POSTN-Mu-96Tests 96 Tests
EUR 774

Rat Periostin (POSTN) ELISA Kit
RDR-POSTN-Ra-48Tests 48 Tests
EUR 583

Rat Periostin (POSTN) ELISA Kit
RDR-POSTN-Ra-96Tests 96 Tests
EUR 811

Human Periostin (POSTN) ELISA Kit
RD-POSTN-Hu-48Tests 48 Tests
EUR 521

Human Periostin (POSTN) ELISA Kit
RD-POSTN-Hu-96Tests 96 Tests
EUR 723

Mouse Periostin (POSTN) ELISA Kit
RD-POSTN-Mu-48Tests 48 Tests
EUR 533

Mouse Periostin (POSTN) ELISA Kit
RD-POSTN-Mu-96Tests 96 Tests
EUR 740

Rat Periostin (POSTN) ELISA Kit
RD-POSTN-Ra-48Tests 48 Tests
EUR 557

Rat Periostin (POSTN) ELISA Kit
RD-POSTN-Ra-96Tests 96 Tests
EUR 775

POSTN Rabbit pAb
A14556-100ul 100 ul
EUR 308

POSTN Rabbit pAb
A14556-200ul 200 ul
EUR 459

POSTN Rabbit pAb
A14556-20ul 20 ul
EUR 183

POSTN Rabbit pAb
A14556-50ul 50 ul
EUR 223

POSTN Rabbit pAb
A2003-100ul 100 ul
EUR 308

POSTN Rabbit pAb
A2003-200ul 200 ul
EUR 459

POSTN Rabbit pAb
A2003-20ul 20 ul
EUR 183

POSTN Rabbit pAb
A2003-50ul 50 ul
EUR 223

Polyclonal POSTN / Periostin Antibody
APR03150G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human POSTN / Periostin . This antibody is tested and proven to work in the following applications:

Polyclonal POSTN Antibody (C-term)
APR03640G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human POSTN (C-term). This antibody is tested and proven to work in the following applications:

POSTN Polyclonal Antibody, FITC Conjugated
A54345 100 µg
EUR 570.55
Description: The best epigenetics products

POSTN Polyclonal Antibody, Biotin Conjugated
A54346 100 µg
EUR 570.55
Description: kits suitable for this type of research

POSTN Polyclonal Antibody, HRP Conjugated
A54347 100 µg
EUR 570.55
Description: fast delivery possible

Periostin (POSTN) Polyclonal Antibody (Mouse)
4-PAH339Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Ser500~Leu630)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periostin (POSTN)

Periostin (POSTN) Polyclonal Antibody (Mouse)
4-PAH339Mu02
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Asp370~Ile494)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periostin (POSTN)

Periostin (POSTN) Polyclonal Antibody (Rat)
4-PAH339Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Asn24~Asn173)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Periostin (POSTN)

Periostin (POSTN) Polyclonal Antibody (Rat)
4-PAH339Ra02
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Arg659~Gln810)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Periostin (POSTN)

POSTN antibody
70R-19425 50 ul
EUR 435
Description: Rabbit polyclonal POSTN antibody

POSTN antibody
70R-15043 100 ul
EUR 392
Description: Rabbit polyclonal POSTN antibody

POSTN antibody
70R-15044 100 ul
EUR 392
Description: Rabbit polyclonal POSTN antibody

POSTN antibody
38331-100ul 100ul
EUR 252

POSTN antibody
10R-5369 100 ul
EUR 726
Description: Mouse monoclonal POSTN antibody

POSTN Antibody
1-CSB-PA09905A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POSTN. Recognizes POSTN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

POSTN Antibody
1-CSB-PA619962ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against POSTN. Recognizes POSTN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

POSTN Antibody
DF6746 200ul
EUR 304
Description: POSTN Antibody detects endogenous levels of total POSTN.

POSTN Antibody
1-CSB-PA018381GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against POSTN. Recognizes POSTN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Postn Antibody
CSB-PA202817-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against Postn. Recognizes Postn from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Postn Antibody
CSB-PA202817-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against Postn. Recognizes Postn from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

POSTN antibody
70R-6066 50 ug
EUR 467
Description: Rabbit polyclonal POSTN antibody raised against the N terminal of POSTN

POSTN antibody
70R-6070 50 ug
EUR 467
Description: Rabbit polyclonal POSTN antibody raised against the middle region of POSTN

POSTN Antibody
ABD6746 100 ug
EUR 438

Periostin (POSTN) Polyclonal Antibody (Human, Rat)
4-PAH339Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Pro97~Leu230)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Periostin (POSTN)

Periostin (POSTN) Polyclonal Antibody (Human, Rat)
4-PAH339Hu02
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Ser500~Leu630)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Periostin (POSTN)

Periostin (POSTN) Polyclonal Antibody (Mouse), APC
4-PAH339Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Ser500~Leu630)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periostin (POSTN). This antibody is labeled with APC.

Periostin (POSTN) Polyclonal Antibody (Mouse), Biotinylated
4-PAH339Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Ser500~Leu630)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periostin (POSTN). This antibody is labeled with Biotin.

Periostin (POSTN) Polyclonal Antibody (Mouse), Cy3
4-PAH339Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Ser500~Leu630)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periostin (POSTN). This antibody is labeled with Cy3.

Periostin (POSTN) Polyclonal Antibody (Mouse), FITC
4-PAH339Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Ser500~Leu630)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periostin (POSTN). This antibody is labeled with FITC.

Periostin (POSTN) Polyclonal Antibody (Mouse), HRP
4-PAH339Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Ser500~Leu630)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periostin (POSTN). This antibody is labeled with HRP.

Periostin (POSTN) Polyclonal Antibody (Mouse), PE
4-PAH339Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Ser500~Leu630)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periostin (POSTN). This antibody is labeled with PE.

Periostin (POSTN) Polyclonal Antibody (Mouse), APC
4-PAH339Mu02-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Asp370~Ile494)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periostin (POSTN). This antibody is labeled with APC.

Periostin (POSTN) Polyclonal Antibody (Mouse), Biotinylated
4-PAH339Mu02-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Asp370~Ile494)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periostin (POSTN). This antibody is labeled with Biotin.

Periostin (POSTN) Polyclonal Antibody (Mouse), Cy3
4-PAH339Mu02-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Asp370~Ile494)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periostin (POSTN). This antibody is labeled with Cy3.

Periostin (POSTN) Polyclonal Antibody (Mouse), FITC
4-PAH339Mu02-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Asp370~Ile494)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periostin (POSTN). This antibody is labeled with FITC.

Periostin (POSTN) Polyclonal Antibody (Mouse), HRP
4-PAH339Mu02-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Asp370~Ile494)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periostin (POSTN). This antibody is labeled with HRP.

Periostin (POSTN) Polyclonal Antibody (Mouse), PE
4-PAH339Mu02-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Asp370~Ile494)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periostin (POSTN). This antibody is labeled with PE.

Periostin (POSTN) Polyclonal Antibody (Rat), APC
4-PAH339Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Asn24~Asn173)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Periostin (POSTN). This antibody is labeled with APC.

Periostin (POSTN) Polyclonal Antibody (Rat), Biotinylated
4-PAH339Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Asn24~Asn173)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Periostin (POSTN). This antibody is labeled with Biotin.

Periostin (POSTN) Polyclonal Antibody (Rat), Cy3
4-PAH339Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Asn24~Asn173)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Periostin (POSTN). This antibody is labeled with Cy3.

Periostin (POSTN) Polyclonal Antibody (Rat), FITC
4-PAH339Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Asn24~Asn173)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Periostin (POSTN). This antibody is labeled with FITC.

Periostin (POSTN) Polyclonal Antibody (Rat), HRP
4-PAH339Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Asn24~Asn173)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Periostin (POSTN). This antibody is labeled with HRP.

Periostin (POSTN) Polyclonal Antibody (Rat), PE
4-PAH339Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Asn24~Asn173)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Periostin (POSTN). This antibody is labeled with PE.

Periostin (POSTN) Polyclonal Antibody (Rat), APC
4-PAH339Ra02-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Arg659~Gln810)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Periostin (POSTN). This antibody is labeled with APC.

Periostin (POSTN) Polyclonal Antibody (Rat), Biotinylated
4-PAH339Ra02-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Arg659~Gln810)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Periostin (POSTN). This antibody is labeled with Biotin.

Periostin (POSTN) Polyclonal Antibody (Rat), Cy3
4-PAH339Ra02-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Arg659~Gln810)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Periostin (POSTN). This antibody is labeled with Cy3.

Periostin (POSTN) Polyclonal Antibody (Rat), FITC
4-PAH339Ra02-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Arg659~Gln810)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Periostin (POSTN). This antibody is labeled with FITC.

Periostin (POSTN) Polyclonal Antibody (Rat), HRP
4-PAH339Ra02-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Arg659~Gln810)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Periostin (POSTN). This antibody is labeled with HRP.

Periostin (POSTN) Polyclonal Antibody (Rat), PE
4-PAH339Ra02-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Arg659~Gln810)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Periostin (POSTN). This antibody is labeled with PE.

Periostin (POSTN) Antibody
abx026531-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Periostin (POSTN) Antibody
abx026531-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Periostin (POSTN) Antibody
20-abx100627
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Periostin (POSTN) Antibody
20-abx100628
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Periostin (POSTN) Antibody
20-abx100629
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Periostin (POSTN) Antibody
20-abx100630
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Periostin (POSTN) Antibody
20-abx100631
  • EUR 342.00
  • EUR 857.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Periostin (POSTN) Antibody
20-abx100632
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Periostin (POSTN) Antibody
abx037124-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Periostin (POSTN) Antibody
20-abx130227
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

POSTN Conjugated Antibody
C38331 100ul
EUR 397

Periostin (POSTN) Antibody
20-abx320356
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Periostin (POSTN) Antibody
abx332108-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Periostin (POSTN) Antibody
20-abx001628
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anti-POSTN antibody
STJ26193 100 µl
EUR 277
Description: This gene encodes a secreted extracellular matrix protein that functions in tissue development and regeneration, including wound healing, and ventricular remodeling following myocardial infarction. The encoded protein binds to integrins to support adhesion and migration of epithelial cells. This protein plays a role in cancer stem cell maintenance and metastasis. Mice lacking this gene exhibit cardiac valve disease, and skeletal and dental defects. Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-POSTN antibody
STJ116767 100 µl
EUR 277
Description: This gene encodes a secreted extracellular matrix protein that functions in tissue development and regeneration, including wound healing, and ventricular remodeling following myocardial infarction. The encoded protein binds to integrins to support adhesion and migration of epithelial cells. This protein plays a role in cancer stem cell maintenance and metastasis. Mice lacking this gene exhibit cardiac valve disease, and skeletal and dental defects. Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-POSTN antibody
STJ192467 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to POSTN

Periostin (POSTN) Polyclonal Antibody (Human, Rat), APC
4-PAH339Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Pro97~Leu230)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Periostin (POSTN). This antibody is labeled with APC.

Periostin (POSTN) Polyclonal Antibody (Human, Rat), Biotinylated
4-PAH339Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Pro97~Leu230)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Periostin (POSTN). This antibody is labeled with Biotin.

Periostin (POSTN) Polyclonal Antibody (Human, Rat), Cy3
4-PAH339Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Pro97~Leu230)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Periostin (POSTN). This antibody is labeled with Cy3.

Periostin (POSTN) Polyclonal Antibody (Human, Rat), FITC
4-PAH339Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Pro97~Leu230)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Periostin (POSTN). This antibody is labeled with FITC.

Periostin (POSTN) Polyclonal Antibody (Human, Rat), HRP
4-PAH339Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Pro97~Leu230)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Periostin (POSTN). This antibody is labeled with HRP.

Periostin (POSTN) Polyclonal Antibody (Human, Rat), PE
4-PAH339Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Pro97~Leu230)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Periostin (POSTN). This antibody is labeled with PE.

Periostin (POSTN) Polyclonal Antibody (Human, Rat), APC
4-PAH339Hu02-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Ser500~Leu630)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Periostin (POSTN). This antibody is labeled with APC.

Periostin (POSTN) Polyclonal Antibody (Human, Rat), Biotinylated
4-PAH339Hu02-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Ser500~Leu630)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Periostin (POSTN). This antibody is labeled with Biotin.

Periostin (POSTN) Polyclonal Antibody (Human, Rat), Cy3
4-PAH339Hu02-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Ser500~Leu630)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Periostin (POSTN). This antibody is labeled with Cy3.

Periostin (POSTN) Polyclonal Antibody (Human, Rat), FITC
4-PAH339Hu02-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Ser500~Leu630)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Periostin (POSTN). This antibody is labeled with FITC.

Periostin (POSTN) Polyclonal Antibody (Human, Rat), HRP
4-PAH339Hu02-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Ser500~Leu630)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Periostin (POSTN). This antibody is labeled with HRP.

Periostin (POSTN) Polyclonal Antibody (Human, Rat), PE
4-PAH339Hu02-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Ser500~Leu630)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Periostin (POSTN). This antibody is labeled with PE.

Periostin (POSTN) Polyclonal Antibody (Mouse), APC-Cy7
4-PAH339Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Ser500~Leu630)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periostin (POSTN). This antibody is labeled with APC-Cy7.

Periostin (POSTN) Polyclonal Antibody (Mouse), APC-Cy7
4-PAH339Mu02-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Asp370~Ile494)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periostin (POSTN). This antibody is labeled with APC-Cy7.

Periostin (POSTN) Polyclonal Antibody (Rat), APC-Cy7
4-PAH339Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Asn24~Asn173)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Periostin (POSTN). This antibody is labeled with APC-Cy7.

Periostin (POSTN) Polyclonal Antibody (Rat), APC-Cy7
4-PAH339Ra02-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Arg659~Gln810)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Periostin (POSTN). This antibody is labeled with APC-Cy7.

POSTN siRNA
20-abx929284
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

POSTN siRNA
20-abx929285
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

POSTN Antibody, HRP conjugated
1-CSB-PA09905B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POSTN. Recognizes POSTN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

POSTN Antibody, FITC conjugated
1-CSB-PA09905C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POSTN. Recognizes POSTN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

POSTN Antibody, Biotin conjugated
1-CSB-PA09905D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POSTN. Recognizes POSTN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-Periostin/Postn Antibody
A01378 100ug/vial
EUR 334

Periostin (POSTN) Antibody (Biotin)
20-abx272405
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Periostin (POSTN) Antibody (Biotin)
20-abx273022
  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Periostin (POSTN) Antibody (Biotin)
20-abx273426
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Periostin (POSTN) Antibody (FITC)
20-abx274630
  • EUR 495.00
  • EUR 258.00
  • EUR 1455.00
  • EUR 676.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Anti-Periostin/POSTN Antibody
PA2048 100ug/vial
EUR 294

Anti-Periostin/POSTN Antibody
PA2048-1 100ug/vial
EUR 294

Periostin (POSTN) Polyclonal Antibody (Human, Rat), APC-Cy7
4-PAH339Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Pro97~Leu230)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Periostin (POSTN). This antibody is labeled with APC-Cy7.

Periostin (POSTN) Polyclonal Antibody (Human, Rat), APC-Cy7
4-PAH339Hu02-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: POSTN (Ser500~Leu630)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Periostin (POSTN). This antibody is labeled with APC-Cy7.

POSTN/OSF-2 (Periostin) Antibody
20-abx110084
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

POSTN/OSF-2 (Periostin) Antibody
20-abx142157
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

POSTN/OSF-2 (Periostin) Antibody
abx236315-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

POSTN/OSF-2 (periostin) Antibody
abx433114-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

POSTN/OSF-2 (periostin) Antibody
abx433115-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

POSTN Blocking Peptide
33R-9848 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of POSTN antibody, catalog no. 70R-6070

POSTN Blocking Peptide
33R-7797 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of POSTN antibody, catalog no. 70R-6066

POSTN Blocking Peptide
DF6746-BP 1mg
EUR 195

POSTN cloning plasmid
CSB-CL619962HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2340
  • Sequence: ATGATTCCCTTTTTACCCATGTTTTCTCTACTATTGCTGCTTATTGTTAACCCTATAAACGCCAACAATCATTATGACAAGATCTTGGCTCATAGTCGTATCAGGGGTCGGGACCAAGGCCCAAATGTCTGTGCCCTTCAACAGATTTTGGGCACCAAAAAGAAATACTTCAGCA
  • Show more
Description: A cloning plasmid for the POSTN gene.

Recombinant Periostin (POSTN)
4-RPH339Hu01
  • EUR 422.56
  • EUR 216.00
  • EUR 1309.60
  • EUR 503.20
  • EUR 906.40
  • EUR 346.00
  • EUR 3124.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q15063
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 16.2kDa
  • Isoelectric Point: 6.6
Description: Recombinant Human Periostin expressed in: E.coli

Recombinant Periostin (POSTN)
4-RPH339Hu02
  • EUR 422.56
  • EUR 216.00
  • EUR 1309.60
  • EUR 503.20
  • EUR 906.40
  • EUR 346.00
  • EUR 3124.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q15063
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Periostin expressed in: E.coli

Recombinant Periostin (POSTN)
4-RPH339Mu01
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q62009
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.9kDa
  • Isoelectric Point: 6.3
Description: Recombinant Mouse Periostin expressed in: E.coli

Recombinant Periostin (POSTN)
4-RPH339Mu02
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q62009
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.3kDa
  • Isoelectric Point: 7.9
Description: Recombinant Mouse Periostin expressed in: E.coli

Recombinant Periostin (POSTN)
4-RPH339Ra01
  • EUR 422.56
  • EUR 216.00
  • EUR 1309.60
  • EUR 503.20
  • EUR 906.40
  • EUR 346.00
  • EUR 3124.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: D3ZAF5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.4kDa
  • Isoelectric Point: 7.7
Description: Recombinant Rat Periostin expressed in: E.coli

Recombinant Periostin (POSTN)
4-RPH339Ra02
  • EUR 422.56
  • EUR 216.00
  • EUR 1309.60
  • EUR 503.20
  • EUR 906.40
  • EUR 346.00
  • EUR 3124.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: D3ZAF5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Periostin expressed in: E.coli

POSTN/OSF-2 (Periostin) Antibody (Biotin)
20-abx105761
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

POSTN/OSF-2 (Periostin) Antibody (FITC)
20-abx107179
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

POSTN/OSF-2 (Periostin) Antibody (HRP)
20-abx108599
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Periostin (POSTN) Monoclonal Antibody (Human, Rat)
4-MAH339Hu21
  • EUR 255.00
  • EUR 2642.00
  • EUR 655.00
  • EUR 322.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Pro97~Leu230
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Rat Periostin (POSTN)

Mouse Periostin (POSTN) Protein
20-abx167186
  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Rat Periostin (POSTN) Protein
20-abx167561
  • EUR 592.00
  • EUR 258.00
  • EUR 1776.00
  • EUR 704.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Periostin (POSTN) Protein
20-abx068464
  • EUR 592.00
  • EUR 258.00
  • EUR 1776.00
  • EUR 704.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Periostin (POSTN) Protein
20-abx068465
  • EUR 578.00
  • EUR 258.00
  • EUR 690.00
  • EUR 425.00
  • EUR 168.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 50 ug
  • 5 ug
  • Shipped within 5-7 working days.

Rat Periostin (POSTN) Protein
20-abx068466
  • EUR 592.00
  • EUR 258.00
  • EUR 1776.00
  • EUR 704.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human Periostin (POSTN) Protein
20-abx068467
  • EUR 592.00
  • EUR 258.00
  • EUR 1776.00
  • EUR 704.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human POSTN ELISA Kit
ELA-E1767h 96 Tests
EUR 824

Mouse POSTN shRNA Plasmid
20-abx974091
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human POSTN shRNA Plasmid
20-abx957242
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

POSTN Recombinant Protein (Human)
RP042367 100 ug Ask for price

POSTN Recombinant Protein (Mouse)
RP163517 100 ug Ask for price

POSTN Recombinant Protein (Mouse)
RP163520 100 ug Ask for price

POSTN Recombinant Protein (Mouse)
RP163523 100 ug Ask for price

POSTN Recombinant Protein (Rat)
RP221459 100 ug Ask for price

POSTN Rabbit Polyclonal Antibody

Apex Business WordPress Theme | Designed by Crafthemes