POSTN Rabbit Polyclonal Antibody

POSTN Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

POSTN Polyclonal Antibody
ABP59973-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human POSTN protein Applications tips:
Description: A polyclonal antibody for detection of POSTN from Human, Mouse. This POSTN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human POSTN protein

POSTN Polyclonal Antibody
ABP59973-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human POSTN protein Applications tips:
Description: A polyclonal antibody for detection of POSTN from Human, Mouse. This POSTN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human POSTN protein

POSTN Polyclonal Antibody
A54348	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

Human Periostin (POSTN) ELISA Kit
DLR-POSTN-Hu-48T	DL Develop	48T	EUR 517
Should the Human Periostin (POSTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Periostin (POSTN) in samples from serum, plasma or other biological fluids.

Human Periostin (POSTN) ELISA Kit
DLR-POSTN-Hu-96T	DL Develop	96T	EUR 673
Should the Human Periostin (POSTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Periostin (POSTN) in samples from serum, plasma or other biological fluids.

Mouse Periostin (POSTN) ELISA Kit
DLR-POSTN-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Periostin (POSTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Periostin (POSTN) in samples from serum, plasma or other biological fluids.

Mouse Periostin (POSTN) ELISA Kit
DLR-POSTN-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Periostin (POSTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Periostin (POSTN) in samples from serum, plasma or other biological fluids.

Rat Periostin (POSTN) ELISA Kit
DLR-POSTN-Ra-48T	DL Develop	48T	EUR 549
Should the Rat Periostin (POSTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Periostin (POSTN) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Periostin (POSTN) ELISA Kit
DLR-POSTN-Ra-96T	DL Develop	96T	EUR 718
Should the Rat Periostin (POSTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Periostin (POSTN) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Periostin (POSTN) ELISA Kit
RD-POSTN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Periostin (POSTN) ELISA Kit
RD-POSTN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Periostin (POSTN) ELISA Kit
RD-POSTN-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Periostin (POSTN) ELISA Kit
RD-POSTN-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Rat Periostin (POSTN) ELISA Kit
RD-POSTN-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Periostin (POSTN) ELISA Kit
RD-POSTN-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Human Periostin (POSTN) ELISA Kit
RDR-POSTN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Periostin (POSTN) ELISA Kit
RDR-POSTN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Periostin (POSTN) ELISA Kit
RDR-POSTN-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Periostin (POSTN) ELISA Kit
RDR-POSTN-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Rat Periostin (POSTN) ELISA Kit
RDR-POSTN-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Periostin (POSTN) ELISA Kit
RDR-POSTN-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

POSTN Rabbit pAb
A2003-100ul	Abclonal	100 ul	EUR 308

POSTN Rabbit pAb
A2003-200ul	Abclonal	200 ul	EUR 459

POSTN Rabbit pAb
A2003-20ul	Abclonal	20 ul	EUR 183

POSTN Rabbit pAb
A2003-50ul	Abclonal	50 ul	EUR 223

POSTN Rabbit pAb
A14556-100ul	Abclonal	100 ul	EUR 308

POSTN Rabbit pAb
A14556-200ul	Abclonal	200 ul	EUR 459

POSTN Rabbit pAb
A14556-20ul	Abclonal	20 ul	EUR 183

POSTN Rabbit pAb
A14556-50ul	Abclonal	50 ul	EUR 223

Polyclonal POSTN / Periostin Antibody
APR03150G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human POSTN / Periostin . This antibody is tested and proven to work in the following applications:

Polyclonal POSTN Antibody (C-term)
APR03640G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human POSTN (C-term). This antibody is tested and proven to work in the following applications:

POSTN Polyclonal Antibody, FITC Conjugated
A54345	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

POSTN Polyclonal Antibody, Biotin Conjugated
A54346	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

POSTN Polyclonal Antibody, HRP Conjugated
A54347	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

Periostin (POSTN) Polyclonal Antibody (Mouse)
4-PAH339Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Ser500~Leu630) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periostin (POSTN)

Periostin (POSTN) Polyclonal Antibody (Mouse)
4-PAH339Mu02	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Asp370~Ile494) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periostin (POSTN)

Periostin (POSTN) Polyclonal Antibody (Rat)
4-PAH339Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Asn24~Asn173) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Periostin (POSTN)

Periostin (POSTN) Polyclonal Antibody (Rat)
4-PAH339Ra02	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Arg659~Gln810) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Periostin (POSTN)

POSTN antibody
70R-6066	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal POSTN antibody raised against the N terminal of POSTN

POSTN antibody
70R-6070	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal POSTN antibody raised against the middle region of POSTN

POSTN Antibody
ABD6746	Lifescience Market	100 ug	EUR 438

POSTN antibody
38331-100ul	SAB	100ul	EUR 252

POSTN antibody
10R-5369	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal POSTN antibody

POSTN antibody
70R-19425	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal POSTN antibody

POSTN antibody
70R-15043	Fitzgerald	100 ul	EUR 392
Description: Rabbit polyclonal POSTN antibody

POSTN antibody
70R-15044	Fitzgerald	100 ul	EUR 392
Description: Rabbit polyclonal POSTN antibody

POSTN Antibody
DF6746	Affbiotech	200ul	EUR 304
Description: POSTN Antibody detects endogenous levels of total POSTN.

POSTN Antibody
1-CSB-PA619962ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against POSTN. Recognizes POSTN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Postn Antibody
CSB-PA202817-	Cusabio		EUR 335
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against Postn. Recognizes Postn from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Postn Antibody
CSB-PA202817-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against Postn. Recognizes Postn from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

POSTN Antibody
1-CSB-PA09905A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POSTN. Recognizes POSTN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

POSTN Antibody
1-CSB-PA018381GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against POSTN. Recognizes POSTN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Periostin (POSTN) Polyclonal Antibody (Human, Rat)
4-PAH339Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Pro97~Leu230) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Periostin (POSTN)

Periostin (POSTN) Polyclonal Antibody (Human, Rat)
4-PAH339Hu02	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Ser500~Leu630) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Periostin (POSTN)

Periostin (POSTN) Polyclonal Antibody (Mouse), APC
4-PAH339Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Ser500~Leu630) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periostin (POSTN). This antibody is labeled with APC.

Periostin (POSTN) Polyclonal Antibody (Mouse), Biotinylated
4-PAH339Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Ser500~Leu630) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periostin (POSTN). This antibody is labeled with Biotin.

Periostin (POSTN) Polyclonal Antibody (Mouse), Cy3
4-PAH339Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Ser500~Leu630) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periostin (POSTN). This antibody is labeled with Cy3.

Periostin (POSTN) Polyclonal Antibody (Mouse), FITC
4-PAH339Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Ser500~Leu630) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periostin (POSTN). This antibody is labeled with FITC.

Periostin (POSTN) Polyclonal Antibody (Mouse), HRP
4-PAH339Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Ser500~Leu630) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periostin (POSTN). This antibody is labeled with HRP.

Periostin (POSTN) Polyclonal Antibody (Mouse), PE
4-PAH339Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Ser500~Leu630) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periostin (POSTN). This antibody is labeled with PE.

Periostin (POSTN) Polyclonal Antibody (Mouse), APC
4-PAH339Mu02-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Asp370~Ile494) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periostin (POSTN). This antibody is labeled with APC.

Periostin (POSTN) Polyclonal Antibody (Mouse), Biotinylated
4-PAH339Mu02-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Asp370~Ile494) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periostin (POSTN). This antibody is labeled with Biotin.

Periostin (POSTN) Polyclonal Antibody (Mouse), Cy3
4-PAH339Mu02-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Asp370~Ile494) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periostin (POSTN). This antibody is labeled with Cy3.

Periostin (POSTN) Polyclonal Antibody (Mouse), FITC
4-PAH339Mu02-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Asp370~Ile494) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periostin (POSTN). This antibody is labeled with FITC.

Periostin (POSTN) Polyclonal Antibody (Mouse), HRP
4-PAH339Mu02-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Asp370~Ile494) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periostin (POSTN). This antibody is labeled with HRP.

Periostin (POSTN) Polyclonal Antibody (Mouse), PE
4-PAH339Mu02-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Asp370~Ile494) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periostin (POSTN). This antibody is labeled with PE.

Periostin (POSTN) Polyclonal Antibody (Rat), APC
4-PAH339Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Asn24~Asn173) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Periostin (POSTN). This antibody is labeled with APC.

Periostin (POSTN) Polyclonal Antibody (Rat), Biotinylated
4-PAH339Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Asn24~Asn173) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Periostin (POSTN). This antibody is labeled with Biotin.

Periostin (POSTN) Polyclonal Antibody (Rat), Cy3
4-PAH339Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Asn24~Asn173) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Periostin (POSTN). This antibody is labeled with Cy3.

Periostin (POSTN) Polyclonal Antibody (Rat), FITC
4-PAH339Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Asn24~Asn173) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Periostin (POSTN). This antibody is labeled with FITC.

Periostin (POSTN) Polyclonal Antibody (Rat), HRP
4-PAH339Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Asn24~Asn173) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Periostin (POSTN). This antibody is labeled with HRP.

Periostin (POSTN) Polyclonal Antibody (Rat), PE
4-PAH339Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Asn24~Asn173) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Periostin (POSTN). This antibody is labeled with PE.

Periostin (POSTN) Polyclonal Antibody (Rat), APC
4-PAH339Ra02-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Arg659~Gln810) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Periostin (POSTN). This antibody is labeled with APC.

Periostin (POSTN) Polyclonal Antibody (Rat), Biotinylated
4-PAH339Ra02-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Arg659~Gln810) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Periostin (POSTN). This antibody is labeled with Biotin.

Periostin (POSTN) Polyclonal Antibody (Rat), Cy3
4-PAH339Ra02-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Arg659~Gln810) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Periostin (POSTN). This antibody is labeled with Cy3.

Periostin (POSTN) Polyclonal Antibody (Rat), FITC
4-PAH339Ra02-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Arg659~Gln810) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Periostin (POSTN). This antibody is labeled with FITC.

Periostin (POSTN) Polyclonal Antibody (Rat), HRP
4-PAH339Ra02-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Arg659~Gln810) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Periostin (POSTN). This antibody is labeled with HRP.

Periostin (POSTN) Polyclonal Antibody (Rat), PE
4-PAH339Ra02-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Arg659~Gln810) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Periostin (POSTN). This antibody is labeled with PE.

POSTN Conjugated Antibody
C38331	SAB	100ul	EUR 397

Periostin (POSTN) Antibody
20-abx130227	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Periostin (POSTN) Antibody
20-abx001628	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Periostin (POSTN) Antibody
abx037124-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Periostin (POSTN) Antibody
20-abx100627	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Periostin (POSTN) Antibody
20-abx100628	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Periostin (POSTN) Antibody
20-abx100629	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Periostin (POSTN) Antibody
20-abx100630	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Periostin (POSTN) Antibody
20-abx100631	Abbexa	EUR 342.00 EUR 857.00 EUR 439.00 EUR 154.00 EUR 258.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

Periostin (POSTN) Antibody
20-abx100632	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Periostin (POSTN) Antibody
abx026531-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Periostin (POSTN) Antibody
abx026531-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Periostin (POSTN) Antibody
20-abx320356	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Periostin (POSTN) Antibody
abx332108-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Anti-POSTN antibody
STJ26193	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a secreted extracellular matrix protein that functions in tissue development and regeneration, including wound healing, and ventricular remodeling following myocardial infarction. The encoded protein binds to integrins to support adhesion and migration of epithelial cells. This protein plays a role in cancer stem cell maintenance and metastasis. Mice lacking this gene exhibit cardiac valve disease, and skeletal and dental defects. Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-POSTN antibody
STJ116767	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a secreted extracellular matrix protein that functions in tissue development and regeneration, including wound healing, and ventricular remodeling following myocardial infarction. The encoded protein binds to integrins to support adhesion and migration of epithelial cells. This protein plays a role in cancer stem cell maintenance and metastasis. Mice lacking this gene exhibit cardiac valve disease, and skeletal and dental defects. Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-POSTN antibody
STJ192467	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to POSTN

Periostin (POSTN) Polyclonal Antibody (Human, Rat), APC
4-PAH339Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Pro97~Leu230) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Periostin (POSTN). This antibody is labeled with APC.

Periostin (POSTN) Polyclonal Antibody (Human, Rat), Biotinylated
4-PAH339Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Pro97~Leu230) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Periostin (POSTN). This antibody is labeled with Biotin.

Periostin (POSTN) Polyclonal Antibody (Human, Rat), Cy3
4-PAH339Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Pro97~Leu230) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Periostin (POSTN). This antibody is labeled with Cy3.

Periostin (POSTN) Polyclonal Antibody (Human, Rat), FITC
4-PAH339Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Pro97~Leu230) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Periostin (POSTN). This antibody is labeled with FITC.

Periostin (POSTN) Polyclonal Antibody (Human, Rat), HRP
4-PAH339Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Pro97~Leu230) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Periostin (POSTN). This antibody is labeled with HRP.

Periostin (POSTN) Polyclonal Antibody (Human, Rat), PE
4-PAH339Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Pro97~Leu230) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Periostin (POSTN). This antibody is labeled with PE.

Periostin (POSTN) Polyclonal Antibody (Human, Rat), APC
4-PAH339Hu02-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Ser500~Leu630) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Periostin (POSTN). This antibody is labeled with APC.

Periostin (POSTN) Polyclonal Antibody (Human, Rat), Biotinylated
4-PAH339Hu02-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Ser500~Leu630) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Periostin (POSTN). This antibody is labeled with Biotin.

Periostin (POSTN) Polyclonal Antibody (Human, Rat), Cy3
4-PAH339Hu02-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Ser500~Leu630) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Periostin (POSTN). This antibody is labeled with Cy3.

Periostin (POSTN) Polyclonal Antibody (Human, Rat), FITC
4-PAH339Hu02-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Ser500~Leu630) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Periostin (POSTN). This antibody is labeled with FITC.

Periostin (POSTN) Polyclonal Antibody (Human, Rat), HRP
4-PAH339Hu02-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Ser500~Leu630) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Periostin (POSTN). This antibody is labeled with HRP.

Periostin (POSTN) Polyclonal Antibody (Human, Rat), PE
4-PAH339Hu02-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Ser500~Leu630) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Periostin (POSTN). This antibody is labeled with PE.

Periostin (POSTN) Polyclonal Antibody (Mouse), APC-Cy7
4-PAH339Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Ser500~Leu630) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periostin (POSTN). This antibody is labeled with APC-Cy7.

Periostin (POSTN) Polyclonal Antibody (Mouse), APC-Cy7
4-PAH339Mu02-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Asp370~Ile494) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periostin (POSTN). This antibody is labeled with APC-Cy7.

Periostin (POSTN) Polyclonal Antibody (Rat), APC-Cy7
4-PAH339Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Asn24~Asn173) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Periostin (POSTN). This antibody is labeled with APC-Cy7.

Periostin (POSTN) Polyclonal Antibody (Rat), APC-Cy7
4-PAH339Ra02-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Arg659~Gln810) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Periostin (POSTN). This antibody is labeled with APC-Cy7.

POSTN siRNA
20-abx929284	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

POSTN siRNA
20-abx929285	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Periostin (POSTN) Antibody (Biotin)
20-abx273426	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Periostin (POSTN) Antibody (FITC)
20-abx274630	Abbexa	EUR 495.00 EUR 258.00 EUR 1455.00 EUR 676.00 EUR 398.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Periostin (POSTN) Antibody (Biotin)
20-abx272405	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Periostin (POSTN) Antibody (Biotin)
20-abx273022	Abbexa	EUR 467.00 EUR 244.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Anti-Periostin/Postn Antibody
A01378	BosterBio	100ug/vial	EUR 334

POSTN Antibody, HRP conjugated
1-CSB-PA09905B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POSTN. Recognizes POSTN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

POSTN Antibody, FITC conjugated
1-CSB-PA09905C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POSTN. Recognizes POSTN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

POSTN Antibody, Biotin conjugated
1-CSB-PA09905D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POSTN. Recognizes POSTN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-Periostin/POSTN Antibody
PA2048	BosterBio	100ug/vial	EUR 294

Anti-Periostin/POSTN Antibody
PA2048-1	BosterBio	100ug/vial	EUR 294

Periostin (POSTN) Polyclonal Antibody (Human, Rat), APC-Cy7
4-PAH339Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Pro97~Leu230) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Periostin (POSTN). This antibody is labeled with APC-Cy7.

Periostin (POSTN) Polyclonal Antibody (Human, Rat), APC-Cy7
4-PAH339Hu02-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: POSTN (Ser500~Leu630) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Periostin (POSTN). This antibody is labeled with APC-Cy7.

POSTN/OSF-2 (Periostin) Antibody
20-abx110084	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

POSTN/OSF-2 (Periostin) Antibody
20-abx142157	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

POSTN/OSF-2 (periostin) Antibody
abx433114-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

POSTN/OSF-2 (periostin) Antibody
abx433115-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

POSTN/OSF-2 (Periostin) Antibody
abx236315-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

POSTN Blocking Peptide
33R-9848	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of POSTN antibody, catalog no. 70R-6070

POSTN Blocking Peptide
33R-7797	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of POSTN antibody, catalog no. 70R-6066

POSTN Blocking Peptide
DF6746-BP	Affbiotech	1mg	EUR 195

POSTN cloning plasmid
CSB-CL619962HU-10ug	Cusabio	10ug	EUR 474
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2340 Sequence: ATGATTCCCTTTTTACCCATGTTTTCTCTACTATTGCTGCTTATTGTTAACCCTATAAACGCCAACAATCATTATGACAAGATCTTGGCTCATAGTCGTATCAGGGGTCGGGACCAAGGCCCAAATGTCTGTGCCCTTCAACAGATTTTGGGCACCAAAAAGAAATACTTCAGCA Show more
Description: A cloning plasmid for the POSTN gene.

Recombinant Periostin (POSTN)
4-RPH339Hu01	Cloud-Clone	EUR 422.56 EUR 216.00 EUR 1309.60 EUR 503.20 EUR 906.40 EUR 346.00 EUR 3124.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q15063 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 16.2kDa Isoelectric Point: 6.6
Description: Recombinant Human Periostin expressed in: E.coli

Recombinant Periostin (POSTN)
4-RPH339Hu02	Cloud-Clone	EUR 422.56 EUR 216.00 EUR 1309.60 EUR 503.20 EUR 906.40 EUR 346.00 EUR 3124.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q15063 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 18.4kDa Isoelectric Point: Inquire
Description: Recombinant Human Periostin expressed in: E.coli

Recombinant Periostin (POSTN)
4-RPH339Mu01	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q62009 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 15.9kDa Isoelectric Point: 6.3
Description: Recombinant Mouse Periostin expressed in: E.coli

Recombinant Periostin (POSTN)
4-RPH339Mu02	Cloud-Clone	EUR 368.80 EUR 202.00 EUR 1108.00 EUR 436.00 EUR 772.00 EUR 310.00 EUR 2620.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q62009 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 15.3kDa Isoelectric Point: 7.9
Description: Recombinant Mouse Periostin expressed in: E.coli

Recombinant Periostin (POSTN)
4-RPH339Ra01	Cloud-Clone	EUR 422.56 EUR 216.00 EUR 1309.60 EUR 503.20 EUR 906.40 EUR 346.00 EUR 3124.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: D3ZAF5 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 18.4kDa Isoelectric Point: 7.7
Description: Recombinant Rat Periostin expressed in: E.coli

Recombinant Periostin (POSTN)
4-RPH339Ra02	Cloud-Clone	EUR 422.56 EUR 216.00 EUR 1309.60 EUR 503.20 EUR 906.40 EUR 346.00 EUR 3124.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: D3ZAF5 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 18.7kDa Isoelectric Point: Inquire
Description: Recombinant Rat Periostin expressed in: E.coli

POSTN/OSF-2 (Periostin) Antibody (HRP)
20-abx108599	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

POSTN/OSF-2 (Periostin) Antibody (Biotin)
20-abx105761	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

POSTN/OSF-2 (Periostin) Antibody (FITC)
20-abx107179	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Periostin (POSTN) Monoclonal Antibody (Human, Rat)
4-MAH339Hu21	Cloud-Clone	EUR 255.00 EUR 2642.00 EUR 655.00 EUR 322.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Pro97~Leu230 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Rat Periostin (POSTN)

Mouse POSTN shRNA Plasmid
20-abx974091	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human POSTN ELISA Kit
ELA-E1767h	Lifescience Market	96 Tests	EUR 824

Human Periostin (POSTN) Protein
20-abx068464	Abbexa	EUR 592.00 EUR 258.00 EUR 1776.00 EUR 704.00 EUR 439.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Periostin (POSTN) Protein
20-abx068465	Abbexa	EUR 578.00 EUR 258.00 EUR 690.00 EUR 425.00 EUR 168.00	100 ug 10 ug 200 ug 50 ug 5 ug
Shipped within 5-7 working days.

Rat Periostin (POSTN) Protein
20-abx068466	Abbexa	EUR 592.00 EUR 258.00 EUR 1776.00 EUR 704.00 EUR 439.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Human Periostin (POSTN) Protein
20-abx068467	Abbexa	EUR 592.00 EUR 258.00 EUR 1776.00 EUR 704.00 EUR 439.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rat Periostin (POSTN) Protein
20-abx167561	Abbexa	EUR 592.00 EUR 258.00 EUR 1776.00 EUR 704.00 EUR 439.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Periostin (POSTN) Protein
20-abx167186	Abbexa	EUR 523.00 EUR 244.00 EUR 1497.00 EUR 606.00 EUR 384.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Human POSTN shRNA Plasmid
20-abx957242	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

POSTN Recombinant Protein (Human)
RP042367	ABM	100 ug	Ask for price

POSTN Recombinant Protein (Rat)
RP221459	ABM	100 ug	Ask for price

POSTN Recombinant Protein (Mouse)
RP163517	ABM	100 ug	Ask for price

POSTN Recombinant Protein (Mouse)
RP163520	ABM	100 ug	Ask for price

POSTN Recombinant Protein (Mouse)
RP163523	ABM	100 ug	Ask for price

POSTN Rabbit Polyclonal Antibody