HBEGF Rabbit Polyclonal Antibody
HBEGF Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
HBEGF Polyclonal Antibody |
ABP58755-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human HBEGF protein at amino acid sequence of 130-210
- Applications tips:
|
Description: A polyclonal antibody for detection of HBEGF from Human, Mouse, Rat. This HBEGF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HBEGF protein at amino acid sequence of 130-210 |
HBEGF Polyclonal Antibody |
ABP58755-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human HBEGF protein at amino acid sequence of 130-210
- Applications tips:
|
Description: A polyclonal antibody for detection of HBEGF from Human, Mouse, Rat. This HBEGF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HBEGF protein at amino acid sequence of 130-210 |
HBEGF Polyclonal Antibody |
A69147 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: kits suitable for this type of research |
HBEGF Polyclonal Antibody |
29821-100ul |
SAB |
100ul |
EUR 252 |
HBEGF Polyclonal Antibody |
29821-50ul |
SAB |
50ul |
EUR 187 |
HBEGF Polyclonal Antibody |
29957-100ul |
SAB |
100ul |
EUR 252 |
HBEGF Polyclonal Antibody |
29957-50ul |
SAB |
50ul |
EUR 187 |
HBEGF Rabbit pAb |
A16365-100ul |
Abclonal |
100 ul |
EUR 308 |
HBEGF Rabbit pAb |
A16365-200ul |
Abclonal |
200 ul |
EUR 459 |
HBEGF Rabbit pAb |
A16365-20ul |
Abclonal |
20 ul |
EUR 183 |
HBEGF Rabbit pAb |
A16365-50ul |
Abclonal |
50 ul |
EUR 223 |
HBEGF Rabbit pAb |
A1695-100ul |
Abclonal |
100 ul |
EUR 308 |
HBEGF Rabbit pAb |
A1695-200ul |
Abclonal |
200 ul |
EUR 459 |
HBEGF Rabbit pAb |
A1695-20ul |
Abclonal |
20 ul |
EUR 183 |
HBEGF Rabbit pAb |
A1695-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal HBEGF Antibody (Center) |
APR04021G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HBEGF (Center). This antibody is tested and proven to work in the following applications: |
HBEGF Polyclonal Conjugated Antibody |
C29821 |
SAB |
100ul |
EUR 397 |
HBEGF Polyclonal Conjugated Antibody |
C29957 |
SAB |
100ul |
EUR 397 |
HBEGF Polyclonal Antibody, HRP Conjugated |
A69148 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: fast delivery possible |
HBEGF Polyclonal Antibody, FITC Conjugated |
A69149 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: reagents widely cited |
HBEGF Polyclonal Antibody, Biotin Conjugated |
A69150 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: Ask the seller for details |
HBEGF Antibody |
1-CSB-PA857429LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HBEGF. Recognizes HBEGF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:20-1:200 |
Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit |
DLR-HBEGF-Hu-48T |
DL Develop |
48T |
EUR 388 |
- Should the Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit |
DLR-HBEGF-Hu-96T |
DL Develop |
96T |
EUR 496 |
- Should the Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit |
DLR-HBEGF-Mu-48T |
DL Develop |
48T |
EUR 396 |
- Should the Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit |
DLR-HBEGF-Mu-96T |
DL Develop |
96T |
EUR 508 |
- Should the Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit |
DLR-HBEGF-Ra-48T |
DL Develop |
48T |
EUR 413 |
- Should the Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit |
DLR-HBEGF-Ra-96T |
DL Develop |
96T |
EUR 531 |
- Should the Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit |
RD-HBEGF-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 375 |
Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit |
RD-HBEGF-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 515 |
Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit |
RD-HBEGF-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 385 |
Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit |
RD-HBEGF-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 528 |
Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit |
RD-HBEGF-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 404 |
Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit |
RD-HBEGF-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 556 |
Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit |
RDR-HBEGF-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 391 |
Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit |
RDR-HBEGF-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 538 |
Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit |
RDR-HBEGF-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 402 |
Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit |
RDR-HBEGF-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 552 |
Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit |
RDR-HBEGF-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 422 |
Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit |
RDR-HBEGF-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 581 |
Anti-HBEGF antibody |
STJ192414 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to HBEGF |
HBEGF siRNA |
20-abx902420 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HBEGF Protein |
20-abx260393 |
Abbexa |
-
EUR 230.00
-
EUR 1970.00
-
EUR 328.00
|
|
- Shipped within 5-10 working days.
|
HBEGF Protein |
20-abx261848 |
Abbexa |
-
EUR 328.00
-
EUR 4448.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
HBEGF Protein |
20-abx263497 |
Abbexa |
-
EUR 230.00
-
EUR 1790.00
-
EUR 328.00
|
|
- Shipped within 5-10 working days.
|
HBEGF Protein |
20-abx263499 |
Abbexa |
-
EUR 230.00
-
EUR 1790.00
-
EUR 328.00
|
|
- Shipped within 5-10 working days.
|
HBEGF siRNA |
20-abx919127 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HBEGF siRNA |
20-abx919128 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HBEGF Antibody, HRP conjugated |
1-CSB-PA857429LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HBEGF. Recognizes HBEGF from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
HBEGF Antibody, FITC conjugated |
1-CSB-PA857429LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HBEGF. Recognizes HBEGF from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
HBEGF Antibody, Biotin conjugated |
1-CSB-PA857429LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HBEGF. Recognizes HBEGF from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
HBEGF cloning plasmid |
CSB-CL857429HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 627
- Sequence: atgaagctgctgccgtcggtggtgctgaagctctttctggctgcagttctctcggcactggtgactggcgagagcctggagcggcttcggagagggctagctgctggaaccagcaacccggaccctcccactgtatccacggaccagctgctacccctaggaggcggccgggaccg
- Show more
|
Description: A cloning plasmid for the HBEGF gene. |
Rat HBEGF shRNA Plasmid |
20-abx985022 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Anserini HBEGF ELISA Kit |
EAH0045 |
Abclonal |
96Tests |
EUR 521 |
Human HBEGF shRNA Plasmid |
20-abx951287 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
HBEGF protein (His tag) |
80R-2915 |
Fitzgerald |
50 ug |
EUR 327 |
Description: Purified recombinant HBEGF protein (His tag) |
HBEGF protein (His tag) |
80R-3462 |
Fitzgerald |
50 ug |
EUR 257 |
Description: Purified recombinant HBEGF protein (His tag) |
Mouse HBEGF shRNA Plasmid |
20-abx970775 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human HBEGF ELISA kit |
LF-EK50781 |
Abfrontier |
1×96T |
EUR 648 |
Rabbit heparin binding EGF like growth factor (HBEGF) ELISA kit |
E04H1364-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit heparin binding EGF like growth factor (HBEGF) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit heparin binding EGF like growth factor (HBEGF) ELISA kit |
E04H1364-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit heparin binding EGF like growth factor (HBEGF) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit heparin binding EGF like growth factor (HBEGF) ELISA kit |
E04H1364-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit heparin binding EGF like growth factor (HBEGF) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Human HBEGF |
EK5330 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human HBEGF in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human HBEGF PicoKine ELISA Kit |
EK0770 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human HBEGF in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA). |
HBEGF protein (Mouse) (His tag) |
80R-3461 |
Fitzgerald |
50 ug |
EUR 257 |
Description: Purified recombinant HBEGF protein (Mouse) (His tag) |
HBEGF ORF Vector (Human) (pORF) |
ORF004813 |
ABM |
1.0 ug DNA |
EUR 95 |
Hbegf ORF Vector (Rat) (pORF) |
ORF068089 |
ABM |
1.0 ug DNA |
EUR 506 |
h HBEGF inducible lentiviral particles |
LVP721 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made over-expression lentivirus for expressing human target: h HBEGF (heparin-binding EGF-like growth factor), [alternative names: DTR; DTS; DTSF; HEGFL]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_001945. It also contains a RFP-Blasticidin dual selection marker. |
Hbegf ORF Vector (Mouse) (pORF) |
ORF047006 |
ABM |
1.0 ug DNA |
EUR 506 |
HBEGF ELISA Kit (Human) (OKAN04671) |
OKAN04671 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.4 pg/mL |
HBEGF ELISA Kit (Mouse) (OKAN06622) |
OKAN06622 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.1 pg/mL |
HBEGF ELISA Kit (Human) (OKBB00436) |
OKBB00436 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: HBEGF (Heparin-binding EGF-like growth factor), also known as HEGFL or DTR, is a member of the EGF family of proteins that in humans is encoded by the HBEGF gene. The HBEGF gene is assigned to chromosome 5, thus confirming the assignment of the gene on the basis of its role in relation to diphtheria toxin susceptibility. HB-EGF is an 87 amino acid glycoprotein which displays highly regulated gene expression. It has been shown to play a role in wound healing, cardiac hypertrophy and heart development and function. HB-EGF binding and activation of EGF receptors plays a critical role during cardiac valve tissue development and the maintenance of normal heart function in adults. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 10 pg/mL |
HBEGF ELISA Kit (Human) (OKCD07421) |
OKCD07421 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: HBEGF is a growth factor that mediates its effects via EGFR, ERBB2 and ERBB4. It is required for normal cardiac valve formation and normal heart function. HBEGF promotes smooth muscle cell proliferation. It may be involved in macrophage-mediated cellular proliferation. It is mitogenic for fibroblasts, but not endothelial cells. It is able to bind EGF receptor/EGFR with higher affinity than EGF itself and is a far more potent mitogen for smooth muscle cells than EGF. It also acts as a diphtheria toxin receptor.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 6.4pg/mL |
HBEGF ELISA Kit (Mouse) (OKCD07422) |
OKCD07422 |
Aviva Systems Biology |
96 Wells |
EUR 701 |
Description: Description of target: Growth factor that mediates its effects via EGFR, ERBB2 and ERBB4. Required for normal cardiac valve formation and normal heart function. Promotes smooth muscle cell proliferation. May be involved in macrophage-mediated cellular proliferation. It is mitogenic for fibroblasts, but not endothelial cells. It is able to bind EGF receptor/EGFR with higher affinity than EGF itself and is a far more potent mitogen for smooth muscle cells than EGF. Also acts as a diphtheria toxin receptor.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 6.1pg/mL |
HBEGF ELISA Kit (Rat) (OKCD07423) |
OKCD07423 |
Aviva Systems Biology |
96 Wells |
EUR 727 |
Description: Description of target: activates epidermal growth factor receptor mediated signaling; contributes to neuronal survival; may play a role in neurogenesis during ventral midbrain development.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 6.1pg/mL |
HBEGF ELISA Kit (Pig) (OKEH01049) |
OKEH01049 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.4 pg/mL |
HBEGF ELISA Kit (Mouse) (OKEH04470) |
OKEH04470 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Growth factor that mediates its effects via EGFR, ERBB2 and ERBB4. Required for normal cardiac valve formation and normal heart function. Promotes smooth muscle cell proliferation. May be involved in macrophage-mediated cellular proliferation. It is mitogenic for fibroblasts, but not endothelial cells. It is able to bind EGF receptor/EGFR with higher affinity than EGF itself and is a far more potent mitogen for smooth muscle cells than EGF. Also acts as a diphtheria toxin receptor.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 8.01 pg/mL |
HBEGF ELISA Kit (Rat) (OKEH06415) |
OKEH06415 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Growth factor that mediates its effects via EGFR, ERBB2 and ERBB4. Required for normal cardiac valve formation and normal heart function. Promotes smooth muscle cell proliferation. May be involved in macrophage-mediated cellular proliferation. It is mitogenic for fibroblasts, but not endothelial cells. It is able to bind EGF receptor/EGFR with higher affinity than EGF itself and is a far more potent mitogen for smooth muscle cells than EGF. Also acts as a diphtheria toxin receptor.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL |
Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Human) |
4-PAB479Hu01 |
Cloud-Clone |
-
EUR 217.00
-
EUR 2048.00
-
EUR 520.00
-
EUR 268.00
-
EUR 201.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HBEGF (Val21~Thr160)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) |
Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Mouse) |
4-PAB479Mu01 |
Cloud-Clone |
-
EUR 221.00
-
EUR 2100.00
-
EUR 532.00
-
EUR 272.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HBEGF (Ser25~Thr160)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) |
Proheparin-Binding EGF-Like Growth Factor (HBEGF) Antibody |
20-abx006691 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Proheparin-Binding EGF-Like Growth Factor (HBEGF) Antibody |
abx028334-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Proheparin-Binding EGF-Like Growth Factor (HBEGF) Antibody |
abx028334-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Heparin Binding EGF Like Growth Factor (HBEGF) Antibody |
20-abx333738 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Human), APC |
4-PAB479Hu01-APC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2645.00
-
EUR 755.00
-
EUR 377.00
-
EUR 200.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HBEGF (Val21~Thr160)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with APC. |
Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Human), Biotinylated |
4-PAB479Hu01-Biotin |
Cloud-Clone |
-
EUR 279.00
-
EUR 1998.00
-
EUR 612.00
-
EUR 334.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HBEGF (Val21~Thr160)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with Biotin. |
Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Human), Cy3 |
4-PAB479Hu01-Cy3 |
Cloud-Clone |
-
EUR 360.00
-
EUR 3485.00
-
EUR 965.00
-
EUR 461.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HBEGF (Val21~Thr160)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with Cy3. |
Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Human), FITC |
4-PAB479Hu01-FITC |
Cloud-Clone |
-
EUR 261.00
-
EUR 2136.00
-
EUR 624.00
-
EUR 321.00
-
EUR 180.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HBEGF (Val21~Thr160)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with FITC. |
Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Human), HRP |
4-PAB479Hu01-HRP |
Cloud-Clone |
-
EUR 277.00
-
EUR 2309.00
-
EUR 671.00
-
EUR 343.00
-
EUR 190.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HBEGF (Val21~Thr160)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with HRP. |
Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Human), PE |
4-PAB479Hu01-PE |
Cloud-Clone |
-
EUR 261.00
-
EUR 2136.00
-
EUR 624.00
-
EUR 321.00
-
EUR 180.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HBEGF (Val21~Thr160)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with PE. |
Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Mouse), APC |
4-PAB479Mu01-APC |
Cloud-Clone |
-
EUR 306.00
-
EUR 2717.00
-
EUR 773.00
-
EUR 384.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HBEGF (Ser25~Thr160)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with APC. |
Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Mouse), Biotinylated |
4-PAB479Mu01-Biotin |
Cloud-Clone |
-
EUR 283.00
-
EUR 2050.00
-
EUR 625.00
-
EUR 340.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HBEGF (Ser25~Thr160)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with Biotin. |
Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Mouse), Cy3 |
4-PAB479Mu01-Cy3 |
Cloud-Clone |
-
EUR 367.00
-
EUR 3581.00
-
EUR 989.00
-
EUR 470.00
-
EUR 228.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HBEGF (Ser25~Thr160)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with Cy3. |
Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Mouse), FITC |
4-PAB479Mu01-FITC |
Cloud-Clone |
-
EUR 265.00
-
EUR 2193.00
-
EUR 638.00
-
EUR 327.00
-
EUR 181.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HBEGF (Ser25~Thr160)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with FITC. |
Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Mouse), HRP |
4-PAB479Mu01-HRP |
Cloud-Clone |
-
EUR 282.00
-
EUR 2371.00
-
EUR 686.00
-
EUR 349.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HBEGF (Ser25~Thr160)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with HRP. |
Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Mouse), PE |
4-PAB479Mu01-PE |
Cloud-Clone |
-
EUR 265.00
-
EUR 2193.00
-
EUR 638.00
-
EUR 327.00
-
EUR 181.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HBEGF (Ser25~Thr160)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with PE. |
HBEGF sgRNA CRISPR Lentivector set (Human) |
K0932001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Hbegf sgRNA CRISPR Lentivector set (Mouse) |
K3988501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Hbegf sgRNA CRISPR Lentivector set (Rat) |
K7619701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human HBEGF ELISA kit (4×96T) |
LF-EK50782 |
Abfrontier |
4×96T |
EUR 2201 |
HBEGF Rabbit Polyclonal Antibody