FKBP2 Rabbit Polyclonal Antibody

FKBP2 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

FKBP2 Polyclonal Antibody

ABP58562-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FKBP2 protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of FKBP2 from Human, Mouse. This FKBP2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FKBP2 protein at amino acid sequence of 80-160

FKBP2 Polyclonal Antibody

31443-100ul 100ul
EUR 252

FKBP2 Polyclonal Antibody

31443-50ul 50ul
EUR 187

FKBP2 Rabbit pAb

A11845-100ul 100 ul
EUR 308

FKBP2 Rabbit pAb

A11845-200ul 200 ul
EUR 459

FKBP2 Rabbit pAb

A11845-20ul 20 ul Ask for price

FKBP2 Rabbit pAb

A11845-50ul 50 ul Ask for price

FKBP2 Rabbit pAb

A8120-100ul 100 ul
EUR 308

FKBP2 Rabbit pAb

A8120-200ul 200 ul
EUR 459

FKBP2 Rabbit pAb

A8120-20ul 20 ul
EUR 183

FKBP2 Rabbit pAb

A8120-50ul 50 ul
EUR 223

FKBP2 Polyclonal Conjugated Antibody

C31443 100ul
EUR 397

FKBP2 antibody

70R-5298 50 ug
EUR 467
Description: Rabbit polyclonal FKBP2 antibody raised against the N terminal of FKBP2

FKBP2 antibody

70R-17310 50 ul
EUR 435
Description: Rabbit polyclonal FKBP2 antibody

FKBP2 Antibody

1-CSB-PA008698ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FKBP2. Recognizes FKBP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

FKBP2 Antibody

1-CSB-PA008698ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FKBP2. Recognizes FKBP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200

FKBP2 Antibody

1-CSB-PA008698GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FKBP2. Recognizes FKBP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Polyclonal FKBP2 Antibody (N-term)

APR15987G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FKBP2 (N-term). This antibody is tested and proven to work in the following applications:

anti- FKBP2 antibody

FNab03138 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:100 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: FK506 binding protein 2, 13kDa
  • Uniprot ID: P26885
  • Gene ID: 2286
  • Research Area: Metabolism
Description: Antibody raised against FKBP2

anti- FKBP2 antibody

FNab03139 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:50-1:500
  • Immunogen: FK506 binding protein 2, 13kDa
  • Uniprot ID: P26885
  • Gene ID: 2286
  • Research Area: Metabolism
Description: Antibody raised against FKBP2

Human FKBP2 Antibody

32851-05111 150 ug
EUR 261

Anti-FKBP2 antibody

PAab03138 100 ug
EUR 355

Anti-FKBP2 antibody

STJ110419 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin. It is thought to function as an ER chaperone and may also act as a component of membrane cytoskeletal scaffolds. Multiple alternatively spliced variants, encoding the same protein, have been identified.

Anti-FKBP2 antibody

STJ113424 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin. It is thought to function as an ER chaperone and may also act as a component of membrane cytoskeletal scaffolds. Multiple alternatively spliced variants, encoding the same protein, have been identified.

Anti-FKBP2 antibody

STJ192471 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FKBP2

FKBP2 siRNA

20-abx916934
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FKBP2 siRNA

20-abx916935
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FKBP2 protein

30R-1506 50 ug
EUR 305
Description: Purified recombinant Human FKBP2 protein

FK506 Binding Protein 2 (FKBP2) Polyclonal Antibody (Human)

4-PAC479Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP2 (Met1~Leu142)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 2 (FKBP2)

FKBP2 cloning plasmid

CSB-CL008698HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 429
  • Sequence: atgaggctgagctggttccgggtcctgacagtactgtccatctgcctgagcgccgtggccacggccacgggggccgagggcaaaaggaagctgcagatcggggtcaagaagcgggtggaccactgtcccatcaaatcgcgcaaaggggatgtcctgcacatgcactacacggggaa
  • Show more
Description: A cloning plasmid for the FKBP2 gene.

FKBP2 Blocking Peptide

33R-8052 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FKBP2 antibody, catalog no. 70R-5298

Human Recombinant FKBP2

6353-50
EUR 457

pCMV-SPORT6-FKBP2

PVT12385 2 ug
EUR 391

Human FKBP2 Antibody (Biotin Conjugate)

32851-05121 150 ug
EUR 369

FK506 Binding Protein 2 (FKBP2) Polyclonal Antibody (Human), APC

4-PAC479Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP2 (Met1~Leu142)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 2 (FKBP2). This antibody is labeled with APC.

FK506 Binding Protein 2 (FKBP2) Polyclonal Antibody (Human), Biotinylated

4-PAC479Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP2 (Met1~Leu142)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 2 (FKBP2). This antibody is labeled with Biotin.

FK506 Binding Protein 2 (FKBP2) Polyclonal Antibody (Human), Cy3

4-PAC479Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP2 (Met1~Leu142)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 2 (FKBP2). This antibody is labeled with Cy3.

FK506 Binding Protein 2 (FKBP2) Polyclonal Antibody (Human), FITC

4-PAC479Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP2 (Met1~Leu142)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 2 (FKBP2). This antibody is labeled with FITC.

FK506 Binding Protein 2 (FKBP2) Polyclonal Antibody (Human), HRP

4-PAC479Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP2 (Met1~Leu142)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 2 (FKBP2). This antibody is labeled with HRP.

FK506 Binding Protein 2 (FKBP2) Polyclonal Antibody (Human), PE

4-PAC479Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP2 (Met1~Leu142)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 2 (FKBP2). This antibody is labeled with PE.

FK506 Binding Protein 2 (FKBP2) Antibody

20-abx126911
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

FK506 Binding Protein 2 (FKBP2) Antibody

20-abx112549
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

FK506 Binding Protein 2 (FKBP2) Antibody

20-abx131036
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

FK506 Binding Protein 2 (FKBP2) Antibody

abx122884-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

FK506 Binding Protein 2 (FKBP2) Antibody

abx032962-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

FK506 Binding Protein 2 (FKBP2) Antibody

abx032962-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

FK506 Binding Protein 2 (FKBP2) Antibody

20-abx006068
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

FK506 Binding Protein 2 (FKBP2) Antibody

20-abx320468
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

FK506 Binding Protein 2 (FKBP2) Antibody

20-abx322674
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

FK506 Binding Protein 2 (FKBP2) Antibody

20-abx225172
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

FK506 Binding Protein 2 (FKBP2) Antibody

abx233138-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

FK506 Binding Protein 2 (FKBP2) Antibody

abx233139-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Human FKBP2 AssayLite Antibody (FITC Conjugate)

32851-05141 150 ug
EUR 428

Human FKBP2 AssayLite Antibody (RPE Conjugate)

32851-05151 150 ug
EUR 428

Human FKBP2 AssayLite Antibody (APC Conjugate)

32851-05161 150 ug
EUR 428

Human FKBP2 AssayLite Antibody (PerCP Conjugate)

32851-05171 150 ug
EUR 471

Mouse Fkbp2 ELISA KIT

ELI-07779m 96 Tests
EUR 865

FKBP2 ELISA KIT|Human

EF009643 96 Tests
EUR 689

Human FKBP2 ELISA KIT

ELI-47335h 96 Tests
EUR 824

Bovine FKBP2 ELISA KIT

ELI-47447b 96 Tests
EUR 928

Mouse FKBP2 shRNA Plasmid

20-abx970350
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FKBP2 shRNA Plasmid

20-abx951596
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FKBP2 Recombinant Protein (Human)

RP012223 100 ug Ask for price

pECMV-3-FLAG-FKBP2

PVT12991 2 ug
EUR 325

FKBP2 Recombinant Protein (Rat)

RP201473 100 ug Ask for price

FKBP2 Recombinant Protein (Rat)

RP201476 100 ug Ask for price

FKBP2 Recombinant Protein (Mouse)

RP134723 100 ug Ask for price

FKBP2 Recombinant Protein (Mouse)

RP134726 100 ug Ask for price

FK506 Binding Protein 2 (FKBP2) Polyclonal Antibody (Human), APC-Cy7

4-PAC479Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP2 (Met1~Leu142)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 2 (FKBP2). This antibody is labeled with APC-Cy7.

FKBP2 ORF Vector (Human) (pORF)

ORF004075 1.0 ug DNA
EUR 95

Fkbp2 ORF Vector (Rat) (pORF)

ORF067159 1.0 ug DNA
EUR 506

Fkbp2 ORF Vector (Rat) (pORF)

ORF067160 1.0 ug DNA
EUR 506

Fkbp2 ORF Vector (Mouse) (pORF)

ORF044909 1.0 ug DNA
EUR 506

Fkbp2 ORF Vector (Mouse) (pORF)

ORF044910 1.0 ug DNA
EUR 506

FKBP2 sgRNA CRISPR Lentivector set (Human)

K0785101 3 x 1.0 ug
EUR 339

Fkbp2 sgRNA CRISPR Lentivector set (Rat)

K6179801 3 x 1.0 ug
EUR 339

Fkbp2 sgRNA CRISPR Lentivector set (Mouse)

K4982201 3 x 1.0 ug
EUR 339

Recombinant FK506 Binding Protein 2 (FKBP2)

4-RPC479Hu01
  • EUR 447.65
  • EUR 223.00
  • EUR 1403.68
  • EUR 534.56
  • EUR 969.12
  • EUR 362.00
  • EUR 3359.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P26885
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human FK506 Binding Protein 2 expressed in: E.coli

FKBP2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0785102 1.0 ug DNA
EUR 154

FKBP2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0785103 1.0 ug DNA
EUR 154

FKBP2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0785104 1.0 ug DNA
EUR 154

Human FK506 Binding Protein 2 (FKBP2) Protein

20-abx168988
  • EUR 634.00
  • EUR 272.00
  • EUR 1901.00
  • EUR 746.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fkbp2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6179802 1.0 ug DNA
EUR 154

Fkbp2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6179803 1.0 ug DNA
EUR 154

Fkbp2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6179804 1.0 ug DNA
EUR 154

Fkbp2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4982202 1.0 ug DNA
EUR 154

Fkbp2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4982203 1.0 ug DNA
EUR 154

Fkbp2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4982204 1.0 ug DNA
EUR 154

FKBP2 Protein Vector (Rat) (pPB-C-His)

PV268634 500 ng
EUR 603

FKBP2 Protein Vector (Rat) (pPB-N-His)

PV268635 500 ng
EUR 603

FKBP2 Protein Vector (Rat) (pPM-C-HA)

PV268636 500 ng
EUR 603

FKBP2 Protein Vector (Rat) (pPM-C-His)

PV268637 500 ng
EUR 603

FKBP2 Protein Vector (Rat) (pPB-C-His)

PV268638 500 ng
EUR 603

FKBP2 Protein Vector (Rat) (pPB-N-His)

PV268639 500 ng
EUR 603

FKBP2 Protein Vector (Rat) (pPM-C-HA)

PV268640 500 ng
EUR 603

FKBP2 Protein Vector (Rat) (pPM-C-His)

PV268641 500 ng
EUR 603

FKBP2 Protein Vector (Mouse) (pPB-C-His)

PV179634 500 ng
EUR 603

FKBP2 Protein Vector (Mouse) (pPB-N-His)

PV179635 500 ng
EUR 603

FKBP2 Protein Vector (Mouse) (pPM-C-HA)

PV179636 500 ng
EUR 603

FKBP2 Protein Vector (Mouse) (pPM-C-His)

PV179637 500 ng
EUR 603

FKBP2 Protein Vector (Mouse) (pPB-C-His)

PV179638 500 ng
EUR 603

FKBP2 Protein Vector (Mouse) (pPB-N-His)

PV179639 500 ng
EUR 603

FKBP2 Protein Vector (Mouse) (pPM-C-HA)

PV179640 500 ng
EUR 603

FKBP2 Protein Vector (Mouse) (pPM-C-His)

PV179641 500 ng
EUR 603

Recombinant Human FKBP2 Protein, Untagged, E.coli-10ug

QP10608-10ug 10ug
EUR 201

Recombinant Human FKBP2 Protein, Untagged, E.coli-1mg

QP10608-1mg 1mg
EUR 5251

Recombinant Human FKBP2 Protein, Untagged, E.coli-2ug

QP10608-2ug 2ug
EUR 155

FKBP2 Protein Vector (Human) (pPB-C-His)

PV016297 500 ng
EUR 329

FKBP2 Protein Vector (Human) (pPB-N-His)

PV016298 500 ng
EUR 329

FKBP2 Protein Vector (Human) (pPM-C-HA)

PV016299 500 ng
EUR 329

FKBP2 Protein Vector (Human) (pPM-C-His)

PV016300 500 ng
EUR 329

Fkbp2 3'UTR Luciferase Stable Cell Line

TU204661 1.0 ml Ask for price

Fkbp2 3'UTR GFP Stable Cell Line

TU156599 1.0 ml Ask for price

FKBP2 3'UTR Luciferase Stable Cell Line

TU007998 1.0 ml
EUR 1394

Fkbp2 3'UTR Luciferase Stable Cell Line

TU106599 1.0 ml Ask for price

FKBP2 3'UTR GFP Stable Cell Line

TU057998 1.0 ml
EUR 1394

Fkbp2 3'UTR GFP Stable Cell Line

TU254661 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

FKBP2 Rabbit Polyclonal Antibody