DRA Rabbit Polyclonal Antibody
DRA Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
DRA Polyclonal Antibody |
ABP53148-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human DRA
- Applications tips:
|
Description: A polyclonal antibody for detection of DRA from Human, Mouse, Rat. This DRA antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human DRA |
DRA Polyclonal Antibody |
ABP53148-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human DRA
- Applications tips:
|
Description: A polyclonal antibody for detection of DRA from Human, Mouse, Rat. This DRA antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human DRA |
DRA Polyclonal Antibody |
ABP53148-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human DRA
- Applications tips:
|
Description: A polyclonal antibody for detection of DRA from Human, Mouse, Rat. This DRA antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human DRA |
DRA Polyclonal Antibody |
ES4147-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against DRA from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
DRA Polyclonal Antibody |
ES4147-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against DRA from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
DRA Polyclonal Antibody |
ES11294-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against DRA from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
DRA Polyclonal Antibody |
ES11294-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against DRA from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
HLA-DRA Polyclonal Antibody |
A53149 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
HLA-DRA Rabbit mAb |
A10863-100ul |
Abclonal |
100 ul |
EUR 410 |
HLA-DRA Rabbit mAb |
A10863-200ul |
Abclonal |
200 ul |
EUR 571 |
HLA-DRA Rabbit mAb |
A10863-20ul |
Abclonal |
20 ul |
EUR 221 |
HLA-DRA Rabbit mAb |
A10863-50ul |
Abclonal |
50 ul |
EUR 287 |
HLA-DRA Rabbit pAb |
A1579-100ul |
Abclonal |
100 ul |
EUR 308 |
HLA-DRA Rabbit pAb |
A1579-200ul |
Abclonal |
200 ul |
EUR 459 |
HLA-DRA Rabbit pAb |
A1579-20ul |
Abclonal |
20 ul |
EUR 183 |
HLA-DRA Rabbit pAb |
A1579-50ul |
Abclonal |
50 ul |
EUR 223 |
HLA-DRA Rabbit pAb |
A11787-100ul |
Abclonal |
100 ul |
EUR 308 |
HLA-DRA Rabbit pAb |
A11787-200ul |
Abclonal |
200 ul |
EUR 459 |
HLA-DRA Rabbit pAb |
A11787-20ul |
Abclonal |
20 ul |
EUR 183 |
HLA-DRA Rabbit pAb |
A11787-50ul |
Abclonal |
50 ul |
EUR 223 |
HLA-DRA Rabbit pAb |
A11790-100ul |
Abclonal |
100 ul |
EUR 308 |
HLA-DRA Rabbit pAb |
A11790-200ul |
Abclonal |
200 ul |
EUR 459 |
HLA-DRA Rabbit pAb |
A11790-20ul |
Abclonal |
20 ul |
EUR 183 |
HLA-DRA Rabbit pAb |
A11790-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal HLA-DRA Antibody (N-term) |
APR05804G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HLA-DRA (N-term). This antibody is tested and proven to work in the following applications: |
Polyclonal HLA-DRA Antibody (C-term) |
APR05805G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HLA-DRA (C-term). This antibody is tested and proven to work in the following applications: |
HLA-DRA Polyclonal Antibody, Biotin Conjugated |
A53146 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
HLA-DRA Polyclonal Antibody, FITC Conjugated |
A53147 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
HLA-DRA Polyclonal Antibody, HRP Conjugated |
A53148 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
HLA-DRA Antibody |
32324-100ul |
SAB |
100ul |
EUR 252 |
HLA-DRA Antibody |
DF6475 |
Affbiotech |
200ul |
EUR 304 |
Description: HLA-DRA Antibody detects endogenous levels of total HLA-DRA. |
HLA-DRA Antibody |
1-CSB-PA17939A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HLA-DRA. Recognizes HLA-DRA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Anti-DRA Antibody |
A03335 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal Antibody for DRA Antibody (SLC26A3) detection. Tested with WB in Human, Mouse, Rat. |
HLA-DRA Antibody |
20-abx125949 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
HLA-DRA Antibody |
CSB-PA010497KA01HU- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against HLA-DRA. Recognizes HLA-DRA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
HLA-DRA Antibody |
CSB-PA010497KA01HU-100ul |
Cusabio |
100ul |
EUR 389 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against HLA-DRA. Recognizes HLA-DRA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
HLA-DRA Antibody |
abx233906-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Anti-DRA antibody |
STJ192452 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to DRA |
Anti-DRA antibody |
STJ96782 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to DRA. |
Anti-HLA-DRA/Hla Dr Rabbit Monoclonal Antibody |
M01195-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal HLA-DRA/Hla Dr Antibody. Validated in IF, WB and tested in Human, Mouse, Rat. |
HLA-DRA Antibody (Biotin) |
20-abx105535 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
HLA-DRA Antibody (FITC) |
20-abx106952 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
HLA-DRA Antibody (HRP) |
20-abx108373 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
HLA-DRA Conjugated Antibody |
C32324 |
SAB |
100ul |
EUR 397 |
anti- HLA-DRA antibody |
FNab03906 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: major histocompatibility complex, class II, DR alpha
- Uniprot ID: P01903
- Gene ID: 3122
- Research Area: Neuroscience, Immunology
|
Description: Antibody raised against HLA-DRA |
Anti-HLA-DRA antibody |
STJ24027 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: HLA-DRA is one of the HLA class II alpha chain paralogues. This class II molecule is a heterodimer consisting of an alpha and a beta chain, both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa and its gene contains 5 exons. Exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, and exon 4 encodes the transmembrane domain and the cytoplasmic tail. DRA does not have polymorphisms in the peptide binding part and acts as the sole alpha chain for DRB1, DRB3, DRB4 and DRB5. |
Anti-HLA-DRA antibody |
STJ113370 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: HLA-DRA is one of the HLA class II alpha chain paralogues. This class II molecule is a heterodimer consisting of an alpha and a beta chain, both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa and its gene contains 5 exons. Exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, and exon 4 encodes the transmembrane domain and the cytoplasmic tail. DRA does not have polymorphisms in the peptide binding part and acts as the sole alpha chain for DRB1, DRB3, DRB4 and DRB5. |
Anti-HLA-DRA antibody |
STJ113855 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: HLA-DRA is one of the HLA class II alpha chain paralogues. This class II molecule is a heterodimer consisting of an alpha and a beta chain, both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa and its gene contains 5 exons. Exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, and exon 4 encodes the transmembrane domain and the cytoplasmic tail. DRA does not have polymorphisms in the peptide binding part and acts as the sole alpha chain for DRB1, DRB3, DRB4 and DRB5. |
HLA-DRA siRNA |
20-abx919567 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HLA-DRA Antibody (Clone # 302CT2.3.2) |
6792-50 |
Biovision |
|
EUR 316 |
HLA-DRA Antibody, HRP conjugated |
1-CSB-PA17939B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HLA-DRA. Recognizes HLA-DRA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
HLA-DRA Antibody, FITC conjugated |
1-CSB-PA17939C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HLA-DRA. Recognizes HLA-DRA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
HLA-DRA Antibody, Biotin conjugated |
1-CSB-PA17939D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HLA-DRA. Recognizes HLA-DRA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Anti-HLA-DR/HLA-DRA Antibody |
A01195 |
BosterBio |
100ug/vial |
EUR 334 |
Monoclonal HLA-DRA Antibody, Clone: 302CT2.3.2 |
AMM02368G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A Monoclonal antibody against Human HLA-DRA. The antibodies are raised in Mouse and are from clone 302CT2.3.2. This antibody is applicable in WB, E |
HLA-DRA Blocking Peptide |
DF6475-BP |
Affbiotech |
1mg |
EUR 195 |
HLA-DRA cloning plasmid |
CSB-CL360793HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 765
- Sequence: atggccataagtggagtccctgtgctaggatttttcatcatagctgtgctgatgagcgctcaggaatcatgggctatcaaagaagaacatgtgatcatccaggccgagttctatctgaatcctgaccaatcaggcgagtttatgtttgactttgatggtgatgagattttccatgt
- Show more
|
Description: A cloning plasmid for the HLA-DRA gene. |
HLA-DRA cloning plasmid |
CSB-CL360793HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 765
- Sequence: atggccataagtggagtccctgtgctaggatttttcatcatagctgtgctgatgagcgctcaggaatcatgggctatcaaagaagaacatgtgatcatccaggccgagttctatctgaatcctgaccaatcaggcgagtttatgtttgactttgatggtgatgagattttccatgt
- Show more
|
Description: A cloning plasmid for the HLA-DRA gene. |
MHC II (HLA-DRA)(19-26.1) Antibody |
BNUM1082-50 |
Biotium |
50uL |
EUR 395 |
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), 1mg/mL |
MHC II (HLA-DRA)(IPO-10) Antibody |
BNUM1090-50 |
Biotium |
50uL |
EUR 395 |
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), 1mg/mL |
MHC II (HLA-DRA)(169-1B5.2) Antibody |
BNUM1096-50 |
Biotium |
50uL |
EUR 395 |
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), 1mg/mL |
MHC II (HLA-DRA)(19-26.1) Antibody |
BNUB1082-100 |
Biotium |
100uL |
EUR 209 |
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), Concentration: 0.2mg/mL |
MHC II (HLA-DRA)(19-26.1) Antibody |
BNUB1082-500 |
Biotium |
500uL |
EUR 458 |
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), Concentration: 0.2mg/mL |
MHC II (HLA-DRA)(IPO-10) Antibody |
BNUB1090-100 |
Biotium |
100uL |
EUR 209 |
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), Concentration: 0.2mg/mL |
MHC II (HLA-DRA)(IPO-10) Antibody |
BNUB1090-500 |
Biotium |
500uL |
EUR 458 |
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), Concentration: 0.2mg/mL |
MHC II (HLA-DRA)(169-1B5.2) Antibody |
BNUB1096-100 |
Biotium |
100uL |
EUR 209 |
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), Concentration: 0.2mg/mL |
MHC II (HLA-DRA)(169-1B5.2) Antibody |
BNUB1096-500 |
Biotium |
500uL |
EUR 458 |
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), Concentration: 0.2mg/mL |
MHC II (HLA-DRA)(19-26.1) Antibody |
BNC551082-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), CF555 conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(19-26.1) Antibody |
BNC551082-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), CF555 conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(IPO-10) Antibody |
BNC551090-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), CF555 conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(IPO-10) Antibody |
BNC551090-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), CF555 conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(169-1B5.2) Antibody |
BNC551096-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), CF555 conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(169-1B5.2) Antibody |
BNC551096-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), CF555 conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(19-26.1) Antibody |
BNC611082-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), CF660R conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(19-26.1) Antibody |
BNC611082-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), CF660R conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(IPO-10) Antibody |
BNC611090-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), CF660R conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(IPO-10) Antibody |
BNC611090-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), CF660R conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(169-1B5.2) Antibody |
BNC611096-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), CF660R conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(169-1B5.2) Antibody |
BNC611096-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), CF660R conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(19-26.1) Antibody |
BNC471082-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), CF647 conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(19-26.1) Antibody |
BNC471082-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), CF647 conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(IPO-10) Antibody |
BNC471090-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), CF647 conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(IPO-10) Antibody |
BNC471090-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), CF647 conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(169-1B5.2) Antibody |
BNC471096-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), CF647 conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(169-1B5.2) Antibody |
BNC471096-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), CF647 conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(19-26.1) Antibody |
BNC051082-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), CF405M conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(19-26.1) Antibody |
BNC051082-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), CF405M conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(IPO-10) Antibody |
BNC051090-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), CF405M conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(IPO-10) Antibody |
BNC051090-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), CF405M conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(169-1B5.2) Antibody |
BNC051096-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), CF405M conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(169-1B5.2) Antibody |
BNC051096-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), CF405M conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(19-26.1) Antibody |
BNC401082-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), CF640R conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(19-26.1) Antibody |
BNC401082-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), CF640R conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(IPO-10) Antibody |
BNC401090-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), CF640R conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(IPO-10) Antibody |
BNC401090-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), CF640R conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(169-1B5.2) Antibody |
BNC401096-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), CF640R conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(169-1B5.2) Antibody |
BNC401096-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), CF640R conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(19-26.1) Antibody |
BNC431082-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), CF543 conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(19-26.1) Antibody |
BNC431082-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), CF543 conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(IPO-10) Antibody |
BNC431090-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), CF543 conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(IPO-10) Antibody |
BNC431090-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), CF543 conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(169-1B5.2) Antibody |
BNC431096-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), CF543 conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(169-1B5.2) Antibody |
BNC431096-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), CF543 conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(19-26.1) Antibody |
BNC041082-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), CF405S conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(19-26.1) Antibody |
BNC041082-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), CF405S conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(IPO-10) Antibody |
BNC041090-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), CF405S conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(IPO-10) Antibody |
BNC041090-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), CF405S conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(169-1B5.2) Antibody |
BNC041096-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), CF405S conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(169-1B5.2) Antibody |
BNC041096-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), CF405S conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(19-26.1) Antibody |
BNC801082-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), CF680 conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(19-26.1) Antibody |
BNC801082-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), CF680 conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(IPO-10) Antibody |
BNC801090-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), CF680 conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(IPO-10) Antibody |
BNC801090-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), CF680 conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(169-1B5.2) Antibody |
BNC801096-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), CF680 conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(169-1B5.2) Antibody |
BNC801096-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), CF680 conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(19-26.1) Antibody |
BNCP1082-250 |
Biotium |
250uL |
EUR 383 |
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), PerCP conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(IPO-10) Antibody |
BNCP1090-250 |
Biotium |
250uL |
EUR 383 |
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), PerCP conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(169-1B5.2) Antibody |
BNCP1096-250 |
Biotium |
250uL |
EUR 383 |
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), PerCP conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(19-26.1) Antibody |
BNCR1082-250 |
Biotium |
250uL |
EUR 383 |
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), RPE conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(IPO-10) Antibody |
BNCR1090-250 |
Biotium |
250uL |
EUR 383 |
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), RPE conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(169-1B5.2) Antibody |
BNCR1096-250 |
Biotium |
250uL |
EUR 383 |
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), RPE conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(19-26.1) Antibody |
BNCA1082-250 |
Biotium |
250uL |
EUR 383 |
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), APC conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(IPO-10) Antibody |
BNCA1090-250 |
Biotium |
250uL |
EUR 383 |
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), APC conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(169-1B5.2) Antibody |
BNCA1096-250 |
Biotium |
250uL |
EUR 383 |
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), APC conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(19-26.1) Antibody |
BNCAP1082-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(19-26.1) Antibody |
BNCAP1082-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(IPO-10) Antibody |
BNCAP1090-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(IPO-10) Antibody |
BNCAP1090-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(169-1B5.2) Antibody |
BNCAP1096-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(169-1B5.2) Antibody |
BNCAP1096-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(19-26.1) Antibody |
BNCB1082-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), Biotin conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(19-26.1) Antibody |
BNCB1082-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), Biotin conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(IPO-10) Antibody |
BNCB1090-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), Biotin conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(IPO-10) Antibody |
BNCB1090-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), Biotin conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(169-1B5.2) Antibody |
BNCB1096-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), Biotin conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(169-1B5.2) Antibody |
BNCB1096-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), Biotin conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(19-26.1) Antibody |
BNCH1082-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(19-26.1) Antibody |
BNCH1082-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL |
MHC II (HLA-DRA)(IPO-10) Antibody |
BNCH1090-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL |
DRA Rabbit Polyclonal Antibody