DRA Rabbit Polyclonal Antibody

DRA Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

DRA Polyclonal Antibody

ABP53148-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human DRA
  • Applications tips:
Description: A polyclonal antibody for detection of DRA from Human, Mouse, Rat. This DRA antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human DRA

DRA Polyclonal Antibody

ABP53148-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human DRA
  • Applications tips:
Description: A polyclonal antibody for detection of DRA from Human, Mouse, Rat. This DRA antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human DRA

DRA Polyclonal Antibody

ABP53148-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human DRA
  • Applications tips:
Description: A polyclonal antibody for detection of DRA from Human, Mouse, Rat. This DRA antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human DRA

DRA Polyclonal Antibody

ES4147-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DRA from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

DRA Polyclonal Antibody

ES4147-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DRA from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

DRA Polyclonal Antibody

ES11294-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DRA from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

DRA Polyclonal Antibody

ES11294-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DRA from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

HLA-DRA Polyclonal Antibody

A53149 100 µg
EUR 570.55
Description: reagents widely cited

HLA-DRA Rabbit mAb

A10863-100ul 100 ul
EUR 410

HLA-DRA Rabbit mAb

A10863-200ul 200 ul
EUR 571

HLA-DRA Rabbit mAb

A10863-20ul 20 ul
EUR 221

HLA-DRA Rabbit mAb

A10863-50ul 50 ul
EUR 287

HLA-DRA Rabbit pAb

A1579-100ul 100 ul
EUR 308

HLA-DRA Rabbit pAb

A1579-200ul 200 ul
EUR 459

HLA-DRA Rabbit pAb

A1579-20ul 20 ul
EUR 183

HLA-DRA Rabbit pAb

A1579-50ul 50 ul
EUR 223

HLA-DRA Rabbit pAb

A11787-100ul 100 ul
EUR 308

HLA-DRA Rabbit pAb

A11787-200ul 200 ul
EUR 459

HLA-DRA Rabbit pAb

A11787-20ul 20 ul
EUR 183

HLA-DRA Rabbit pAb

A11787-50ul 50 ul
EUR 223

HLA-DRA Rabbit pAb

A11790-100ul 100 ul
EUR 308

HLA-DRA Rabbit pAb

A11790-200ul 200 ul
EUR 459

HLA-DRA Rabbit pAb

A11790-20ul 20 ul
EUR 183

HLA-DRA Rabbit pAb

A11790-50ul 50 ul
EUR 223

Polyclonal HLA-DRA Antibody (N-term)

APR05804G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HLA-DRA (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal HLA-DRA Antibody (C-term)

APR05805G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HLA-DRA (C-term). This antibody is tested and proven to work in the following applications:

HLA-DRA Polyclonal Antibody, Biotin Conjugated

A53146 100 µg
EUR 570.55
Description: fast delivery possible

HLA-DRA Polyclonal Antibody, FITC Conjugated

A53147 100 µg
EUR 570.55
Description: reagents widely cited

HLA-DRA Polyclonal Antibody, HRP Conjugated

A53148 100 µg
EUR 570.55
Description: Ask the seller for details

HLA-DRA Antibody

32324-100ul 100ul
EUR 252

HLA-DRA Antibody

DF6475 200ul
EUR 304
Description: HLA-DRA Antibody detects endogenous levels of total HLA-DRA.

HLA-DRA Antibody

1-CSB-PA17939A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HLA-DRA. Recognizes HLA-DRA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Anti-DRA Antibody

A03335 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for DRA Antibody (SLC26A3) detection. Tested with WB in Human, Mouse, Rat.

HLA-DRA Antibody

20-abx125949
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

HLA-DRA Antibody

CSB-PA010497KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against HLA-DRA. Recognizes HLA-DRA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

HLA-DRA Antibody

CSB-PA010497KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against HLA-DRA. Recognizes HLA-DRA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

HLA-DRA Antibody

abx233906-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

HLA- DRA Antibody

ABD6475 100 ug
EUR 438

Anti-DRA antibody

STJ192452 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DRA

Anti-DRA antibody

STJ96782 200 µl
EUR 197
Description: Rabbit polyclonal to DRA.

Anti-HLA-DRA/Hla Dr Rabbit Monoclonal Antibody

M01195-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal HLA-DRA/Hla Dr Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

HLA-DRA Antibody (Biotin)

20-abx105535
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

HLA-DRA Antibody (FITC)

20-abx106952
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

HLA-DRA Antibody (HRP)

20-abx108373
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

HLA-DRA Conjugated Antibody

C32324 100ul
EUR 397

anti- HLA-DRA antibody

FNab03906 100µg
EUR 548.75
  • Immunogen: major histocompatibility complex, class II, DR alpha
  • Uniprot ID: P01903
  • Gene ID: 3122
  • Research Area: Neuroscience, Immunology
Description: Antibody raised against HLA-DRA

Anti-HLA-DRA antibody

PAab03906 100 ug
EUR 386

Anti-HLA-DRA antibody

STJ24027 100 µl
EUR 277
Description: HLA-DRA is one of the HLA class II alpha chain paralogues. This class II molecule is a heterodimer consisting of an alpha and a beta chain, both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa and its gene contains 5 exons. Exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, and exon 4 encodes the transmembrane domain and the cytoplasmic tail. DRA does not have polymorphisms in the peptide binding part and acts as the sole alpha chain for DRB1, DRB3, DRB4 and DRB5.

Anti-HLA-DRA antibody

STJ113370 100 µl
EUR 277
Description: HLA-DRA is one of the HLA class II alpha chain paralogues. This class II molecule is a heterodimer consisting of an alpha and a beta chain, both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa and its gene contains 5 exons. Exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, and exon 4 encodes the transmembrane domain and the cytoplasmic tail. DRA does not have polymorphisms in the peptide binding part and acts as the sole alpha chain for DRB1, DRB3, DRB4 and DRB5.

Anti-HLA-DRA antibody

STJ113855 100 µl
EUR 277
Description: HLA-DRA is one of the HLA class II alpha chain paralogues. This class II molecule is a heterodimer consisting of an alpha and a beta chain, both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa and its gene contains 5 exons. Exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, and exon 4 encodes the transmembrane domain and the cytoplasmic tail. DRA does not have polymorphisms in the peptide binding part and acts as the sole alpha chain for DRB1, DRB3, DRB4 and DRB5.

HLA-DRA siRNA

20-abx919567
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HLA-DRA Antibody (Clone # 302CT2.3.2)

6792-50
EUR 316

HLA-DRA Antibody, HRP conjugated

1-CSB-PA17939B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HLA-DRA. Recognizes HLA-DRA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HLA-DRA Antibody, FITC conjugated

1-CSB-PA17939C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HLA-DRA. Recognizes HLA-DRA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HLA-DRA Antibody, Biotin conjugated

1-CSB-PA17939D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HLA-DRA. Recognizes HLA-DRA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-MHC II DRA antibody

STJ16101043 100 µg
EUR 354

Anti-HLA-DR/HLA-DRA Antibody

A01195 100ug/vial
EUR 334

Monoclonal HLA-DRA Antibody, Clone: 302CT2.3.2

AMM02368G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human HLA-DRA. The antibodies are raised in Mouse and are from clone 302CT2.3.2. This antibody is applicable in WB, E

HLA-DRA Blocking Peptide

DF6475-BP 1mg
EUR 195

HLA-DRA cloning plasmid

CSB-CL360793HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 765
  • Sequence: atggccataagtggagtccctgtgctaggatttttcatcatagctgtgctgatgagcgctcaggaatcatgggctatcaaagaagaacatgtgatcatccaggccgagttctatctgaatcctgaccaatcaggcgagtttatgtttgactttgatggtgatgagattttccatgt
  • Show more
Description: A cloning plasmid for the HLA-DRA gene.

HLA-DRA cloning plasmid

CSB-CL360793HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 765
  • Sequence: atggccataagtggagtccctgtgctaggatttttcatcatagctgtgctgatgagcgctcaggaatcatgggctatcaaagaagaacatgtgatcatccaggccgagttctatctgaatcctgaccaatcaggcgagtttatgtttgactttgatggtgatgagattttccatgt
  • Show more
Description: A cloning plasmid for the HLA-DRA gene.

Dra I unit: 3500

YRDRA1 1 vial Ask for price

MHC II (HLA-DRA)(19-26.1) Antibody

BNUM1082-50 50uL
EUR 395
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), 1mg/mL

MHC II (HLA-DRA)(IPO-10) Antibody

BNUM1090-50 50uL
EUR 395
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), 1mg/mL

MHC II (HLA-DRA)(169-1B5.2) Antibody

BNUM1096-50 50uL
EUR 395
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), 1mg/mL

MHC II (HLA-DRA)(19-26.1) Antibody

BNUB1082-100 100uL
EUR 209
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), Concentration: 0.2mg/mL

MHC II (HLA-DRA)(19-26.1) Antibody

BNUB1082-500 500uL
EUR 458
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), Concentration: 0.2mg/mL

MHC II (HLA-DRA)(IPO-10) Antibody

BNUB1090-100 100uL
EUR 209
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), Concentration: 0.2mg/mL

MHC II (HLA-DRA)(IPO-10) Antibody

BNUB1090-500 500uL
EUR 458
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), Concentration: 0.2mg/mL

MHC II (HLA-DRA)(169-1B5.2) Antibody

BNUB1096-100 100uL
EUR 209
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), Concentration: 0.2mg/mL

MHC II (HLA-DRA)(169-1B5.2) Antibody

BNUB1096-500 500uL
EUR 458
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), Concentration: 0.2mg/mL

MHC II (HLA-DRA)(19-26.1) Antibody

BNC551082-100 100uL
EUR 199
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), CF555 conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(19-26.1) Antibody

BNC551082-500 500uL
EUR 544
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), CF555 conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(IPO-10) Antibody

BNC551090-100 100uL
EUR 199
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), CF555 conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(IPO-10) Antibody

BNC551090-500 500uL
EUR 544
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), CF555 conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(169-1B5.2) Antibody

BNC551096-100 100uL
EUR 199
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), CF555 conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(169-1B5.2) Antibody

BNC551096-500 500uL
EUR 544
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), CF555 conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(19-26.1) Antibody

BNC611082-100 100uL
EUR 199
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), CF660R conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(19-26.1) Antibody

BNC611082-500 500uL
EUR 544
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), CF660R conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(IPO-10) Antibody

BNC611090-100 100uL
EUR 199
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), CF660R conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(IPO-10) Antibody

BNC611090-500 500uL
EUR 544
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), CF660R conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(169-1B5.2) Antibody

BNC611096-100 100uL
EUR 199
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), CF660R conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(169-1B5.2) Antibody

BNC611096-500 500uL
EUR 544
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), CF660R conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(19-26.1) Antibody

BNC471082-100 100uL
EUR 199
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), CF647 conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(19-26.1) Antibody

BNC471082-500 500uL
EUR 544
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), CF647 conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(IPO-10) Antibody

BNC471090-100 100uL
EUR 199
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), CF647 conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(IPO-10) Antibody

BNC471090-500 500uL
EUR 544
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), CF647 conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(169-1B5.2) Antibody

BNC471096-100 100uL
EUR 199
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), CF647 conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(169-1B5.2) Antibody

BNC471096-500 500uL
EUR 544
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), CF647 conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(19-26.1) Antibody

BNC051082-100 100uL
EUR 199
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), CF405M conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(19-26.1) Antibody

BNC051082-500 500uL
EUR 544
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), CF405M conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(IPO-10) Antibody

BNC051090-100 100uL
EUR 199
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), CF405M conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(IPO-10) Antibody

BNC051090-500 500uL
EUR 544
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), CF405M conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(169-1B5.2) Antibody

BNC051096-100 100uL
EUR 199
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), CF405M conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(169-1B5.2) Antibody

BNC051096-500 500uL
EUR 544
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), CF405M conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(19-26.1) Antibody

BNC401082-100 100uL
EUR 199
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), CF640R conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(19-26.1) Antibody

BNC401082-500 500uL
EUR 544
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), CF640R conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(IPO-10) Antibody

BNC401090-100 100uL
EUR 199
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), CF640R conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(IPO-10) Antibody

BNC401090-500 500uL
EUR 544
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), CF640R conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(169-1B5.2) Antibody

BNC401096-100 100uL
EUR 199
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), CF640R conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(169-1B5.2) Antibody

BNC401096-500 500uL
EUR 544
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), CF640R conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(19-26.1) Antibody

BNC431082-100 100uL
EUR 199
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), CF543 conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(19-26.1) Antibody

BNC431082-500 500uL
EUR 544
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), CF543 conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(IPO-10) Antibody

BNC431090-100 100uL
EUR 199
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), CF543 conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(IPO-10) Antibody

BNC431090-500 500uL
EUR 544
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), CF543 conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(169-1B5.2) Antibody

BNC431096-100 100uL
EUR 199
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), CF543 conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(169-1B5.2) Antibody

BNC431096-500 500uL
EUR 544
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), CF543 conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(19-26.1) Antibody

BNC041082-100 100uL
EUR 199
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), CF405S conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(19-26.1) Antibody

BNC041082-500 500uL
EUR 544
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), CF405S conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(IPO-10) Antibody

BNC041090-100 100uL
EUR 199
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), CF405S conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(IPO-10) Antibody

BNC041090-500 500uL
EUR 544
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), CF405S conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(169-1B5.2) Antibody

BNC041096-100 100uL
EUR 199
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), CF405S conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(169-1B5.2) Antibody

BNC041096-500 500uL
EUR 544
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), CF405S conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(19-26.1) Antibody

BNC801082-100 100uL
EUR 199
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), CF680 conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(19-26.1) Antibody

BNC801082-500 500uL
EUR 544
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), CF680 conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(IPO-10) Antibody

BNC801090-100 100uL
EUR 199
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), CF680 conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(IPO-10) Antibody

BNC801090-500 500uL
EUR 544
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), CF680 conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(169-1B5.2) Antibody

BNC801096-100 100uL
EUR 199
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), CF680 conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(169-1B5.2) Antibody

BNC801096-500 500uL
EUR 544
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), CF680 conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(19-26.1) Antibody

BNCP1082-250 250uL
EUR 383
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), PerCP conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(IPO-10) Antibody

BNCP1090-250 250uL
EUR 383
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), PerCP conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(169-1B5.2) Antibody

BNCP1096-250 250uL
EUR 383
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), PerCP conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(19-26.1) Antibody

BNCR1082-250 250uL
EUR 383
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), RPE conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(IPO-10) Antibody

BNCR1090-250 250uL
EUR 383
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), RPE conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(169-1B5.2) Antibody

BNCR1096-250 250uL
EUR 383
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), RPE conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(19-26.1) Antibody

BNCA1082-250 250uL
EUR 383
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), APC conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(IPO-10) Antibody

BNCA1090-250 250uL
EUR 383
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), APC conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(169-1B5.2) Antibody

BNCA1096-250 250uL
EUR 383
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), APC conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(19-26.1) Antibody

BNCAP1082-100 100uL
EUR 199
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(19-26.1) Antibody

BNCAP1082-500 500uL
EUR 544
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(IPO-10) Antibody

BNCAP1090-100 100uL
EUR 199
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(IPO-10) Antibody

BNCAP1090-500 500uL
EUR 544
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(169-1B5.2) Antibody

BNCAP1096-100 100uL
EUR 199
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(169-1B5.2) Antibody

BNCAP1096-500 500uL
EUR 544
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(19-26.1) Antibody

BNCB1082-100 100uL
EUR 199
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), Biotin conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(19-26.1) Antibody

BNCB1082-500 500uL
EUR 544
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), Biotin conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(IPO-10) Antibody

BNCB1090-100 100uL
EUR 199
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), Biotin conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(IPO-10) Antibody

BNCB1090-500 500uL
EUR 544
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), Biotin conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(169-1B5.2) Antibody

BNCB1096-100 100uL
EUR 199
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), Biotin conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(169-1B5.2) Antibody

BNCB1096-500 500uL
EUR 544
Description: Primary antibody against MHC II (HLA-DRA)(169-1B5.2), Biotin conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(19-26.1) Antibody

BNCH1082-100 100uL
EUR 199
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(19-26.1) Antibody

BNCH1082-500 500uL
EUR 544
Description: Primary antibody against MHC II (HLA-DRA)(19-26.1), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

MHC II (HLA-DRA)(IPO-10) Antibody

BNCH1090-100 100uL
EUR 199
Description: Primary antibody against MHC II (HLA-DRA)(IPO-10), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

DRA Rabbit Polyclonal Antibody