WASL Rabbit Polyclonal Antibody
WASL Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
WASL Polyclonal Antibody |
ABP60911-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human WASL protein at amino acid sequence of 190-270
- Applications tips:
|
Description: A polyclonal antibody for detection of WASL from Human, Mouse, Rat. This WASL antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human WASL protein at amino acid sequence of 190-270 |
WASL Polyclonal Antibody |
ABP60911-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human WASL protein at amino acid sequence of 190-270
- Applications tips:
|
Description: A polyclonal antibody for detection of WASL from Human, Mouse, Rat. This WASL antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human WASL protein at amino acid sequence of 190-270 |
WASL Polyclonal Antibody |
ES11262-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WASL from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
WASL Polyclonal Antibody |
ES11262-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WASL from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
WASL Rabbit mAb |
A2270-100ul |
Abclonal |
100 ul |
EUR 410 |
WASL Rabbit mAb |
A2270-200ul |
Abclonal |
200 ul |
EUR 571 |
WASL Rabbit mAb |
A2270-20ul |
Abclonal |
20 ul |
EUR 221 |
WASL Rabbit mAb |
A2270-50ul |
Abclonal |
50 ul |
EUR 287 |
WASL antibody |
70R-21295 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal WASL antibody |
WASL Antibody |
32726-100ul |
SAB |
100ul |
EUR 252 |
WASL Antibody |
49725-100ul |
SAB |
100ul |
EUR 333 |
WASL Antibody |
49725-50ul |
SAB |
50ul |
EUR 239 |
WASL Antibody |
43021-100ul |
SAB |
100ul |
EUR 252 |
WASL Antibody |
1-CSB-PA025973GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against WASL. Recognizes WASL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
Polyclonal WASL Antibody (N-term) |
AMM08505G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WASL (N-term). This antibody is tested and proven to work in the following applications: |
WASL Conjugated Antibody |
C49725 |
SAB |
100ul |
EUR 397 |
WASL Conjugated Antibody |
C43021 |
SAB |
100ul |
EUR 397 |
WASL Conjugated Antibody |
C32726 |
SAB |
100ul |
EUR 397 |
anti- WASL antibody |
FNab09470 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:5000
- IHC: 1:20-1:200;IF: 1:10-1:100
- Immunogen: Wiskott-Aldrich syndrome-like
- Uniprot ID: O00401
- Gene ID: 8976
- Research Area: Neuroscience, Metabolism, cancer
|
Description: Antibody raised against WASL |
Anti-WASL antibody |
STJ110921 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the Wiskott-Aldrich syndrome (WAS) protein family. Wiskott-Aldrich syndrome proteins share similar domain structure, and associate with a variety of signaling molecules to alter the actin cytoskeleton. The encoded protein is highly expressed in neural tissues, and interacts with several proteins involved in cytoskeletal organization, including cell division control protein 42 (CDC42) and the actin-related protein-2/3 (ARP2/3) complex. The encoded protein may be involved in the formation of long actin microspikes, and in neurite extension. |
Anti-WASL antibody |
STJ26108 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the Wiskott-Aldrich syndrome (WAS) protein family. Wiskott-Aldrich syndrome proteins share similar domain structure, and associate with a variety of signaling molecules to alter the actin cytoskeleton. The encoded protein is highly expressed in neural tissues, and interacts with several proteins involved in cytoskeletal organization, including cell division control protein 42 (CDC42) and the actin-related protein-2/3 (ARP2/3) complex. The encoded protein may be involved in the formation of long actin microspikes, and in neurite extension. |
Anti-WASL antibody |
STJ192420 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to WASL |
WASL siRNA |
20-abx939642 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
WASL siRNA |
20-abx939643 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
WASL recombinant monoclonal antibody |
A5400 |
Bimake |
100ul X 3 |
EUR 595 |
- Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
- Show more
|
Description: A recombinant monoclonal antibody from rabbit against human WASL for WB,ELISA |
Anti-WASL Monoclonal Antibody |
M05438 |
BosterBio |
100ug |
EUR 397 |
Description: Rabbit Monoclonal WASL Antibody. Validated in IF, WB and tested in Human, Mouse. |
WASL cloning plasmid |
CSB-CL025973HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1518
- Sequence: atgagctccgtccagcagcagccgccgccgccgcggagggtcaccaacgtggggtccctgttgctcaccccgcaggagaacgagtccctcttcactttcctcggcaagaaatgtgtgactatgtcttcagcagtggtgcagttatatgcagcagatcggaactgtatgtggtcaa
- Show more
|
Description: A cloning plasmid for the WASL gene. |
Mouse WASL shRNA Plasmid |
20-abx977926 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human WASL shRNA Plasmid |
20-abx955926 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
WASL Recombinant Protein (Rat) |
RP237164 |
ABM |
100 ug |
Ask for price |
WASL Recombinant Protein (Human) |
RP034510 |
ABM |
100 ug |
Ask for price |
WASL Recombinant Protein (Mouse) |
RP185123 |
ABM |
100 ug |
Ask for price |
WASL Recombinant Protein (Mouse) |
RP185126 |
ABM |
100 ug |
Ask for price |
Wiskott-Aldrich Syndrome-Like (WASL) Antibody |
20-abx116678 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Monoclonal WASL Antibody (monoclonal) (M04), Clone: 5F4 |
AMM08504G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human WASL (monoclonal) (M04). The antibodies are raised in mouse and are from clone 5F4. This antibody is applicable in WB, IHC and IF |
Neural Wiskott-Aldrich Syndrome Protein (WASL) Antibody |
20-abx127083 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Neural Wiskott-Aldrich Syndrome Protein (WASL) Antibody |
abx239470-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Neural Wiskott-Aldrich Syndrome Protein (WASL) Antibody |
20-abx002013 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Wasl ORF Vector (Mouse) (pORF) |
ORF061709 |
ABM |
1.0 ug DNA |
EUR 506 |
Wasl ORF Vector (Mouse) (pORF) |
ORF061710 |
ABM |
1.0 ug DNA |
EUR 506 |
Wasl ORF Vector (Rat) (pORF) |
ORF079056 |
ABM |
1.0 ug DNA |
EUR 506 |
WASL ORF Vector (Human) (pORF) |
ORF011504 |
ABM |
1.0 ug DNA |
EUR 95 |
Was / Wasl Interacting Protein Family, Member 2 Antibody |
20-abx116645 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Wasl sgRNA CRISPR Lentivector set (Rat) |
K7509501 |
ABM |
3 x 1.0 ug |
EUR 339 |
WASL sgRNA CRISPR Lentivector set (Human) |
K2626001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Wasl sgRNA CRISPR Lentivector set (Mouse) |
K4550301 |
ABM |
3 x 1.0 ug |
EUR 339 |
WAS/WASL-Interacting Protein Family Member 2 (WIPF2) Antibody |
abx026019-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
WAS/WASL-Interacting Protein Family Member 2 (WIPF2) Antibody |
abx026019-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
WAS/WASL Interacting Protein Family Member 1 (WIPF1) Antibody |
20-abx015004 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
WAS/WASL Interacting Protein Family Member 1 (WIPF1) Antibody |
20-abx133536 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
WAS/WASL-Interacting Protein Family Member 2 (WIPF2) Antibody |
abx239511-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
WAS/WASL Interacting Protein Family Member 1 (WIPF1) Antibody |
20-abx329117 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
WAS/WASL Interacting Protein Family Member 1 (WIPF1) Antibody |
abx330771-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
WAS/WASL Interacting Protein Family Member 1 (WIPF1) Antibody |
abx431652-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Wasl sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7509502 |
ABM |
1.0 ug DNA |
EUR 154 |
Wasl sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7509503 |
ABM |
1.0 ug DNA |
EUR 154 |
Wasl sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7509504 |
ABM |
1.0 ug DNA |
EUR 154 |
WASL sgRNA CRISPR Lentivector (Human) (Target 1) |
K2626002 |
ABM |
1.0 ug DNA |
EUR 154 |
WASL sgRNA CRISPR Lentivector (Human) (Target 2) |
K2626003 |
ABM |
1.0 ug DNA |
EUR 154 |
WASL sgRNA CRISPR Lentivector (Human) (Target 3) |
K2626004 |
ABM |
1.0 ug DNA |
EUR 154 |
Wasl sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4550302 |
ABM |
1.0 ug DNA |
EUR 154 |
Wasl sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4550303 |
ABM |
1.0 ug DNA |
EUR 154 |
Wasl sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4550304 |
ABM |
1.0 ug DNA |
EUR 154 |
WASL Protein Vector (Mouse) (pPB-C-His) |
PV246834 |
ABM |
500 ng |
EUR 603 |
WASL Protein Vector (Mouse) (pPB-N-His) |
PV246835 |
ABM |
500 ng |
EUR 603 |
WASL Protein Vector (Mouse) (pPM-C-HA) |
PV246836 |
ABM |
500 ng |
EUR 603 |
WASL Protein Vector (Mouse) (pPM-C-His) |
PV246837 |
ABM |
500 ng |
EUR 603 |
WASL Protein Vector (Mouse) (pPB-C-His) |
PV246838 |
ABM |
500 ng |
EUR 603 |
WASL Protein Vector (Mouse) (pPB-N-His) |
PV246839 |
ABM |
500 ng |
EUR 603 |
WASL Protein Vector (Mouse) (pPM-C-HA) |
PV246840 |
ABM |
500 ng |
EUR 603 |
WASL Protein Vector (Mouse) (pPM-C-His) |
PV246841 |
ABM |
500 ng |
EUR 603 |
WASL Protein Vector (Rat) (pPB-C-His) |
PV316222 |
ABM |
500 ng |
EUR 603 |
WASL Protein Vector (Rat) (pPB-N-His) |
PV316223 |
ABM |
500 ng |
EUR 603 |
WASL Protein Vector (Rat) (pPM-C-HA) |
PV316224 |
ABM |
500 ng |
EUR 603 |
WASL Protein Vector (Rat) (pPM-C-His) |
PV316225 |
ABM |
500 ng |
EUR 603 |
WASL Protein Vector (Human) (pPB-C-His) |
PV046013 |
ABM |
500 ng |
EUR 329 |
WASL Protein Vector (Human) (pPB-N-His) |
PV046014 |
ABM |
500 ng |
EUR 329 |
WASL Protein Vector (Human) (pPM-C-HA) |
PV046015 |
ABM |
500 ng |
EUR 329 |
WASL Protein Vector (Human) (pPM-C-His) |
PV046016 |
ABM |
500 ng |
EUR 329 |
Wasl 3'UTR Luciferase Stable Cell Line |
TU122188 |
ABM |
1.0 ml |
Ask for price |
WASL 3'UTR GFP Stable Cell Line |
TU078369 |
ABM |
1.0 ml |
EUR 1521 |
Wasl 3'UTR GFP Stable Cell Line |
TU172188 |
ABM |
1.0 ml |
Ask for price |
Wasl 3'UTR Luciferase Stable Cell Line |
TU223306 |
ABM |
1.0 ml |
Ask for price |
WASL 3'UTR Luciferase Stable Cell Line |
TU028369 |
ABM |
1.0 ml |
EUR 1521 |
Wasl 3'UTR GFP Stable Cell Line |
TU273306 |
ABM |
1.0 ml |
Ask for price |
WASL Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV697687 |
ABM |
1.0 ug DNA |
EUR 682 |
WASL Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV697691 |
ABM |
1.0 ug DNA |
EUR 682 |
WASL Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV697692 |
ABM |
1.0 ug DNA |
EUR 682 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
WASL Rabbit Polyclonal Antibody