WASL Rabbit Polyclonal Antibody

WASL Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

WASL Polyclonal Antibody
ABP60911-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human WASL protein at amino acid sequence of 190-270
  • Applications tips:
Description: A polyclonal antibody for detection of WASL from Human, Mouse, Rat. This WASL antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human WASL protein at amino acid sequence of 190-270
WASL Polyclonal Antibody
ABP60911-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human WASL protein at amino acid sequence of 190-270
  • Applications tips:
Description: A polyclonal antibody for detection of WASL from Human, Mouse, Rat. This WASL antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human WASL protein at amino acid sequence of 190-270
WASL Polyclonal Antibody
ES11262-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WASL from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
WASL Polyclonal Antibody
ES11262-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WASL from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
WASL Rabbit mAb
A2270-100ul 100 ul
EUR 410
WASL Rabbit mAb
A2270-200ul 200 ul
EUR 571
WASL Rabbit mAb
A2270-20ul 20 ul
EUR 221
WASL Rabbit mAb
A2270-50ul 50 ul
EUR 287
WASL antibody
70R-21295 50 ul
EUR 435
Description: Rabbit polyclonal WASL antibody
WASL Antibody
32726-100ul 100ul
EUR 252
WASL Antibody
49725-100ul 100ul
EUR 333
WASL Antibody
49725-50ul 50ul
EUR 239
WASL Antibody
43021-100ul 100ul
EUR 252
WASL Antibody
1-CSB-PA025973GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against WASL. Recognizes WASL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF
WASL Antibody
ABD7029 100 ug
EUR 438
Polyclonal WASL Antibody (N-term)
AMM08505G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WASL (N-term). This antibody is tested and proven to work in the following applications:
Wasl/ Rat Wasl ELISA Kit
ELI-51494r 96 Tests
EUR 886
WASL Conjugated Antibody
C49725 100ul
EUR 397
WASL Conjugated Antibody
C43021 100ul
EUR 397
WASL Conjugated Antibody
C32726 100ul
EUR 397
anti- WASL antibody
FNab09470 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200;IF: 1:10-1:100
  • Immunogen: Wiskott-Aldrich syndrome-like
  • Uniprot ID: O00401
  • Gene ID: 8976
  • Research Area: Neuroscience, Metabolism, cancer
Description: Antibody raised against WASL
Anti-WASL antibody
PAab09470 100 ug
EUR 386
Anti-WASL antibody
STJ110921 100 µl
EUR 277
Description: This gene encodes a member of the Wiskott-Aldrich syndrome (WAS) protein family. Wiskott-Aldrich syndrome proteins share similar domain structure, and associate with a variety of signaling molecules to alter the actin cytoskeleton. The encoded protein is highly expressed in neural tissues, and interacts with several proteins involved in cytoskeletal organization, including cell division control protein 42 (CDC42) and the actin-related protein-2/3 (ARP2/3) complex. The encoded protein may be involved in the formation of long actin microspikes, and in neurite extension.
Anti-WASL antibody
STJ26108 100 µl
EUR 277
Description: This gene encodes a member of the Wiskott-Aldrich syndrome (WAS) protein family. Wiskott-Aldrich syndrome proteins share similar domain structure, and associate with a variety of signaling molecules to alter the actin cytoskeleton. The encoded protein is highly expressed in neural tissues, and interacts with several proteins involved in cytoskeletal organization, including cell division control protein 42 (CDC42) and the actin-related protein-2/3 (ARP2/3) complex. The encoded protein may be involved in the formation of long actin microspikes, and in neurite extension.
Anti-WASL antibody
STJ192420 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to WASL
WASL siRNA
20-abx939642
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
WASL siRNA
20-abx939643
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
WASL recombinant monoclonal antibody
A5400 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human WASL for WB,ELISA
Anti-WASL Monoclonal Antibody
M05438 100ug
EUR 397
Description: Rabbit Monoclonal WASL Antibody. Validated in IF, WB and tested in Human, Mouse.
WASL cloning plasmid
CSB-CL025973HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1518
  • Sequence: atgagctccgtccagcagcagccgccgccgccgcggagggtcaccaacgtggggtccctgttgctcaccccgcaggagaacgagtccctcttcactttcctcggcaagaaatgtgtgactatgtcttcagcagtggtgcagttatatgcagcagatcggaactgtatgtggtcaa
  • Show more
Description: A cloning plasmid for the WASL gene.
WASL ELISA KIT|Human
EF004250 96 Tests
EUR 689
Mouse WASL shRNA Plasmid
20-abx977926
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human WASL shRNA Plasmid
20-abx955926
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
WASL Recombinant Protein (Rat)
RP237164 100 ug Ask for price
WASL Recombinant Protein (Human)
RP034510 100 ug Ask for price
WASL Recombinant Protein (Mouse)
RP185123 100 ug Ask for price
WASL Recombinant Protein (Mouse)
RP185126 100 ug Ask for price
Wiskott-Aldrich Syndrome-Like (WASL) Antibody
20-abx116678
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Monoclonal WASL Antibody (monoclonal) (M04), Clone: 5F4
AMM08504G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human WASL (monoclonal) (M04). The antibodies are raised in mouse and are from clone 5F4. This antibody is applicable in WB, IHC and IF
Neural Wiskott-Aldrich Syndrome Protein (WASL) Antibody
20-abx127083
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Neural Wiskott-Aldrich Syndrome Protein (WASL) Antibody
abx239470-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Neural Wiskott-Aldrich Syndrome Protein (WASL) Antibody
20-abx002013
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Wasl ORF Vector (Mouse) (pORF)
ORF061709 1.0 ug DNA
EUR 506
Wasl ORF Vector (Mouse) (pORF)
ORF061710 1.0 ug DNA
EUR 506
Wasl ORF Vector (Rat) (pORF)
ORF079056 1.0 ug DNA
EUR 506
WASL ORF Vector (Human) (pORF)
ORF011504 1.0 ug DNA
EUR 95
Was / Wasl Interacting Protein Family, Member 2 Antibody
20-abx116645
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Wasl sgRNA CRISPR Lentivector set (Rat)
K7509501 3 x 1.0 ug
EUR 339
WASL sgRNA CRISPR Lentivector set (Human)
K2626001 3 x 1.0 ug
EUR 339
Wasl sgRNA CRISPR Lentivector set (Mouse)
K4550301 3 x 1.0 ug
EUR 339
WAS/WASL-Interacting Protein Family Member 2 (WIPF2) Antibody
abx026019-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
WAS/WASL-Interacting Protein Family Member 2 (WIPF2) Antibody
abx026019-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
WAS/WASL Interacting Protein Family Member 1 (WIPF1) Antibody
20-abx015004
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
WAS/WASL Interacting Protein Family Member 1 (WIPF1) Antibody
20-abx133536
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
WAS/WASL-Interacting Protein Family Member 2 (WIPF2) Antibody
abx239511-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
WAS/WASL Interacting Protein Family Member 1 (WIPF1) Antibody
20-abx329117
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
WAS/WASL Interacting Protein Family Member 1 (WIPF1) Antibody
abx330771-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
WAS/WASL Interacting Protein Family Member 1 (WIPF1) Antibody
abx431652-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Wasl sgRNA CRISPR Lentivector (Rat) (Target 1)
K7509502 1.0 ug DNA
EUR 154
Wasl sgRNA CRISPR Lentivector (Rat) (Target 2)
K7509503 1.0 ug DNA
EUR 154
Wasl sgRNA CRISPR Lentivector (Rat) (Target 3)
K7509504 1.0 ug DNA
EUR 154
WASL sgRNA CRISPR Lentivector (Human) (Target 1)
K2626002 1.0 ug DNA
EUR 154
WASL sgRNA CRISPR Lentivector (Human) (Target 2)
K2626003 1.0 ug DNA
EUR 154
WASL sgRNA CRISPR Lentivector (Human) (Target 3)
K2626004 1.0 ug DNA
EUR 154
Wasl sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4550302 1.0 ug DNA
EUR 154
Wasl sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4550303 1.0 ug DNA
EUR 154
Wasl sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4550304 1.0 ug DNA
EUR 154
WASL Protein Vector (Mouse) (pPB-C-His)
PV246834 500 ng
EUR 603
WASL Protein Vector (Mouse) (pPB-N-His)
PV246835 500 ng
EUR 603
WASL Protein Vector (Mouse) (pPM-C-HA)
PV246836 500 ng
EUR 603
WASL Protein Vector (Mouse) (pPM-C-His)
PV246837 500 ng
EUR 603
WASL Protein Vector (Mouse) (pPB-C-His)
PV246838 500 ng
EUR 603
WASL Protein Vector (Mouse) (pPB-N-His)
PV246839 500 ng
EUR 603
WASL Protein Vector (Mouse) (pPM-C-HA)
PV246840 500 ng
EUR 603
WASL Protein Vector (Mouse) (pPM-C-His)
PV246841 500 ng
EUR 603
WASL Protein Vector (Rat) (pPB-C-His)
PV316222 500 ng
EUR 603
WASL Protein Vector (Rat) (pPB-N-His)
PV316223 500 ng
EUR 603
WASL Protein Vector (Rat) (pPM-C-HA)
PV316224 500 ng
EUR 603
WASL Protein Vector (Rat) (pPM-C-His)
PV316225 500 ng
EUR 603
WASL Protein Vector (Human) (pPB-C-His)
PV046013 500 ng
EUR 329
WASL Protein Vector (Human) (pPB-N-His)
PV046014 500 ng
EUR 329
WASL Protein Vector (Human) (pPM-C-HA)
PV046015 500 ng
EUR 329
WASL Protein Vector (Human) (pPM-C-His)
PV046016 500 ng
EUR 329
Wasl 3'UTR Luciferase Stable Cell Line
TU122188 1.0 ml Ask for price
WASL 3'UTR GFP Stable Cell Line
TU078369 1.0 ml
EUR 1521
Wasl 3'UTR GFP Stable Cell Line
TU172188 1.0 ml Ask for price
Wasl 3'UTR Luciferase Stable Cell Line
TU223306 1.0 ml Ask for price
WASL 3'UTR Luciferase Stable Cell Line
TU028369 1.0 ml
EUR 1521
Wasl 3'UTR GFP Stable Cell Line
TU273306 1.0 ml Ask for price
WASL Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV697687 1.0 ug DNA
EUR 682
WASL Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV697691 1.0 ug DNA
EUR 682
WASL Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV697692 1.0 ug DNA
EUR 682
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252

WASL Rabbit Polyclonal Antibody