ARC Rabbit Polyclonal Antibody

ARC Rabbit Polyclonal Antibody

To Order Now:

ARC Polyclonal Antibody

ABP57807-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ARC protein at amino acid sequence of 70-150
  • Applications tips:
Description: A polyclonal antibody for detection of ARC from Human, Mouse, Rat. This ARC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ARC protein at amino acid sequence of 70-150

ARC Polyclonal Antibody

ABP57807-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ARC protein at amino acid sequence of 70-150
  • Applications tips:
Description: A polyclonal antibody for detection of ARC from Human, Mouse, Rat. This ARC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ARC protein at amino acid sequence of 70-150

ARC Polyclonal Antibody

ABP57807-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ARC protein at amino acid sequence of 70-150
  • Applications tips:
Description: A polyclonal antibody for detection of ARC from Human, Mouse, Rat. This ARC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ARC protein at amino acid sequence of 70-150

ARC Polyclonal Antibody

ES11228-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ARC from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ARC Polyclonal Antibody

ES11228-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ARC from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ARC Rabbit pAb

A9177-100ul 100 ul
EUR 308

ARC Rabbit pAb

A9177-200ul 200 ul
EUR 459

ARC Rabbit pAb

A9177-20ul 20 ul
EUR 183

ARC Rabbit pAb

A9177-50ul 50 ul
EUR 223

Polyclonal NOL3 / ARC Antibody

AMM06742G 1 ea
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NOL3 / ARC . This antibody is tested and proven to work in the following applications:

Human Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit

DLR-ARC-Hu-48T 48T
EUR 517
  • Should the Human Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Activity Regulated Cytoskeleton Associated Protein (ARC) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit

DLR-ARC-Hu-96T 96T
EUR 673
  • Should the Human Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Activity Regulated Cytoskeleton Associated Protein (ARC) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit

DLR-ARC-Mu-48T 48T
EUR 527
  • Should the Mouse Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Activity Regulated Cytoskeleton Associated Protein (ARC) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit

DLR-ARC-Mu-96T 96T
EUR 688
  • Should the Mouse Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Activity Regulated Cytoskeleton Associated Protein (ARC) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit

DLR-ARC-Ra-48T 48T
EUR 549
  • Should the Rat Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Activity Regulated Cytoskeleton Associated Protein (ARC) in samples from tissue homogenates or other biological fluids.

Rat Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit

DLR-ARC-Ra-96T 96T
EUR 718
  • Should the Rat Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Activity Regulated Cytoskeleton Associated Protein (ARC) in samples from tissue homogenates or other biological fluids.

Human Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit

RDR-ARC-Hu-48Tests 48 Tests
EUR 544

Human Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit

RDR-ARC-Hu-96Tests 96 Tests
EUR 756

Mouse Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit

RDR-ARC-Mu-48Tests 48 Tests
EUR 557

Mouse Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit

RDR-ARC-Mu-96Tests 96 Tests
EUR 774

Rat Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit

RDR-ARC-Ra-48Tests 48 Tests
EUR 583

Rat Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit

RDR-ARC-Ra-96Tests 96 Tests
EUR 811

Human Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit

RD-ARC-Hu-48Tests 48 Tests
EUR 521

Human Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit

RD-ARC-Hu-96Tests 96 Tests
EUR 723

Mouse Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit

RD-ARC-Mu-48Tests 48 Tests
EUR 533

Mouse Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit

RD-ARC-Mu-96Tests 96 Tests
EUR 740

Rat Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit

RD-ARC-Ra-48Tests 48 Tests
EUR 557

Rat Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit

RD-ARC-Ra-96Tests 96 Tests
EUR 775

Polyclonal ARC Antibody (N-term)

APR11458G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ARC (N-term). This antibody is tested and proven to work in the following applications:

ARC Antibody

24052-100ul 100ul
EUR 390

ARC Antibody

24081-100ul 100ul
EUR 390

ARC antibody

70R-31103 100 ug
EUR 327
Description: Rabbit polyclonal ARC antibody

ARC antibody

70R-13932 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal ARC antibody

ARC antibody

70R-15785 50 ul
EUR 435
Description: Rabbit polyclonal ARC antibody

ARC Antibody

33325-100ul 100ul
EUR 252

ARC Antibody

33325-50ul 50ul
EUR 187

ARC Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ARC. Recognizes ARC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

ARC Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ARC. Recognizes ARC from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

ARC Antibody

CSB-PA995409-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ARC. Recognizes ARC from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

ARC Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ARC. Recognizes ARC from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

ARC Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ARC. Recognizes ARC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

ARC Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ARC. Recognizes ARC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:200-1:1000, IHC:1:50-1:200

ARC antibody

70R-4422 50 ug
EUR 467
Description: Rabbit polyclonal ARC antibody raised against the middle region of ARC

ARC antibody

70R-8315 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal ARC antibody

ARC Antibody

AF0118 200ul
EUR 304
Description: ARC antibody detects endogenous levels of total ARC.

ARC Antibody

ABF0118 100 ug
EUR 438

Anti-p16 ARC Rabbit Monoclonal Antibody

M02096 100ug/vial
EUR 397
Description: Rabbit Monoclonal p16 ARC Antibody. Validated in Flow Cytometry, IP, IF, IHC, ICC, WB and tested in Human, Mouse, Rat.


RA15042 100 ug
EUR 526

Polyclonal NOL3 / ARC Antibody (aa159-208)

AMM06743G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NOL3 / ARC (aa159-208). This antibody is tested and proven to work in the following applications:

p21-ARC antibody

22102-100ul 100ul
EUR 390

p21 ARC antibody

70R-12631 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal p21 ARC antibody

p16 ARC Antibody

48673-100ul 100ul
EUR 333

p16 ARC Antibody

48673-50ul 50ul
EUR 239

ARC Conjugated Antibody

C33325 100ul
EUR 397

ARC / ARG3.1 Antibody

abx230524-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Anti-Arc Antibody

PA1390 100ug/vial
EUR 294

Anti-Arc Antibody

PB9753 100ug/vial
EUR 294

Anti-ARC antibody

STJ111600 100 µl
EUR 277

Anti-ARC antibody

STJ192386 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ARC

Polyclonal ARPC2 / p34-Arc Antibody (C-Terminus)

APR15062G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ARPC2 / p34-Arc (C-Terminus). This antibody is tested and proven to work in the following applications:

Rabbit Anti-ARC monoclonal antibody, clone TS45-13

CABT-L589 100 ul
EUR 777


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA27515 50 ug
EUR 363
Description: Mouse polyclonal to ARC

Human p16 ARC Antibody

32957-05111 150 ug
EUR 261

Human p21-ARC Antibody

33339-05111 150 ug
EUR 261

p16 ARC Conjugated Antibody

C48673 100ul
EUR 397

anti- ARC/ARG3.1 antibody

FNab00524 100µg
EUR 505.25
  • Immunogen: activity-regulated cytoskeleton-associated protein
  • Uniprot ID: Q7LC44
  • Gene ID: 23237
  • Research Area: Neuroscience, Developmental biology
Description: Antibody raised against ARC/ARG3.1

Anti-ARC/ARG3.1 antibody

PAab00524 100 ug
EUR 355

Polyclonal ARPC1B / p41-ARC / ARP2 Antibody (N-Terminus)

APR15059G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ARPC1B / p41-ARC / ARP2 (N-Terminus). This antibody is tested and proven to work in the following applications:

ARC Blocking Peptide

33R-2533 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ARC antibody, catalog no. 70R-8315

ARC Blocking Peptide

33R-2534 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ARC antibody, catalog no. 70R-4422

ARC 239 dihydrochloride

B6508-25 25 mg
EUR 535
Description: ARC 239 dihydrochloride is a selective antagonist of ?2B adrenoceptor with pKD value of 8.8 [1]. ?2B adrenoceptor is a G-protein coupled receptor.

ARC 239 dihydrochloride

B6508-5 5 mg
EUR 177
Description: ARC 239 dihydrochloride is a selective antagonist of ?2B adrenoceptor with pKD value of 8.8 [1]. ?2B adrenoceptor is a G-protein coupled receptor.

ARC Blocking Peptide

AF0118-BP 1mg
EUR 195

ARC cloning plasmid

CSB-CL001981HU-10ug 10ug
EUR 443
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1191
  • Sequence: atggagctggaccaccggaccagcggcgggctccacgcctaccccgggccgcggggcgggcaggtggccaagcccaacgtgatcctgcagatcgggaagtgccgggccgagatgctggagcacgtgcggcggacgcaccggcacctgctggccgaggtgtccaagcaggtggagc
  • Show more
Description: A cloning plasmid for the ARC gene.

ARC Rabbit Polyclonal Antibody