EGFL7 Rabbit Polyclonal Antibody

EGFL7 Rabbit Polyclonal Antibody

To Order Now:

EGFL7 Polyclonal Antibody

ABP58463-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human EGFL7 protein at amino acid sequence of 140-220
  • Applications tips:
Description: A polyclonal antibody for detection of EGFL7 from Human, Mouse, Rat. This EGFL7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EGFL7 protein at amino acid sequence of 140-220

EGFL7 Polyclonal Antibody

ABP58463-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human EGFL7 protein at amino acid sequence of 140-220
  • Applications tips:
Description: A polyclonal antibody for detection of EGFL7 from Human, Mouse, Rat. This EGFL7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EGFL7 protein at amino acid sequence of 140-220

EGFL7 Rabbit pAb

A9376-100ul 100 ul
EUR 308

EGFL7 Rabbit pAb

A9376-200ul 200 ul
EUR 459

EGFL7 Rabbit pAb

A9376-20ul 20 ul
EUR 183

EGFL7 Rabbit pAb

A9376-50ul 50 ul
EUR 223

EGFL7 Antibody

35721-100ul 100ul
EUR 252

EGFL7 antibody

70R-17016 50 ul
EUR 435
Description: Rabbit polyclonal EGFL7 antibody

EGFL7 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EGFL7. Recognizes EGFL7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

EGFL7 Antibody

DF12391 200ul
EUR 304
Description: EGFL7 antibody detects endogenous levels of EGFL7.

EGFL7 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against EGFL7. Recognizes EGFL7 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

EGFL7 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EGFL7. Recognizes EGFL7 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

Human EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit

DLR-EGFL7-Hu-48T 48T
EUR 590
  • Should the Human EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human EGF Like Domain Protein, Multiple 7 (EGFL7) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit

DLR-EGFL7-Hu-96T 96T
EUR 774
  • Should the Human EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human EGF Like Domain Protein, Multiple 7 (EGFL7) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit

DLR-EGFL7-Mu-48T 48T
EUR 566
  • Should the Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit

DLR-EGFL7-Mu-96T 96T
EUR 741
  • Should the Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit

RDR-EGFL7-Hu-48Tests 48 Tests
EUR 631

Human EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit

RDR-EGFL7-Hu-96Tests 96 Tests
EUR 880

Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit

RDR-EGFL7-Mu-48Tests 48 Tests
EUR 603

Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit

RDR-EGFL7-Mu-96Tests 96 Tests
EUR 840

Human EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit

RD-EGFL7-Hu-48Tests 48 Tests
EUR 603

Human EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit

RD-EGFL7-Hu-96Tests 96 Tests
EUR 840

Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit

RD-EGFL7-Mu-48Tests 48 Tests
EUR 577

Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit

RD-EGFL7-Mu-96Tests 96 Tests
EUR 802

EGFL7 Conjugated Antibody

C35721 100ul
EUR 397

anti- EGFL7 antibody

FNab02666 100µg
EUR 505.25
  • Immunogen: EGF-like-domain, multiple 7
  • Uniprot ID: Q9UHF1
  • Gene ID: 51162
  • Research Area: Cardiovascular, Developmental biology
Description: Antibody raised against EGFL7

Anti-EGFL7 antibody

PAab02666 100 ug
EUR 355

Anti-EGFL7 antibody

STJ73452 100 µg
EUR 359

Anti-EGFL7 antibody

STJ117865 100 µl
EUR 277
Description: This gene encodes a secreted endothelial cell protein that contains two epidermal growth factor-like domains. The encoded protein may play a role in regulating vasculogenesis. This protein may be involved in the growth and proliferation of tumor cells. Alternate splicing results in multiple transcript variants.

Anti-EGFL7 antibody

STJ192463 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to EGFL7

Egfl7/ Rat Egfl7 ELISA Kit

ELI-31539r 96 Tests
EUR 886

Polyclonal Goat Anti-EGFL7 Antibody (internal region)

AMM04962G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-EGFL7 (internal region). This antibody is tested and proven to work in the following applications:


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA18891 100 ul
EUR 403
Description: Rabbit polyclonal to EGFL7


YF-PA18892 100 ug
EUR 403
Description: Rabbit polyclonal to EGFL7


YF-PA26144 50 ul
EUR 334
Description: Mouse polyclonal to EGFL7


YF-PA27553 50 ug
EUR 363
Description: Mouse polyclonal to EGFL7

EGFL7 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EGFL7. Recognizes EGFL7 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EGFL7 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EGFL7. Recognizes EGFL7 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EGFL7 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EGFL7. Recognizes EGFL7 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

EGFL7 Blocking Peptide

DF12391-BP 1mg
EUR 195

EGFL7 cloning plasmid

CSB-CL890692HU-10ug 10ug
EUR 339
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 822
  • Sequence: atgaggggctctcaggaggtgctgctgatgtggcttctggtgttggcagtgggcggcacagagcacgcctaccggcccggccgtagggtgtgtgctgtccgggctcacggggaccctgtctccgagtcgttcgtgcagcgtgtgtaccagcccttcctcaccacctgcgacgggca
  • Show more
Description: A cloning plasmid for the EGFL7 gene.


PVT13643 2 ug
EUR 391

Anti-EGFL7 (2H6)

YF-MA18426 100 ug
EUR 363
Description: Mouse monoclonal to EGFL7

Anti-EGFL7 (3G1)

YF-MA18427 100 ug
EUR 363
Description: Mouse monoclonal to EGFL7

EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Human)

  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EGFL7 (Tyr24~Ser273)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human EGF Like Domain Protein, Multiple 7 (EGFL7)

EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Mouse)

  • EUR 266.00
  • EUR 2813.00
  • EUR 694.00
  • EUR 337.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EGFL7 (Glu22~Leu275)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse EGF Like Domain Protein, Multiple 7 (EGFL7)

Rat EGFL7 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse EGFL7 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELA-E9193h 96 Tests
EUR 824


EF006491 96 Tests
EUR 689

Human EGFL7 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pEGFP-N1-EGFL7 Plasmid

PVTB00895-2a 2 ug
EUR 356

EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Human), APC

  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EGFL7 (Tyr24~Ser273)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human EGF Like Domain Protein, Multiple 7 (EGFL7). This antibody is labeled with APC.

EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Human), Biotinylated

  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EGFL7 (Tyr24~Ser273)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human EGF Like Domain Protein, Multiple 7 (EGFL7). This antibody is labeled with Biotin.

EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Human), Cy3

  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EGFL7 (Tyr24~Ser273)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human EGF Like Domain Protein, Multiple 7 (EGFL7). This antibody is labeled with Cy3.

EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Human), FITC

  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EGFL7 (Tyr24~Ser273)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human EGF Like Domain Protein, Multiple 7 (EGFL7). This antibody is labeled with FITC.

EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Human), HRP

  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EGFL7 (Tyr24~Ser273)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human EGF Like Domain Protein, Multiple 7 (EGFL7). This antibody is labeled with HRP.

EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Human), PE

  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EGFL7 (Tyr24~Ser273)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human EGF Like Domain Protein, Multiple 7 (EGFL7). This antibody is labeled with PE.

EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Mouse), APC

  • EUR 374.00
  • EUR 3689.00
  • EUR 1016.00
  • EUR 481.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EGFL7 (Glu22~Leu275)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse EGF Like Domain Protein, Multiple 7 (EGFL7). This antibody is labeled with APC.

EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 332.00
  • EUR 2763.00
  • EUR 803.00
  • EUR 411.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EGFL7 (Glu22~Leu275)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse EGF Like Domain Protein, Multiple 7 (EGFL7). This antibody is labeled with Biotin.

EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Mouse), Cy3

  • EUR 457.00
  • EUR 4877.00
  • EUR 1313.00
  • EUR 600.00
  • EUR 267.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EGFL7 (Glu22~Leu275)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse EGF Like Domain Protein, Multiple 7 (EGFL7). This antibody is labeled with Cy3.

EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Mouse), FITC

  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EGFL7 (Glu22~Leu275)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse EGF Like Domain Protein, Multiple 7 (EGFL7). This antibody is labeled with FITC.

EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Mouse), HRP

  • EUR 341.00
  • EUR 3213.00
  • EUR 897.00
  • EUR 433.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EGFL7 (Glu22~Leu275)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse EGF Like Domain Protein, Multiple 7 (EGFL7). This antibody is labeled with HRP.

EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Mouse), PE

  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EGFL7 (Glu22~Leu275)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse EGF Like Domain Protein, Multiple 7 (EGFL7). This antibody is labeled with PE.

Monoclonal EGFL7 Antibody (monoclonal) (M01), Clone: 2H6

APR07659G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human EGFL7 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2H6. This antibody is applicable in WB, E

Monoclonal EGFL7 Antibody (monoclonal) (M02), Clone: 3G1

APR07660G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human EGFL7 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 3G1. This antibody is applicable in E

EGF Like Domain Multiple 7 (EGFL7) Antibody

abx145646-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

EGF Like Domain Multiple 7 (EGFL7) Antibody

abx432640-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

EGF Like Domain Multiple 7 (EGFL7) Antibody

abx232666-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

EGFL7 ORF Vector (Human) (pORF)

ORF003431 1.0 ug DNA
EUR 95

Egfl7 ORF Vector (Rat) (pORF)

ORF066401 1.0 ug DNA
EUR 506

Egfl7 ORF Vector (Mouse) (pORF)

ORF043689 1.0 ug DNA
EUR 506

Egfl7 ORF Vector (Mouse) (pORF)

ORF043690 1.0 ug DNA
EUR 506

Egfl7 ORF Vector (Mouse) (pORF)

ORF043691 1.0 ug DNA
EUR 506

Egfl7 ORF Vector (Mouse) (pORF)

ORF043692 1.0 ug DNA
EUR 506

EGFL7 ELISA Kit (Human) (OKAN06007)

OKAN06007 96 Wells
EUR 792
Description: Description of target: This gene encodes a secreted endothelial cell protein that contains two epidermal growth factor-like domains. The encoded protein may play a role in regulating vasculogenesis. This protein may be involved in the growth and proliferation of tumor cells. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 13.1 pg/mL

EGFL7 ELISA Kit (Mouse) (OKCD02517)

OKCD02517 96 Wells
EUR 936
Description: Description of target: Regulates vascular tubulogenesis in vivo. Inhibits platelet-derived growth factor (PDGF)-BB-induced smooth muscle cell migration and promotes endothelial cell adhesion to the extracellular matrix and angiogenesis.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.062 ng/mL

EGFL7 ELISA Kit (Human) (OKCD09318)

OKCD09318 96 Wells
EUR 909
Description: Description of target: This gene encodes a secreted endothelial cell protein that contains two epidermal growth factor-like domains. The encoded protein may play a role in regulating vasculogenesis. This protein may be involved in the growth and proliferation of tumor cells. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 13.1pg/mL

EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Human), APC-Cy7

  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EGFL7 (Tyr24~Ser273)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human EGF Like Domain Protein, Multiple 7 (EGFL7). This antibody is labeled with APC-Cy7.

EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 628.00
  • EUR 7258.00
  • EUR 1912.00
  • EUR 842.00
  • EUR 344.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EGFL7 (Glu22~Leu275)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse EGF Like Domain Protein, Multiple 7 (EGFL7). This antibody is labeled with APC-Cy7.

EGF Like Domain Protein, Multiple 7 (EGFL7) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

EGF Like Domain Protein, Multiple 7 (EGFL7) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

EGF Like Domain Protein, Multiple 7 (EGFL7) Antibody

  • EUR 467.00
  • EUR 133.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

EGF Like Domain Protein, Multiple 7 (EGFL7) Antibody

  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

EGF Like Domain Protein, Multiple 7 (EGFL7) Antibody

  • EUR 1344.00
  • EUR 634.00
  • 1 mg
  • 200 ug
  • Please enquire.

EGF Like Domain Protein, Multiple 7 (EGFL7) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anti-EGFL7 (Parsatuzumab)-SMCC-DM1 ADC

ADC-W-1028 1mg Ask for price
Description: This ADC product is comprised of an anti-EGFL7 monoclonal antibody conjugated via a SMCC linker to DM1

Anti-EGFL7 (Parsatuzumab)-SPDB-DM4 ADC

ADC-W-1029 1mg Ask for price
Description: This ADC product is comprised of an anti-EGFL7 monoclonal antibody conjugated via a SPDB linker to DM4

Anti-EGFL7 (Parsatuzumab)-MC-MMAF ADC

ADC-W-1030 1mg Ask for price
Description: This ADC product is comprised of an anti-EGFL7 monoclonal antibody conjugated via a MC linker to MMAF

EGFL7 sgRNA CRISPR Lentivector set (Human)

K0661901 3 x 1.0 ug
EUR 339

Egfl7 sgRNA CRISPR Lentivector set (Mouse)

K4502801 3 x 1.0 ug
EUR 339

Egfl7 sgRNA CRISPR Lentivector set (Rat)

K7409601 3 x 1.0 ug
EUR 339

EGFL7 sgRNA CRISPR Lentivector (Human) (Target 1)

K0661902 1.0 ug DNA
EUR 154

EGFL7 sgRNA CRISPR Lentivector (Human) (Target 2)

K0661903 1.0 ug DNA
EUR 154

EGFL7 sgRNA CRISPR Lentivector (Human) (Target 3)

K0661904 1.0 ug DNA
EUR 154

Egfl7 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4502802 1.0 ug DNA
EUR 154

Egfl7 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4502803 1.0 ug DNA
EUR 154

Egfl7 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4502804 1.0 ug DNA
EUR 154

Egfl7 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7409602 1.0 ug DNA
EUR 154

Egfl7 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7409603 1.0 ug DNA
EUR 154

Egfl7 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7409604 1.0 ug DNA
EUR 154

EGFL7 Protein Vector (Mouse) (pPB-C-His)

PV174754 500 ng
EUR 603

EGFL7 Protein Vector (Mouse) (pPB-N-His)

PV174755 500 ng
EUR 603

EGFL7 Protein Vector (Mouse) (pPM-C-HA)

PV174756 500 ng
EUR 603

EGFL7 Protein Vector (Mouse) (pPM-C-His)

PV174757 500 ng
EUR 603

EGFL7 Protein Vector (Mouse) (pPB-C-His)

PV174758 500 ng
EUR 603

EGFL7 Protein Vector (Mouse) (pPB-N-His)

PV174759 500 ng
EUR 603

EGFL7 Protein Vector (Mouse) (pPM-C-HA)

PV174760 500 ng
EUR 603

EGFL7 Protein Vector (Mouse) (pPM-C-His)

PV174761 500 ng
EUR 603

EGFL7 Protein Vector (Mouse) (pPB-C-His)

PV174762 500 ng
EUR 603

EGFL7 Protein Vector (Mouse) (pPB-N-His)

PV174763 500 ng
EUR 603

EGFL7 Protein Vector (Mouse) (pPM-C-HA)

PV174764 500 ng
EUR 603

EGFL7 Protein Vector (Mouse) (pPM-C-His)

PV174765 500 ng
EUR 603

EGFL7 Protein Vector (Mouse) (pPB-C-His)

PV174766 500 ng
EUR 603

EGFL7 Protein Vector (Mouse) (pPB-N-His)

PV174767 500 ng
EUR 603

EGFL7 Protein Vector (Mouse) (pPM-C-HA)

PV174768 500 ng
EUR 603

EGFL7 Protein Vector (Mouse) (pPM-C-His)

PV174769 500 ng
EUR 603

EGFL7 Protein Vector (Human) (pPB-C-His)

PV013721 500 ng
EUR 329

EGFL7 Protein Vector (Human) (pPB-N-His)

PV013722 500 ng
EUR 329

EGFL7 Protein Vector (Human) (pPM-C-HA)

PV013723 500 ng
EUR 329

EGFL7 Protein Vector (Human) (pPM-C-His)

PV013724 500 ng
EUR 329

EGFL7 Protein Vector (Rat) (pPB-C-His)

PV265602 500 ng
EUR 603

EGFL7 Protein Vector (Rat) (pPB-N-His)

PV265603 500 ng
EUR 603

EGFL7 Protein Vector (Rat) (pPM-C-HA)

PV265604 500 ng
EUR 603

EGFL7 Protein Vector (Rat) (pPM-C-His)

PV265605 500 ng
EUR 603

Egfl7 3'UTR Luciferase Stable Cell Line

TU203832 1.0 ml Ask for price

Egfl7 3'UTR GFP Stable Cell Line

TU155663 1.0 ml Ask for price

EGFL7 3'UTR Luciferase Stable Cell Line

TU006670 1.0 ml
EUR 1394

Egfl7 3'UTR Luciferase Stable Cell Line

TU105663 1.0 ml Ask for price

EGFL7 3'UTR GFP Stable Cell Line

TU056670 1.0 ml
EUR 1394

Egfl7 3'UTR GFP Stable Cell Line

TU253832 1.0 ml Ask for price

EGFL7 ELISA Kit (Human) : 96 Wells (OKEH01928)

OKEH01928 96 Wells
EUR 727
Description: Description of target: This gene encodes a secreted endothelial cell protein that contains two epidermal growth factor-like domains. The encoded protein may play a role in regulating vasculogenesis. This protein may be involved in the growth and proliferation of tumor cells. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 12 pg/mL

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

EGFL7 Rabbit Polyclonal Antibody