EGFL7 Rabbit Polyclonal Antibody
EGFL7 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
EGFL7 Polyclonal Antibody |
ES11305-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against EGFL7 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
EGFL7 Polyclonal Antibody |
ES11305-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against EGFL7 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
EGFL7 Rabbit pAb |
A9376-100ul |
Abclonal |
100 ul |
EUR 308 |
EGFL7 Rabbit pAb |
A9376-200ul |
Abclonal |
200 ul |
EUR 459 |
EGFL7 Rabbit pAb |
A9376-20ul |
Abclonal |
20 ul |
EUR 183 |
EGFL7 Rabbit pAb |
A9376-50ul |
Abclonal |
50 ul |
EUR 223 |
EGFL7 antibody |
70R-17016 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal EGFL7 antibody |
EGFL7 Antibody |
35721-100ul |
SAB |
100ul |
EUR 252 |
EGFL7 Antibody |
1-CSB-PA890692LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EGFL7. Recognizes EGFL7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500 |
EGFL7 Antibody |
DF12391 |
Affbiotech |
200ul |
EUR 304 |
Description: EGFL7 antibody detects endogenous levels of EGFL7. |
EGFL7 Antibody |
1-CSB-PA241758 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against EGFL7. Recognizes EGFL7 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100 |
EGFL7 Antibody |
1-CSB-PA007476GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against EGFL7. Recognizes EGFL7 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Human EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit |
DLR-EGFL7-Hu-48T |
DL Develop |
48T |
EUR 590 |
- Should the Human EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human EGF Like Domain Protein, Multiple 7 (EGFL7) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit |
DLR-EGFL7-Hu-96T |
DL Develop |
96T |
EUR 774 |
- Should the Human EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human EGF Like Domain Protein, Multiple 7 (EGFL7) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit |
DLR-EGFL7-Mu-48T |
DL Develop |
48T |
EUR 566 |
- Should the Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit |
DLR-EGFL7-Mu-96T |
DL Develop |
96T |
EUR 741 |
- Should the Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit |
RDR-EGFL7-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 631 |
Human EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit |
RDR-EGFL7-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 880 |
Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit |
RDR-EGFL7-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 603 |
Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit |
RDR-EGFL7-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 840 |
Human EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit |
RD-EGFL7-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 603 |
Human EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit |
RD-EGFL7-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 840 |
Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit |
RD-EGFL7-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 577 |
Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit |
RD-EGFL7-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 802 |
EGFL7 Conjugated Antibody |
C35721 |
SAB |
100ul |
EUR 397 |
anti- EGFL7 antibody |
FNab02666 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: EGF-like-domain, multiple 7
- Uniprot ID: Q9UHF1
- Gene ID: 51162
- Research Area: Cardiovascular, Developmental biology
|
Description: Antibody raised against EGFL7 |
Anti-EGFL7 antibody |
STJ117865 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a secreted endothelial cell protein that contains two epidermal growth factor-like domains. The encoded protein may play a role in regulating vasculogenesis. This protein may be involved in the growth and proliferation of tumor cells. Alternate splicing results in multiple transcript variants. |
Anti-EGFL7 antibody |
STJ192463 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to EGFL7 |
Polyclonal Goat Anti-EGFL7 Antibody (internal region) |
AMM04962G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-EGFL7 (internal region). This antibody is tested and proven to work in the following applications: |
EGFL7 siRNA |
20-abx901654 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EGFL7 siRNA |
20-abx915065 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EGFL7 siRNA |
20-abx915066 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-EGFL7 |
YF-PA18891 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to EGFL7 |
anti-EGFL7 |
YF-PA18892 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to EGFL7 |
anti-EGFL7 |
YF-PA26144 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to EGFL7 |
anti-EGFL7 |
YF-PA27553 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to EGFL7 |
EGFL7 Antibody, HRP conjugated |
1-CSB-PA890692LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EGFL7. Recognizes EGFL7 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
EGFL7 Antibody, FITC conjugated |
1-CSB-PA890692LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EGFL7. Recognizes EGFL7 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
EGFL7 Antibody, Biotin conjugated |
1-CSB-PA890692LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EGFL7. Recognizes EGFL7 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
EGFL7 Blocking Peptide |
DF12391-BP |
Affbiotech |
1mg |
EUR 195 |
EGFL7 cloning plasmid |
CSB-CL890692HU-10ug |
Cusabio |
10ug |
EUR 339 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 822
- Sequence: atgaggggctctcaggaggtgctgctgatgtggcttctggtgttggcagtgggcggcacagagcacgcctaccggcccggccgtagggtgtgtgctgtccgggctcacggggaccctgtctccgagtcgttcgtgcagcgtgtgtaccagcccttcctcaccacctgcgacgggca
- Show more
|
Description: A cloning plasmid for the EGFL7 gene. |
Anti-EGFL7 (2H6) |
YF-MA18426 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to EGFL7 |
Anti-EGFL7 (3G1) |
YF-MA18427 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to EGFL7 |
EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Human) |
4-PAL643Hu01 |
Cloud-Clone |
-
EUR 262.00
-
EUR 2747.00
-
EUR 679.00
-
EUR 331.00
-
EUR 220.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGFL7 (Tyr24~Ser273)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human EGF Like Domain Protein, Multiple 7 (EGFL7) |
EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Mouse) |
4-PAL643Mu01 |
Cloud-Clone |
-
EUR 266.00
-
EUR 2813.00
-
EUR 694.00
-
EUR 337.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGFL7 (Glu22~Leu275)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) |
Rat EGFL7 shRNA Plasmid |
20-abx987913 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human EGFL7 shRNA Plasmid |
20-abx959573 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse EGFL7 shRNA Plasmid |
20-abx983708 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Human), APC |
4-PAL643Hu01-APC |
Cloud-Clone |
-
EUR 368.00
-
EUR 3599.00
-
EUR 993.00
-
EUR 472.00
-
EUR 229.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGFL7 (Tyr24~Ser273)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human EGF Like Domain Protein, Multiple 7 (EGFL7). This antibody is labeled with APC. |
EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Human), Biotinylated |
4-PAL643Hu01-Biotin |
Cloud-Clone |
-
EUR 328.00
-
EUR 2697.00
-
EUR 786.00
-
EUR 404.00
-
EUR 226.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGFL7 (Tyr24~Ser273)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human EGF Like Domain Protein, Multiple 7 (EGFL7). This antibody is labeled with Biotin. |
EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Human), Cy3 |
4-PAL643Hu01-Cy3 |
Cloud-Clone |
-
EUR 449.00
-
EUR 4757.00
-
EUR 1283.00
-
EUR 588.00
-
EUR 264.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGFL7 (Tyr24~Ser273)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human EGF Like Domain Protein, Multiple 7 (EGFL7). This antibody is labeled with Cy3. |
EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Human), FITC |
4-PAL643Hu01-FITC |
Cloud-Clone |
-
EUR 314.00
-
EUR 2899.00
-
EUR 814.00
-
EUR 397.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGFL7 (Tyr24~Ser273)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human EGF Like Domain Protein, Multiple 7 (EGFL7). This antibody is labeled with FITC. |
EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Human), HRP |
4-PAL643Hu01-HRP |
Cloud-Clone |
-
EUR 335.00
-
EUR 3135.00
-
EUR 877.00
-
EUR 426.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGFL7 (Tyr24~Ser273)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human EGF Like Domain Protein, Multiple 7 (EGFL7). This antibody is labeled with HRP. |
EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Human), PE |
4-PAL643Hu01-PE |
Cloud-Clone |
-
EUR 314.00
-
EUR 2899.00
-
EUR 814.00
-
EUR 397.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGFL7 (Tyr24~Ser273)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human EGF Like Domain Protein, Multiple 7 (EGFL7). This antibody is labeled with PE. |
EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Mouse), APC |
4-PAL643Mu01-APC |
Cloud-Clone |
-
EUR 374.00
-
EUR 3689.00
-
EUR 1016.00
-
EUR 481.00
-
EUR 232.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGFL7 (Glu22~Leu275)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse EGF Like Domain Protein, Multiple 7 (EGFL7). This antibody is labeled with APC. |
EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Mouse), Biotinylated |
4-PAL643Mu01-Biotin |
Cloud-Clone |
-
EUR 332.00
-
EUR 2763.00
-
EUR 803.00
-
EUR 411.00
-
EUR 228.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGFL7 (Glu22~Leu275)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse EGF Like Domain Protein, Multiple 7 (EGFL7). This antibody is labeled with Biotin. |
EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Mouse), Cy3 |
4-PAL643Mu01-Cy3 |
Cloud-Clone |
-
EUR 457.00
-
EUR 4877.00
-
EUR 1313.00
-
EUR 600.00
-
EUR 267.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGFL7 (Glu22~Leu275)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse EGF Like Domain Protein, Multiple 7 (EGFL7). This antibody is labeled with Cy3. |
EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Mouse), FITC |
4-PAL643Mu01-FITC |
Cloud-Clone |
-
EUR 319.00
-
EUR 2971.00
-
EUR 832.00
-
EUR 405.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGFL7 (Glu22~Leu275)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse EGF Like Domain Protein, Multiple 7 (EGFL7). This antibody is labeled with FITC. |
EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Mouse), HRP |
4-PAL643Mu01-HRP |
Cloud-Clone |
-
EUR 341.00
-
EUR 3213.00
-
EUR 897.00
-
EUR 433.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGFL7 (Glu22~Leu275)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse EGF Like Domain Protein, Multiple 7 (EGFL7). This antibody is labeled with HRP. |
EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Mouse), PE |
4-PAL643Mu01-PE |
Cloud-Clone |
-
EUR 319.00
-
EUR 2971.00
-
EUR 832.00
-
EUR 405.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGFL7 (Glu22~Leu275)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse EGF Like Domain Protein, Multiple 7 (EGFL7). This antibody is labeled with PE. |
EGF Like Domain Multiple 7 (EGFL7) Antibody |
abx145646-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Monoclonal EGFL7 Antibody (monoclonal) (M01), Clone: 2H6 |
APR07659G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human EGFL7 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2H6. This antibody is applicable in WB, E |
Monoclonal EGFL7 Antibody (monoclonal) (M02), Clone: 3G1 |
APR07660G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human EGFL7 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 3G1. This antibody is applicable in E |
EGF Like Domain Multiple 7 (EGFL7) Antibody |
abx432640-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
EGF Like Domain Multiple 7 (EGFL7) Antibody |
abx232666-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Egfl7 ORF Vector (Rat) (pORF) |
ORF066401 |
ABM |
1.0 ug DNA |
EUR 506 |
EGFL7 ORF Vector (Human) (pORF) |
ORF003431 |
ABM |
1.0 ug DNA |
EUR 95 |
Egfl7 ORF Vector (Mouse) (pORF) |
ORF043689 |
ABM |
1.0 ug DNA |
EUR 506 |
Egfl7 ORF Vector (Mouse) (pORF) |
ORF043690 |
ABM |
1.0 ug DNA |
EUR 506 |
Egfl7 ORF Vector (Mouse) (pORF) |
ORF043691 |
ABM |
1.0 ug DNA |
EUR 506 |
Egfl7 ORF Vector (Mouse) (pORF) |
ORF043692 |
ABM |
1.0 ug DNA |
EUR 506 |
EGFL7 ELISA Kit (Human) (OKAN06007) |
OKAN06007 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes a secreted endothelial cell protein that contains two epidermal growth factor-like domains. The encoded protein may play a role in regulating vasculogenesis. This protein may be involved in the growth and proliferation of tumor cells. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 13.1 pg/mL |
EGFL7 ELISA Kit (Mouse) (OKCD02517) |
OKCD02517 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
Description: Description of target: Regulates vascular tubulogenesis in vivo. Inhibits platelet-derived growth factor (PDGF)-BB-induced smooth muscle cell migration and promotes endothelial cell adhesion to the extracellular matrix and angiogenesis.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.062 ng/mL |
EGFL7 ELISA Kit (Human) (OKCD09318) |
OKCD09318 |
Aviva Systems Biology |
96 Wells |
EUR 909 |
Description: Description of target: This gene encodes a secreted endothelial cell protein that contains two epidermal growth factor-like domains. The encoded protein may play a role in regulating vasculogenesis. This protein may be involved in the growth and proliferation of tumor cells. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 13.1pg/mL |
EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Human), APC-Cy7 |
4-PAL643Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 616.00
-
EUR 7078.00
-
EUR 1867.00
-
EUR 824.00
-
EUR 338.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGFL7 (Tyr24~Ser273)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human EGF Like Domain Protein, Multiple 7 (EGFL7). This antibody is labeled with APC-Cy7. |
EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAL643Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 628.00
-
EUR 7258.00
-
EUR 1912.00
-
EUR 842.00
-
EUR 344.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGFL7 (Glu22~Leu275)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse EGF Like Domain Protein, Multiple 7 (EGFL7). This antibody is labeled with APC-Cy7. |
EGF Like Domain Protein, Multiple 7 (EGFL7) Antibody |
20-abx176224 |
Abbexa |
|
|
|
EGF Like Domain Protein, Multiple 7 (EGFL7) Antibody |
20-abx212160 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EGF Like Domain Protein, Multiple 7 (EGFL7) Antibody |
20-abx112249 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EGF Like Domain Protein, Multiple 7 (EGFL7) Antibody |
20-abx129054 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
EGF Like Domain Protein, Multiple 7 (EGFL7) Antibody |
20-abx129919 |
Abbexa |
-
EUR 467.00
-
EUR 133.00
-
EUR 1344.00
-
EUR 634.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
EGF Like Domain Protein, Multiple 7 (EGFL7) Antibody |
20-abx172195 |
Abbexa |
|
|
|
Anti-EGFL7 (Parsatuzumab)-SMCC-DM1 ADC |
ADC-W-1028 |
Creative Biolabs |
1mg |
Ask for price |
Description: This ADC product is comprised of an anti-EGFL7 monoclonal antibody conjugated via a SMCC linker to DM1 |
Anti-EGFL7 (Parsatuzumab)-SPDB-DM4 ADC |
ADC-W-1029 |
Creative Biolabs |
1mg |
Ask for price |
Description: This ADC product is comprised of an anti-EGFL7 monoclonal antibody conjugated via a SPDB linker to DM4 |
Anti-EGFL7 (Parsatuzumab)-MC-MMAF ADC |
ADC-W-1030 |
Creative Biolabs |
1mg |
Ask for price |
Description: This ADC product is comprised of an anti-EGFL7 monoclonal antibody conjugated via a MC linker to MMAF |
EGFL7 sgRNA CRISPR Lentivector set (Human) |
K0661901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Egfl7 sgRNA CRISPR Lentivector set (Rat) |
K7409601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Egfl7 sgRNA CRISPR Lentivector set (Mouse) |
K4502801 |
ABM |
3 x 1.0 ug |
EUR 339 |
EGFL7 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0661902 |
ABM |
1.0 ug DNA |
EUR 154 |
EGFL7 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0661903 |
ABM |
1.0 ug DNA |
EUR 154 |
EGFL7 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0661904 |
ABM |
1.0 ug DNA |
EUR 154 |
Egfl7 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7409602 |
ABM |
1.0 ug DNA |
EUR 154 |
Egfl7 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7409603 |
ABM |
1.0 ug DNA |
EUR 154 |
Egfl7 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7409604 |
ABM |
1.0 ug DNA |
EUR 154 |
Egfl7 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4502802 |
ABM |
1.0 ug DNA |
EUR 154 |
Egfl7 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4502803 |
ABM |
1.0 ug DNA |
EUR 154 |
Egfl7 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4502804 |
ABM |
1.0 ug DNA |
EUR 154 |
EGFL7 Protein Vector (Mouse) (pPB-C-His) |
PV174754 |
ABM |
500 ng |
EUR 603 |
EGFL7 Protein Vector (Mouse) (pPB-N-His) |
PV174755 |
ABM |
500 ng |
EUR 603 |
EGFL7 Protein Vector (Mouse) (pPM-C-HA) |
PV174756 |
ABM |
500 ng |
EUR 603 |
EGFL7 Protein Vector (Mouse) (pPM-C-His) |
PV174757 |
ABM |
500 ng |
EUR 603 |
EGFL7 Protein Vector (Mouse) (pPB-C-His) |
PV174758 |
ABM |
500 ng |
EUR 603 |
EGFL7 Protein Vector (Mouse) (pPB-N-His) |
PV174759 |
ABM |
500 ng |
EUR 603 |
EGFL7 Protein Vector (Mouse) (pPM-C-HA) |
PV174760 |
ABM |
500 ng |
EUR 603 |
EGFL7 Protein Vector (Mouse) (pPM-C-His) |
PV174761 |
ABM |
500 ng |
EUR 603 |
EGFL7 Protein Vector (Mouse) (pPB-C-His) |
PV174762 |
ABM |
500 ng |
EUR 603 |
EGFL7 Protein Vector (Mouse) (pPB-N-His) |
PV174763 |
ABM |
500 ng |
EUR 603 |
EGFL7 Protein Vector (Mouse) (pPM-C-HA) |
PV174764 |
ABM |
500 ng |
EUR 603 |
EGFL7 Protein Vector (Mouse) (pPM-C-His) |
PV174765 |
ABM |
500 ng |
EUR 603 |
EGFL7 Protein Vector (Mouse) (pPB-C-His) |
PV174766 |
ABM |
500 ng |
EUR 603 |
EGFL7 Protein Vector (Mouse) (pPB-N-His) |
PV174767 |
ABM |
500 ng |
EUR 603 |
EGFL7 Protein Vector (Mouse) (pPM-C-HA) |
PV174768 |
ABM |
500 ng |
EUR 603 |
EGFL7 Protein Vector (Mouse) (pPM-C-His) |
PV174769 |
ABM |
500 ng |
EUR 603 |
EGFL7 Protein Vector (Rat) (pPB-C-His) |
PV265602 |
ABM |
500 ng |
EUR 603 |
EGFL7 Protein Vector (Rat) (pPB-N-His) |
PV265603 |
ABM |
500 ng |
EUR 603 |
EGFL7 Protein Vector (Rat) (pPM-C-HA) |
PV265604 |
ABM |
500 ng |
EUR 603 |
EGFL7 Protein Vector (Rat) (pPM-C-His) |
PV265605 |
ABM |
500 ng |
EUR 603 |
EGFL7 Protein Vector (Human) (pPB-C-His) |
PV013721 |
ABM |
500 ng |
EUR 329 |
EGFL7 Protein Vector (Human) (pPB-N-His) |
PV013722 |
ABM |
500 ng |
EUR 329 |
EGFL7 Protein Vector (Human) (pPM-C-HA) |
PV013723 |
ABM |
500 ng |
EUR 329 |
EGFL7 Protein Vector (Human) (pPM-C-His) |
PV013724 |
ABM |
500 ng |
EUR 329 |
Egfl7 3'UTR GFP Stable Cell Line |
TU155663 |
ABM |
1.0 ml |
Ask for price |
Egfl7 3'UTR Luciferase Stable Cell Line |
TU105663 |
ABM |
1.0 ml |
Ask for price |
Egfl7 3'UTR Luciferase Stable Cell Line |
TU203832 |
ABM |
1.0 ml |
Ask for price |
Egfl7 3'UTR GFP Stable Cell Line |
TU253832 |
ABM |
1.0 ml |
Ask for price |
EGFL7 3'UTR GFP Stable Cell Line |
TU056670 |
ABM |
1.0 ml |
EUR 1394 |
EGFL7 3'UTR Luciferase Stable Cell Line |
TU006670 |
ABM |
1.0 ml |
EUR 1394 |
EGFL7 ELISA Kit (Human) : 96 Wells (OKEH01928) |
OKEH01928 |
Aviva Systems Biology |
96 Wells |
EUR 727 |
Description: Description of target: This gene encodes a secreted endothelial cell protein that contains two epidermal growth factor-like domains. The encoded protein may play a role in regulating vasculogenesis. This protein may be involved in the growth and proliferation of tumor cells. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 12 pg/mL |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
EGFL7 Rabbit Polyclonal Antibody