NRCAM Rabbit Polyclonal Antibody
NRCAM Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
NRCAM Polyclonal Antibody |
ES11299-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NRCAM from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
NRCAM Polyclonal Antibody |
ABP59534-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human NRCAM protein at amino acid sequence of 1050-1130
- Applications tips:
|
Description: A polyclonal antibody for detection of NRCAM from Human, Mouse, Rat. This NRCAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NRCAM protein at amino acid sequence of 1050-1130 |
NRCAM Polyclonal Antibody |
ABP59534-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human NRCAM protein at amino acid sequence of 1050-1130
- Applications tips:
|
Description: A polyclonal antibody for detection of NRCAM from Human, Mouse, Rat. This NRCAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NRCAM protein at amino acid sequence of 1050-1130 |
NRCAM Polyclonal Antibody |
ABP59534-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NRCAM protein at amino acid sequence of 1050-1130
- Applications tips:
|
Description: A polyclonal antibody for detection of NRCAM from Human, Mouse, Rat. This NRCAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NRCAM protein at amino acid sequence of 1050-1130 |
NRCAM Polyclonal Antibody |
A69635 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: fast delivery possible |
NRCAM antibody |
70R-6388 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal NRCAM antibody raised against the N terminal of NRCAM |
NRCAM antibody |
70R-1741 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal NRCAM antibody raised against the N terminal of NRCAM |
NRCAM antibody |
70R-18960 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal NRCAM antibody |
NRCAM Antibody |
DF13196 |
Affbiotech |
200ul |
EUR 304 |
Description: NRCAM Antibody detects endogenous levels of NRCAM. |
NRCAM Antibody |
1-CSB-PA016074GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against NRCAM. Recognizes NRCAM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
NRCAM Antibody |
1-CSB-PA016074LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NRCAM. Recognizes NRCAM from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200 |
Polyclonal NRCAM Antibody (N-Term) |
AMM06822G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NRCAM (N-Term). This antibody is tested and proven to work in the following applications: |
NRCAM Polyclonal Antibody, HRP Conjugated |
A69636 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: reagents widely cited |
NRCAM Polyclonal Antibody, FITC Conjugated |
A69637 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: Ask the seller for details |
NRCAM Polyclonal Antibody, Biotin Conjugated |
A69638 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: The best epigenetics products |
anti- NRCAM antibody |
FNab05852 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: neuronal cell adhesion molecule
- Uniprot ID: Q92823
- Gene ID: 4897
- Research Area: Immunology, Cardiovascular, Developmental biology, Signal Transduction
|
Description: Antibody raised against NRCAM |
Anti-NRCAM antibody |
STJ192457 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NRCAM |
NRCAM siRNA |
20-abx926379 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NRCAM siRNA |
20-abx926380 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-NrCAM |
YF-PA13484 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to NrCAM |
anti-NrCAM |
YF-PA24268 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to NrCAM |
NRCAM recombinant monoclonal antibody |
A5800 |
Bimake |
100ul X 3 |
EUR 595 |
- Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
- Show more
|
Description: A recombinant monoclonal antibody from rabbit against human NRCAM for WB,ELISA |
NRCAM Antibody, HRP conjugated |
1-CSB-PA016074LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NRCAM. Recognizes NRCAM from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
NRCAM Antibody, FITC conjugated |
1-CSB-PA016074LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NRCAM. Recognizes NRCAM from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
NRCAM Antibody, Biotin conjugated |
1-CSB-PA016074LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NRCAM. Recognizes NRCAM from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Anti-NRCAM Monoclonal Antibody |
M03746 |
BosterBio |
100ug |
EUR 397 |
Description: Rabbit IgG Monoclonal antibody for Q92823 detection. Tested positive for WB IP in Human |
Monoclonal antibody for NrCAM |
SMC-462D |
Stressmarq |
0.1mg |
EUR 353 |
- Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
- Show more
|
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin.
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is not conjugated. |
Monoclonal antibody for NrCAM |
SMC-462D-A390 |
Stressmarq |
0.1mg |
EUR 400 |
- Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
- Show more
|
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin.
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with ATTO 390. |
Monoclonal antibody for NrCAM |
SMC-462D-A488 |
Stressmarq |
0.1mg |
EUR 399 |
- Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
- Show more
|
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin.
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with ATTO 488. |
Monoclonal antibody for NrCAM |
SMC-462D-A565 |
Stressmarq |
0.1mg |
EUR 399 |
- Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
- Show more
|
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin.
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with ATTO 565. |
Monoclonal antibody for NrCAM |
SMC-462D-A594 |
Stressmarq |
0.1mg |
EUR 399 |
- Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
- Show more
|
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin.
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with ATTO 594. |
Monoclonal antibody for NrCAM |
SMC-462D-A633 |
Stressmarq |
0.1mg |
EUR 399 |
- Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
- Show more
|
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin.
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with ATTO 633. |
Monoclonal antibody for NrCAM |
SMC-462D-A655 |
Stressmarq |
0.1mg |
EUR 399 |
- Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
- Show more
|
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin.
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with ATTO 655. |
Monoclonal antibody for NrCAM |
SMC-462D-A680 |
Stressmarq |
0.1mg |
EUR 399 |
- Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
- Show more
|
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin.
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with ATTO 680. |
Monoclonal antibody for NrCAM |
SMC-462D-A700 |
Stressmarq |
0.1mg |
EUR 399 |
- Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
- Show more
|
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin.
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with ATTO 700. |
Monoclonal antibody for NrCAM |
SMC-462D-ALP |
Stressmarq |
0.1mg |
EUR 393 |
- Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
- Show more
|
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin.
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with Alkaline Phosphatase. |
Monoclonal antibody for NrCAM |
SMC-462D-APC |
Stressmarq |
0.1mg |
EUR 398 |
- Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
- Show more
|
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin.
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with APC. |
Monoclonal antibody for NrCAM |
SMC-462D-APCCY7 |
Stressmarq |
0.1mg |
EUR 470 |
- Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
- Show more
|
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin.
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with APC/Cy7. |
Monoclonal antibody for NrCAM |
SMC-462D-BI |
Stressmarq |
0.1mg |
EUR 395 |
- Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
- Show more
|
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin.
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with Biotin. |
Monoclonal antibody for NrCAM |
SMC-462D-DY350 |
Stressmarq |
0.1mg |
EUR 413 |
- Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
- Show more
|
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin.
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with Dylight 350. |
Monoclonal antibody for NrCAM |
SMC-462D-DY405 |
Stressmarq |
0.1mg |
EUR 402 |
- Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
- Show more
|
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin.
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with Dylight 405. |
Monoclonal antibody for NrCAM |
SMC-462D-DY488 |
Stressmarq |
0.1mg |
EUR 392 |
- Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
- Show more
|
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin.
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with Dylight 488. |
Monoclonal antibody for NrCAM |
SMC-462D-DY594 |
Stressmarq |
0.1mg |
EUR 394 |
- Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
- Show more
|
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin.
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with Dylight 594. |
Monoclonal antibody for NrCAM |
SMC-462D-DY633 |
Stressmarq |
0.1mg |
EUR 389 |
- Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
- Show more
|
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin.
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with Dylight 633. |
Monoclonal antibody for NrCAM |
SMC-462D-FITC |
Stressmarq |
0.1mg |
EUR 391 |
- Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
- Show more
|
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin.
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with FITC. |
Monoclonal antibody for NrCAM |
SMC-462D-HRP |
Stressmarq |
0.1mg |
EUR 387 |
- Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
- Show more
|
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin.
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with HRP. |
Monoclonal antibody for NrCAM |
SMC-462D-P594 |
Stressmarq |
0.1mg |
EUR 406 |
- Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
- Show more
|
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin.
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with PE/ATTO 594. |
Monoclonal antibody for NrCAM |
SMC-462D-PCP |
Stressmarq |
0.1mg |
EUR 398 |
- Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
- Show more
|
Description: A monoclonal antibody from clone S364-51 against Human | Mouse NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin.
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with PerCP. |
Monoclonal antibody for NrCAM |
SMC-462D-RPE |
Stressmarq |
0.1mg |
EUR 396 |
- Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
- Show more
|
Description: A monoclonal antibody from clone S364-51 against Human | Mouse NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin.
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with RPE. |
Monoclonal antibody for NrCAM |
SMC-462D-STR |
Stressmarq |
0.1mg |
EUR 397 |
- Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
- Show more
|
Description: A monoclonal antibody from clone S364-51 against Human | Mouse NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin.
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with Streptavidin. |
Monoclonal antibody for NrCAM |
SMC-462S |
Stressmarq |
0.012mg |
EUR 65 |
- Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
- Show more
|
Description: A monoclonal antibody from clone S364-51 against Human | Mouse NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin.
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is not conjugated. |
Human NRCAM Protein |
20-abx650867 |
Abbexa |
-
EUR 453.00
-
EUR 230.00
-
EUR 1233.00
-
EUR 523.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
NRCAM cloning plasmid |
CSB-CL016074HU-10ug |
Cusabio |
10ug |
EUR 1266 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3579
- Sequence: ATGCAGCTTAAAATAATGCCGAAAAAGAAGCGCTTATCTGCGGGCAGAGTGCCCCTGATTCTCTTCCTGTGCCAGATGATTAGTGCACTGGAAGTACCTCTTGATCCAAAACTTCTTGAAGACTTGGTACAGCCTCCAACCATCACCCAACAGTCTCCAAAAGATTACATTATTG
- Show more
|
Description: A cloning plasmid for the NRCAM gene. |
NRCAM Blocking Peptide |
33R-6774 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NRCAM antibody, catalog no. 70R-1741 |
NRCAM Blocking Peptide |
33R-7194 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NRCAM antibody, catalog no. 70R-6388 |
NRCAM Blocking Peptide |
DF13196-BP |
Affbiotech |
1mg |
EUR 195 |
Monoclonal NRCAM Antibody, Clone: 7D8C5 |
APR08829G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human NRCAM. The antibodies are raised in Mouse and are from clone 7D8C5. This antibody is applicable in WB, ICC, E |
Neuronal Cell Adhesion Molecule (NRCAM) Antibody |
20-abx114080 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Neuronal Cell Adhesion Molecule (NRCAM) Antibody |
abx122663-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Neuronal Cell Adhesion Molecule (NRCAM) Antibody |
abx015947-100ug |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
Neuronal Cell Adhesion Molecule (NRCAM) Antibody |
20-abx334203 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neuronal Cell Adhesion Molecule (NrCAM) Antibody |
abx445071-100ug |
Abbexa |
100 ug |
EUR 523 |
- Shipped within 5-12 working days.
|
Neuronal Cell Adhesion Molecule (NRCAM) Antibody |
abx235852-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Mouse NRCAM shRNA Plasmid |
20-abx983275 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human NRCAM shRNA Plasmid |
20-abx953253 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Neuronal Cell Adhesion Molecule (NRCAM) Antibody (HRP) |
20-abx336778 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neuronal Cell Adhesion Molecule (NRCAM) Antibody (FITC) |
20-abx336779 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neuronal Cell Adhesion Molecule (NRCAM) Antibody (Biotin) |
20-abx336780 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (ALP) |
abx442468-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (APC) |
abx442749-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (Biotin) |
abx443029-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (FITC) |
abx443309-100ug |
Abbexa |
100 ug |
EUR 565 |
- Shipped within 5-12 working days.
|
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (HRP) |
abx443590-100ug |
Abbexa |
100 ug |
EUR 565 |
- Shipped within 5-12 working days.
|
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (PerCP) |
abx444152-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (RPE) |
abx444433-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (Streptavidin) |
abx444714-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Human NRCAM PicoKine ELISA Kit |
EK1408 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human NRCAM in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA). |
ELISA kit for Human NRCAM |
EK5654 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human NRCAM in samples from serum, plasma, tissue homogenates and other biological fluids. |
Nrcam ORF Vector (Rat) (pORF) |
ORF071508 |
ABM |
1.0 ug DNA |
EUR 506 |
NRCAM ORF Vector (Human) (pORF) |
ORF013917 |
ABM |
1.0 ug DNA |
EUR 354 |
Nrcam ORF Vector (Mouse) (pORF) |
ORF051661 |
ABM |
1.0 ug DNA |
EUR 506 |
Nrcam ORF Vector (Mouse) (pORF) |
ORF051662 |
ABM |
1.0 ug DNA |
EUR 506 |
NRCAM ELISA Kit (Human) (OKBB00968) |
OKBB00968 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Neuronal cell adhesion molecule is a protein that in humans is encoded by the NRCAM gene. Cell adhesion molecules (CAMs) are members of the immunoglobulin superfamily. This gene encodes a neuronal cell adhesion molecule with multiple immunoglobulin-like C2-type domains and fibronectin type-III domains. This ankyrin-binding protein is involved in neuron-neuron adhesion and promotes directional signaling during axonal cone growth. Also, this gene is expressed in non-neural tissues and may play a general role in cell-cell communication via signaling from its intracellular domain to the actin cytoskeleton during directional cell migration. Allelic variants of this gene have been associated with autism and addiction vulnerability. Alternative splicing results in multiple transcript variants encoding different isoforms.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml |
NRCAM ELISA Kit (Rat) (OKCA01911) |
OKCA01911 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: Cell adhesion protein that is required for normal responses to cell-cell contacts in brain and in the peripheral nervous system. Plays a role in neurite outgrowth in response to contactin binding. Plays a role in mediating cell-cell contacts between Schwann cells and axons. Plays a role in the formation and maintenance of the nodes of Ranvier on myelinated axons (PubMed:16039564). Nodes of Ranvier contain clustered sodium channels that are crucial for the saltatory propagation of action potentials along myelinated axons. During development, nodes of Ranvier are formed by the fusion of two heminodes. Required for normal clustering of sodium channels at heminodes; not required for the formation of mature nodes with normal sodium channel clusters. Required, together with GLDN, for maintaining NFASC and sodium channel clusters at mature nodes of Ranvier.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 15.6 pg/mL |
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (ATTO 390) |
abx440220-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (ATTO 488) |
abx440501-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (ATTO 565) |
abx440782-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (ATTO 594) |
abx441063-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (ATTO 633) |
abx441344-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (ATTO 655) |
abx441625-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (ATTO 680) |
abx441906-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (ATTO 700) |
abx442187-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
NRCAM sgRNA CRISPR Lentivector set (Human) |
K1454501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nrcam sgRNA CRISPR Lentivector set (Mouse) |
K3894701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nrcam sgRNA CRISPR Lentivector set (Rat) |
K7493201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Recombinant Neuronal Cell Adhesion Molecule (NRCAM) |
4-RPC668Hu01 |
Cloud-Clone |
-
EUR 315.04
-
EUR 187.00
-
EUR 906.40
-
EUR 368.80
-
EUR 637.60
-
EUR 274.00
-
EUR 2116.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q92823
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 43.2kDa
- Isoelectric Point: 5.4
|
Description: Recombinant Human Neuronal Cell Adhesion Molecule expressed in: E.coli |
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (PE/ATTO 594) |
abx443871-100ug |
Abbexa |
100 ug |
EUR 592 |
- Shipped within 5-12 working days.
|
NRCAM sgRNA CRISPR Lentivector (Human) (Target 1) |
K1454502 |
ABM |
1.0 ug DNA |
EUR 154 |
NRCAM sgRNA CRISPR Lentivector (Human) (Target 2) |
K1454503 |
ABM |
1.0 ug DNA |
EUR 154 |
NRCAM sgRNA CRISPR Lentivector (Human) (Target 3) |
K1454504 |
ABM |
1.0 ug DNA |
EUR 154 |
Nrcam sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3894702 |
ABM |
1.0 ug DNA |
EUR 154 |
Nrcam sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3894703 |
ABM |
1.0 ug DNA |
EUR 154 |
Nrcam sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3894704 |
ABM |
1.0 ug DNA |
EUR 154 |
Nrcam sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7493202 |
ABM |
1.0 ug DNA |
EUR 154 |
Nrcam sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7493203 |
ABM |
1.0 ug DNA |
EUR 154 |
Nrcam sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7493204 |
ABM |
1.0 ug DNA |
EUR 154 |
NRCAM Protein Vector (Human) (pPB-C-His) |
PV055665 |
ABM |
500 ng |
EUR 481 |
NRCAM Protein Vector (Human) (pPB-N-His) |
PV055666 |
ABM |
500 ng |
EUR 481 |
NRCAM Protein Vector (Human) (pPM-C-HA) |
PV055667 |
ABM |
500 ng |
EUR 481 |
NRCAM Protein Vector (Human) (pPM-C-His) |
PV055668 |
ABM |
500 ng |
EUR 481 |
NRCAM Protein Vector (Mouse) (pPB-C-His) |
PV206642 |
ABM |
500 ng |
EUR 1065 |
NRCAM Protein Vector (Mouse) (pPB-N-His) |
PV206643 |
ABM |
500 ng |
EUR 1065 |
NRCAM Protein Vector (Mouse) (pPM-C-HA) |
PV206644 |
ABM |
500 ng |
EUR 1065 |
NRCAM Protein Vector (Mouse) (pPM-C-His) |
PV206645 |
ABM |
500 ng |
EUR 1065 |
NRCAM Protein Vector (Mouse) (pPB-C-His) |
PV206646 |
ABM |
500 ng |
EUR 1065 |
NRCAM Protein Vector (Mouse) (pPB-N-His) |
PV206647 |
ABM |
500 ng |
EUR 1065 |
NRCAM Protein Vector (Mouse) (pPM-C-HA) |
PV206648 |
ABM |
500 ng |
EUR 1065 |
NRCAM Protein Vector (Mouse) (pPM-C-His) |
PV206649 |
ABM |
500 ng |
EUR 1065 |
NRCAM Protein Vector (Rat) (pPB-C-His) |
PV286030 |
ABM |
500 ng |
EUR 1191 |
NRCAM Protein Vector (Rat) (pPB-N-His) |
PV286031 |
ABM |
500 ng |
EUR 1191 |
NRCAM Protein Vector (Rat) (pPM-C-HA) |
PV286032 |
ABM |
500 ng |
EUR 1191 |
NRCAM Protein Vector (Rat) (pPM-C-His) |
PV286033 |
ABM |
500 ng |
EUR 1191 |
Nrcam 3'UTR GFP Stable Cell Line |
TU164316 |
ABM |
1.0 ml |
Ask for price |
NRCAM 3'UTR Luciferase Stable Cell Line |
TU015965 |
ABM |
1.0 ml |
EUR 1521 |
Nrcam 3'UTR Luciferase Stable Cell Line |
TU114316 |
ABM |
1.0 ml |
Ask for price |
NRCAM 3'UTR GFP Stable Cell Line |
TU065965 |
ABM |
1.0 ml |
EUR 1521 |
Nrcam 3'UTR GFP Stable Cell Line |
TU264184 |
ABM |
1.0 ml |
Ask for price |
Nrcam 3'UTR Luciferase Stable Cell Line |
TU214184 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NRCAM Rabbit Polyclonal Antibody