NRCAM Rabbit Polyclonal Antibody

NRCAM Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

NRCAM Polyclonal Antibody
ES11299-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NRCAM from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
NRCAM Polyclonal Antibody
ABP59534-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human NRCAM protein at amino acid sequence of 1050-1130
  • Applications tips:
Description: A polyclonal antibody for detection of NRCAM from Human, Mouse, Rat. This NRCAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NRCAM protein at amino acid sequence of 1050-1130
NRCAM Polyclonal Antibody
ABP59534-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NRCAM protein at amino acid sequence of 1050-1130
  • Applications tips:
Description: A polyclonal antibody for detection of NRCAM from Human, Mouse, Rat. This NRCAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NRCAM protein at amino acid sequence of 1050-1130
NRCAM Polyclonal Antibody
ABP59534-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NRCAM protein at amino acid sequence of 1050-1130
  • Applications tips:
Description: A polyclonal antibody for detection of NRCAM from Human, Mouse, Rat. This NRCAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NRCAM protein at amino acid sequence of 1050-1130
NRCAM Polyclonal Antibody
A69635 100 ?g
EUR 628.55
Description: fast delivery possible
NRCAM antibody
70R-6388 50 ug
EUR 467
Description: Rabbit polyclonal NRCAM antibody raised against the N terminal of NRCAM
NRCAM antibody
70R-1741 100 ug
EUR 377
Description: Rabbit polyclonal NRCAM antibody raised against the N terminal of NRCAM
NRCAM antibody
70R-18960 50 ul
EUR 435
Description: Rabbit polyclonal NRCAM antibody
NRCAM Antibody
DF13196 200ul
EUR 304
Description: NRCAM Antibody detects endogenous levels of NRCAM.
NRCAM Antibody
1-CSB-PA016074GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NRCAM. Recognizes NRCAM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
NRCAM Antibody
1-CSB-PA016074LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRCAM. Recognizes NRCAM from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200
Polyclonal NRCAM Antibody (N-Term)
AMM06822G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NRCAM (N-Term). This antibody is tested and proven to work in the following applications:
NRCAM Polyclonal Antibody, HRP Conjugated
A69636 100 ?g
EUR 628.55
Description: reagents widely cited
NRCAM Polyclonal Antibody, FITC Conjugated
A69637 100 ?g
EUR 628.55
Description: Ask the seller for details
NRCAM Polyclonal Antibody, Biotin Conjugated
A69638 100 ?g
EUR 628.55
Description: The best epigenetics products
anti- NRCAM antibody
FNab05852 100µg
EUR 505.25
  • Immunogen: neuronal cell adhesion molecule
  • Uniprot ID: Q92823
  • Gene ID: 4897
  • Research Area: Immunology, Cardiovascular, Developmental biology, Signal Transduction
Description: Antibody raised against NRCAM
Anti-NRCAM antibody
PAab05852 100 ug
EUR 355
Anti-NRCAM antibody
STJ192457 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NRCAM
Nrcam/ Rat Nrcam ELISA Kit
ELI-22257r 96 Tests
EUR 886
NRCAM siRNA
20-abx926379
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
NRCAM siRNA
20-abx926380
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-NrCAM
YF-PA13484 100 ug
EUR 403
Description: Rabbit polyclonal to NrCAM
anti-NrCAM
YF-PA24268 50 ul
EUR 334
Description: Mouse polyclonal to NrCAM
NRCAM recombinant monoclonal antibody
A5800 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human NRCAM for WB,ELISA
NRCAM Antibody, HRP conjugated
1-CSB-PA016074LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRCAM. Recognizes NRCAM from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
NRCAM Antibody, FITC conjugated
1-CSB-PA016074LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRCAM. Recognizes NRCAM from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
NRCAM Antibody, Biotin conjugated
1-CSB-PA016074LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRCAM. Recognizes NRCAM from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Anti-NRCAM Monoclonal Antibody
M03746 100ug
EUR 397
Description: Rabbit IgG Monoclonal antibody for Q92823 detection. Tested positive for WB IP in Human
Monoclonal antibody for NrCAM
SMC-462D 0.1mg
EUR 353
  • Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
  • Show more
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin. . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is not conjugated.
Monoclonal antibody for NrCAM
SMC-462D-A390 0.1mg
EUR 400
  • Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
  • Show more
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin. . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with ATTO 390.
Monoclonal antibody for NrCAM
SMC-462D-A488 0.1mg
EUR 399
  • Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
  • Show more
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin. . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with ATTO 488.
Monoclonal antibody for NrCAM
SMC-462D-A565 0.1mg
EUR 399
  • Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
  • Show more
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin. . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with ATTO 565.
Monoclonal antibody for NrCAM
SMC-462D-A594 0.1mg
EUR 399
  • Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
  • Show more
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin. . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with ATTO 594.
Monoclonal antibody for NrCAM
SMC-462D-A633 0.1mg
EUR 399
  • Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
  • Show more
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin. . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with ATTO 633.
Monoclonal antibody for NrCAM
SMC-462D-A655 0.1mg
EUR 399
  • Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
  • Show more
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin. . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with ATTO 655.
Monoclonal antibody for NrCAM
SMC-462D-A680 0.1mg
EUR 399
  • Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
  • Show more
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin. . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with ATTO 680.
Monoclonal antibody for NrCAM
SMC-462D-A700 0.1mg
EUR 399
  • Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
  • Show more
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin. . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with ATTO 700.
Monoclonal antibody for NrCAM
SMC-462D-ALP 0.1mg
EUR 393
  • Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
  • Show more
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin. . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with Alkaline Phosphatase.
Monoclonal antibody for NrCAM
SMC-462D-APC 0.1mg
EUR 398
  • Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
  • Show more
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin. . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with APC.
Monoclonal antibody for NrCAM
SMC-462D-APCCY7 0.1mg
EUR 470
  • Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
  • Show more
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin. . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with APC/Cy7.
Monoclonal antibody for NrCAM
SMC-462D-BI 0.1mg
EUR 395
  • Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
  • Show more
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin. . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with Biotin.
Monoclonal antibody for NrCAM
SMC-462D-DY350 0.1mg
EUR 413
  • Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
  • Show more
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin. . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with Dylight 350.
Monoclonal antibody for NrCAM
SMC-462D-DY405 0.1mg
EUR 402
  • Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
  • Show more
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin. . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with Dylight 405.
Monoclonal antibody for NrCAM
SMC-462D-DY488 0.1mg
EUR 392
  • Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
  • Show more
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin. . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with Dylight 488.
Monoclonal antibody for NrCAM
SMC-462D-DY594 0.1mg
EUR 394
  • Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
  • Show more
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin. . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with Dylight 594.
Monoclonal antibody for NrCAM
SMC-462D-DY633 0.1mg
EUR 389
  • Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
  • Show more
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin. . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with Dylight 633.
Monoclonal antibody for NrCAM
SMC-462D-FITC 0.1mg
EUR 391
  • Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
  • Show more
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin. . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with FITC.
Monoclonal antibody for NrCAM
SMC-462D-HRP 0.1mg
EUR 387
  • Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
  • Show more
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin. . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with HRP.
Monoclonal antibody for NrCAM
SMC-462D-P594 0.1mg
EUR 406
  • Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
  • Show more
Description: A monoclonal antibody from clone S364-51 against Human | Mouse | Rat NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin. . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with PE/ATTO 594.
Monoclonal antibody for NrCAM
SMC-462D-PCP 0.1mg
EUR 398
  • Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
  • Show more
Description: A monoclonal antibody from clone S364-51 against Human | Mouse NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin. . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with PerCP.
Monoclonal antibody for NrCAM
SMC-462D-RPE 0.1mg
EUR 396
  • Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
  • Show more
Description: A monoclonal antibody from clone S364-51 against Human | Mouse NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin. . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with RPE.
Monoclonal antibody for NrCAM
SMC-462D-STR 0.1mg
EUR 397
  • Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
  • Show more
Description: A monoclonal antibody from clone S364-51 against Human | Mouse NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin. . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is conjugated with Streptavidin.
Monoclonal antibody for NrCAM
SMC-462S 0.012mg
EUR 65
  • Neuronal cell adhesion molecule (NrCAM) is a cell surface protein of the immunoglobulin (Ig) superfamily. NrCAM (also known as Bravo) contains six Ig domains, five fibronectin repeats, a transmembrane region and an intracellular domain. NrCAM is expr
  • Show more
Description: A monoclonal antibody from clone S364-51 against Human | Mouse NrCAM. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 30-845 (extracellular domain) of mouse NrCAM. Rat: 96% identity (795/822 amino acids identical). Human: 91% identity (753/822 amino acids identical) ~50% identity with Neurofascin. . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for NrCAM is not conjugated.
Human NRCAM Protein
20-abx650867
  • EUR 453.00
  • EUR 230.00
  • EUR 1233.00
  • EUR 523.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
NRCAM cloning plasmid
CSB-CL016074HU-10ug 10ug
EUR 1266
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3579
  • Sequence: ATGCAGCTTAAAATAATGCCGAAAAAGAAGCGCTTATCTGCGGGCAGAGTGCCCCTGATTCTCTTCCTGTGCCAGATGATTAGTGCACTGGAAGTACCTCTTGATCCAAAACTTCTTGAAGACTTGGTACAGCCTCCAACCATCACCCAACAGTCTCCAAAAGATTACATTATTG
  • Show more
Description: A cloning plasmid for the NRCAM gene.
NRCAM Blocking Peptide
33R-6774 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NRCAM antibody, catalog no. 70R-1741
NRCAM Blocking Peptide
33R-7194 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NRCAM antibody, catalog no. 70R-6388
NRCAM Blocking Peptide
DF13196-BP 1mg
EUR 195
Monoclonal NRCAM Antibody, Clone: 7D8C5
APR08829G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human NRCAM. The antibodies are raised in Mouse and are from clone 7D8C5. This antibody is applicable in WB, ICC, E
Neuronal Cell Adhesion Molecule (NRCAM) Antibody
20-abx114080
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Neuronal Cell Adhesion Molecule (NRCAM) Antibody
abx122663-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Neuronal Cell Adhesion Molecule (NRCAM) Antibody
abx015947-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.
Neuronal Cell Adhesion Molecule (NRCAM) Antibody
20-abx334203
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Neuronal Cell Adhesion Molecule (NrCAM) Antibody
abx445071-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.
Neuronal Cell Adhesion Molecule (NRCAM) Antibody
abx235852-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Mouse NRCAM shRNA Plasmid
20-abx983275
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
NRCAM ELISA KIT|Human
EF001326 96 Tests
EUR 689
Human NRCAM shRNA Plasmid
20-abx953253
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Neuronal Cell Adhesion Molecule (NRCAM) Antibody (HRP)
20-abx336778
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Neuronal Cell Adhesion Molecule (NRCAM) Antibody (FITC)
20-abx336779
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Neuronal Cell Adhesion Molecule (NRCAM) Antibody (Biotin)
20-abx336780
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (ALP)
abx442468-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (APC)
abx442749-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (Biotin)
abx443029-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (FITC)
abx443309-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (HRP)
abx443590-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (PerCP)
abx444152-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (RPE)
abx444433-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (Streptavidin)
abx444714-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Human NRCAM PicoKine ELISA Kit
EK1408 96 wells
EUR 425
Description: For quantitative detection of human NRCAM in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).
ELISA kit for Human NRCAM
EK5654 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human NRCAM in samples from serum, plasma, tissue homogenates and other biological fluids.
Nrcam ORF Vector (Rat) (pORF)
ORF071508 1.0 ug DNA
EUR 506
NRCAM ORF Vector (Human) (pORF)
ORF013917 1.0 ug DNA
EUR 354
Nrcam ORF Vector (Mouse) (pORF)
ORF051661 1.0 ug DNA
EUR 506
Nrcam ORF Vector (Mouse) (pORF)
ORF051662 1.0 ug DNA
EUR 506
pCMV-N-FLAG-NRCAM Plasmid
PVTB00404-2a 2 ug
EUR 356
NRCAM ELISA Kit (Human) (OKBB00968)
OKBB00968 96 Wells
EUR 505
Description: Description of target: Neuronal cell adhesion molecule is a protein that in humans is encoded by the NRCAM gene. Cell adhesion molecules (CAMs) are members of the immunoglobulin superfamily. This gene encodes a neuronal cell adhesion molecule with multiple immunoglobulin-like C2-type domains and fibronectin type-III domains. This ankyrin-binding protein is involved in neuron-neuron adhesion and promotes directional signaling during axonal cone growth. Also, this gene is expressed in non-neural tissues and may play a general role in cell-cell communication via signaling from its intracellular domain to the actin cytoskeleton during directional cell migration. Allelic variants of this gene have been associated with autism and addiction vulnerability. Alternative splicing results in multiple transcript variants encoding different isoforms.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml
NRCAM ELISA Kit (Rat) (OKCA01911)
OKCA01911 96 Wells
EUR 846
Description: Description of target: Cell adhesion protein that is required for normal responses to cell-cell contacts in brain and in the peripheral nervous system. Plays a role in neurite outgrowth in response to contactin binding. Plays a role in mediating cell-cell contacts between Schwann cells and axons. Plays a role in the formation and maintenance of the nodes of Ranvier on myelinated axons (PubMed:16039564). Nodes of Ranvier contain clustered sodium channels that are crucial for the saltatory propagation of action potentials along myelinated axons. During development, nodes of Ranvier are formed by the fusion of two heminodes. Required for normal clustering of sodium channels at heminodes; not required for the formation of mature nodes with normal sodium channel clusters. Required, together with GLDN, for maintaining NFASC and sodium channel clusters at mature nodes of Ranvier.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 15.6 pg/mL
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (ATTO 390)
abx440220-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (ATTO 488)
abx440501-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (ATTO 565)
abx440782-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (ATTO 594)
abx441063-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (ATTO 633)
abx441344-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (ATTO 655)
abx441625-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (ATTO 680)
abx441906-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (ATTO 700)
abx442187-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
NRCAM sgRNA CRISPR Lentivector set (Human)
K1454501 3 x 1.0 ug
EUR 339
Nrcam sgRNA CRISPR Lentivector set (Mouse)
K3894701 3 x 1.0 ug
EUR 339
Nrcam sgRNA CRISPR Lentivector set (Rat)
K7493201 3 x 1.0 ug
EUR 339
Recombinant Neuronal Cell Adhesion Molecule (NRCAM)
4-RPC668Hu01
  • EUR 315.04
  • EUR 187.00
  • EUR 906.40
  • EUR 368.80
  • EUR 637.60
  • EUR 274.00
  • EUR 2116.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q92823
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 43.2kDa
  • Isoelectric Point: 5.4
Description: Recombinant Human Neuronal Cell Adhesion Molecule expressed in: E.coli
Neuronal Cell Adhesion Molecule (NrCAM) Antibody (PE/ATTO 594)
abx443871-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.
NRCAM sgRNA CRISPR Lentivector (Human) (Target 1)
K1454502 1.0 ug DNA
EUR 154
NRCAM sgRNA CRISPR Lentivector (Human) (Target 2)
K1454503 1.0 ug DNA
EUR 154
NRCAM sgRNA CRISPR Lentivector (Human) (Target 3)
K1454504 1.0 ug DNA
EUR 154
Nrcam sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3894702 1.0 ug DNA
EUR 154
Nrcam sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3894703 1.0 ug DNA
EUR 154
Nrcam sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3894704 1.0 ug DNA
EUR 154
Nrcam sgRNA CRISPR Lentivector (Rat) (Target 1)
K7493202 1.0 ug DNA
EUR 154
Nrcam sgRNA CRISPR Lentivector (Rat) (Target 2)
K7493203 1.0 ug DNA
EUR 154
Nrcam sgRNA CRISPR Lentivector (Rat) (Target 3)
K7493204 1.0 ug DNA
EUR 154
NRCAM Protein Vector (Human) (pPB-C-His)
PV055665 500 ng
EUR 481
NRCAM Protein Vector (Human) (pPB-N-His)
PV055666 500 ng
EUR 481
NRCAM Protein Vector (Human) (pPM-C-HA)
PV055667 500 ng
EUR 481
NRCAM Protein Vector (Human) (pPM-C-His)
PV055668 500 ng
EUR 481
NRCAM Protein Vector (Mouse) (pPB-C-His)
PV206642 500 ng
EUR 1065
NRCAM Protein Vector (Mouse) (pPB-N-His)
PV206643 500 ng
EUR 1065
NRCAM Protein Vector (Mouse) (pPM-C-HA)
PV206644 500 ng
EUR 1065
NRCAM Protein Vector (Mouse) (pPM-C-His)
PV206645 500 ng
EUR 1065
NRCAM Protein Vector (Mouse) (pPB-C-His)
PV206646 500 ng
EUR 1065
NRCAM Protein Vector (Mouse) (pPB-N-His)
PV206647 500 ng
EUR 1065
NRCAM Protein Vector (Mouse) (pPM-C-HA)
PV206648 500 ng
EUR 1065
NRCAM Protein Vector (Mouse) (pPM-C-His)
PV206649 500 ng
EUR 1065
NRCAM Protein Vector (Rat) (pPB-C-His)
PV286030 500 ng
EUR 1191
NRCAM Protein Vector (Rat) (pPB-N-His)
PV286031 500 ng
EUR 1191
NRCAM Protein Vector (Rat) (pPM-C-HA)
PV286032 500 ng
EUR 1191
NRCAM Protein Vector (Rat) (pPM-C-His)
PV286033 500 ng
EUR 1191
Nrcam 3'UTR GFP Stable Cell Line
TU164316 1.0 ml Ask for price
NRCAM 3'UTR Luciferase Stable Cell Line
TU015965 1.0 ml
EUR 1521
Nrcam 3'UTR Luciferase Stable Cell Line
TU114316 1.0 ml Ask for price
NRCAM 3'UTR GFP Stable Cell Line
TU065965 1.0 ml
EUR 1521
Nrcam 3'UTR GFP Stable Cell Line
TU264184 1.0 ml Ask for price
Nrcam 3'UTR Luciferase Stable Cell Line
TU214184 1.0 ml Ask for price
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NRCAM Rabbit Polyclonal Antibody

Apex Business WordPress Theme | Designed by Crafthemes