AIF1 Rabbit Polyclonal Antibody

AIF1 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

AIF1 Polyclonal Antibody

ABP57733-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human AIF1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of AIF1 from Human, Mouse, Rat. This AIF1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AIF1 protein

AIF1 Polyclonal Antibody

ABP57733-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human AIF1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of AIF1 from Human, Mouse, Rat. This AIF1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AIF1 protein

AIF1 Polyclonal Antibody

ABP57733-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human AIF1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of AIF1 from Human, Mouse, Rat. This AIF1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AIF1 protein

AIF1 Polyclonal Antibody

ES11111-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against AIF1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

AIF1 Polyclonal Antibody

ES11111-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against AIF1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Allograft Inflammatory Factor 1 (AIF1) ELISA Kit

DLR-AIF1-Hu-48T 48T
EUR 404
  • Should the Human Allograft Inflammatory Factor 1 (AIF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Allograft Inflammatory Factor 1 (AIF1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Allograft Inflammatory Factor 1 (AIF1) ELISA Kit

DLR-AIF1-Hu-96T 96T
EUR 518
  • Should the Human Allograft Inflammatory Factor 1 (AIF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Allograft Inflammatory Factor 1 (AIF1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Allograft Inflammatory Factor 1 (AIF1) ELISA Kit

DLR-AIF1-Mu-48T 48T
EUR 527
  • Should the Mouse Allograft Inflammatory Factor 1 (AIF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Allograft Inflammatory Factor 1 (AIF1) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Mouse Allograft Inflammatory Factor 1 (AIF1) ELISA Kit

DLR-AIF1-Mu-96T 96T
EUR 688
  • Should the Mouse Allograft Inflammatory Factor 1 (AIF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Allograft Inflammatory Factor 1 (AIF1) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Rat Allograft Inflammatory Factor 1 (AIF1) ELISA Kit

DLR-AIF1-Ra-48T 48T
EUR 549
  • Should the Rat Allograft Inflammatory Factor 1 (AIF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Allograft Inflammatory Factor 1 (AIF1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Allograft Inflammatory Factor 1 (AIF1) ELISA Kit

DLR-AIF1-Ra-96T 96T
EUR 718
  • Should the Rat Allograft Inflammatory Factor 1 (AIF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Allograft Inflammatory Factor 1 (AIF1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Allograft Inflammatory Factor 1 (AIF1) ELISA Kit

RD-AIF1-Hu-48Tests 48 Tests
EUR 393

Human Allograft Inflammatory Factor 1 (AIF1) ELISA Kit

RD-AIF1-Hu-96Tests 96 Tests
EUR 541

Mouse Allograft Inflammatory Factor 1 (AIF1) ELISA Kit

RD-AIF1-Mu-48Tests 48 Tests
EUR 533

Mouse Allograft Inflammatory Factor 1 (AIF1) ELISA Kit

RD-AIF1-Mu-96Tests 96 Tests
EUR 740

Rat Allograft Inflammatory Factor 1 (AIF1) ELISA Kit

RD-AIF1-Ra-48Tests 48 Tests
EUR 557

Rat Allograft Inflammatory Factor 1 (AIF1) ELISA Kit

RD-AIF1-Ra-96Tests 96 Tests
EUR 775

Human Allograft Inflammatory Factor 1 (AIF1) ELISA Kit

RDR-AIF1-Hu-48Tests 48 Tests
EUR 411

Human Allograft Inflammatory Factor 1 (AIF1) ELISA Kit

RDR-AIF1-Hu-96Tests 96 Tests
EUR 565

Mouse Allograft Inflammatory Factor 1 (AIF1) ELISA Kit

RDR-AIF1-Mu-48Tests 48 Tests
EUR 557

Mouse Allograft Inflammatory Factor 1 (AIF1) ELISA Kit

RDR-AIF1-Mu-96Tests 96 Tests
EUR 774

Rat Allograft Inflammatory Factor 1 (AIF1) ELISA Kit

RDR-AIF1-Ra-48Tests 48 Tests
EUR 583

Rat Allograft Inflammatory Factor 1 (AIF1) ELISA Kit

RDR-AIF1-Ra-96Tests 96 Tests
EUR 811

Polyclonal AIF1 / IBA1 Antibody (Internal)

APG01628G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human AIF1 / IBA1 (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal AIF1 Antibody (N-term)

APR07052G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AIF1 (N-term). This antibody is tested and proven to work in the following applications:

Aif1 Polyclonal Antibody, HRP Conjugated

A62067 100 µg
EUR 570.55
Description: reagents widely cited

Aif1 Polyclonal Antibody, FITC Conjugated

A62068 100 µg
EUR 570.55
Description: Ask the seller for details

Aif1 Polyclonal Antibody, Biotin Conjugated

A62069 100 µg
EUR 570.55
Description: The best epigenetics products

Aif1 Polyclonal Antibody, HRP Conjugated

A56195 100 µg
EUR 570.55
Description: fast delivery possible

Aif1 Polyclonal Antibody, FITC Conjugated

A56196 100 µg
EUR 570.55
Description: reagents widely cited

Aif1 Polyclonal Antibody, Biotin Conjugated

A56197 100 µg
EUR 570.55
Description: Ask the seller for details

AIF1 Polyclonal Antibody, HRP Conjugated

A55284 100 µg
EUR 570.55
Description: kits suitable for this type of research

AIF1 Polyclonal Antibody, FITC Conjugated

A55285 100 µg
EUR 570.55
Description: fast delivery possible

AIF1 Polyclonal Antibody, Biotin Conjugated

A55286 100 µg
EUR 570.55
Description: reagents widely cited

Rabbit AIF1 ELISA Kit

ERTA0634 96Tests
EUR 521

AIF1 antibody

22709-100ul 100ul
EUR 390

AIF1 Antibody

31086-100ul 100ul
EUR 252

AIF1 Antibody

31086-50ul 50ul
EUR 187

AIF1 antibody

70R-12482 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal AIF1 antibody

AIF1 antibody

70R-14261 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal AIF1 antibody

AIF1 antibody

38248-100ul 100ul
EUR 252

AIF1 antibody

38603-100ul 100ul
EUR 252

AIF1 Antibody

1-CSB-PA001490GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against AIF1. Recognizes AIF1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

Aif1 Antibody

1-CSB-PA001490HA01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Aif1. Recognizes Aif1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

Aif1 Antibody

1-CSB-PA001490HA01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Aif1. Recognizes Aif1 from Rat. This antibody is Unconjugated. Tested in the following application: ELISA

AIF1 Antibody

1-CSB-PA970771
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AIF1. Recognizes AIF1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

AIF1 Antibody

DF6442 200ul
EUR 304
Description: AIF1 Antibody detects endogenous levels of total AIF1.

AIF1 Antibody

DF7217 200ul
EUR 304
Description: AIF1 Antibody detects endogenous levels of total AIF1.

AIF1 Antibody

1-CSB-PA149571
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AIF1. Recognizes AIF1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

AIF1 Antibody

1-CSB-PA00667A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AIF1. Recognizes AIF1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

AIF1 Antibody

ABD6442 100 ug
EUR 438

AIF1 Antibody

ABD7217 100 ug
EUR 438

AIF1 antibody

PAab09944 100 ug
EUR 386

Polyclonal AIF1 / IBA1 Antibody (C-Terminus)

APG01627G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human AIF1 / IBA1 (C-Terminus). This antibody is tested and proven to work in the following applications:

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNUB1909-100 100uL
EUR 264
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), Concentration: 0.2mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNUB1909-50 50uL
EUR 405
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), 1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNUB1909-500 500uL
EUR 513
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), Concentration: 0.2mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNC551909-100 100uL
EUR 233
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF555 conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNC551909-500 500uL
EUR 545
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF555 conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNC611909-100 100uL
EUR 233
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF660R conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNC611909-500 500uL
EUR 545
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF660R conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNC471909-100 100uL
EUR 233
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF647 conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNC471909-500 500uL
EUR 545
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF647 conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNC041909-100 100uL
EUR 233
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF405S conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNC041909-500 500uL
EUR 545
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF405S conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNC051909-100 100uL
EUR 233
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF405M conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNC051909-500 500uL
EUR 545
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF405M conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNC401909-100 100uL
EUR 233
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF640R conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNC401909-500 500uL
EUR 545
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF640R conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNC431909-100 100uL
EUR 233
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF543 conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNC431909-500 500uL
EUR 545
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF543 conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNC701909-100 100uL
EUR 233
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF770 conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNC701909-500 500uL
EUR 545
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF770 conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNC801909-100 100uL
EUR 233
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF680 conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNC801909-500 500uL
EUR 545
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF680 conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNCH1909-100 100uL
EUR 233
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNCH1909-500 500uL
EUR 545
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNCP1909-250 250uL
EUR 394
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), PerCP conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNCR1909-250 250uL
EUR 394
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), RPE conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNC941909-100 100uL
EUR 233
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF594 conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNC941909-500 500uL
EUR 545
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF594 conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNCA1909-250 250uL
EUR 394
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), APC conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNCB1909-100 100uL
EUR 233
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), Biotin conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNCB1909-500 500uL
EUR 545
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), Biotin conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNC881909-100 100uL
EUR 233
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF488A conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNC881909-500 500uL
EUR 545
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF488A conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNC681909-100 100uL
EUR 233
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF568 conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNC681909-500 500uL
EUR 545
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF568 conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNCAP1909-100 100uL
EUR 233
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNCAP1909-500 500uL
EUR 545
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNC811909-100 100uL
EUR 233
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF680R conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody

BNC811909-500 500uL
EUR 545
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF680R conjugate, Concentration: 0.1mg/mL

AIF1 Conjugated Antibody

C31086 100ul
EUR 397

AIF1 Conjugated Antibody

C38248 100ul
EUR 397

anti- AIF1 antibody

FNab09944 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: allograft inflammatory factor 1
  • Uniprot ID: P55008
  • Gene ID: 199
  • Research Area: Signal Transduction, Metabolism, Cardiovascular, Developmental biology, Neuroscience, Stem Cells, Immunology
Description: Antibody raised against AIF1

anti- AIF1 antibody

LSMab09944 100 ug
EUR 386

Anti-AIF1 antibody

STJ114929 100 µl
EUR 277
Description: This gene encodes a protein that binds actin and calcium. This gene is induced by cytokines and interferon and may promote macrophage activation and growth of vascular smooth muscle cells and T-lymphocytes. Polymorphisms in this gene may be associated with systemic sclerosis. Alternative splicing results in multiple transcript variants, but the full-length and coding nature of some of these variants is not certain.

Anti-AIF1 antibody

STJ22554 100 µl
EUR 277
Description: This gene encodes a protein that binds actin and calcium. This gene is induced by cytokines and interferon and may promote macrophage activation and growth of vascular smooth muscle cells and T-lymphocytes. Polymorphisms in this gene may be associated with systemic sclerosis. Alternative splicing results in multiple transcript variants, but the full-length and coding nature of some of these variants is not certain.

Anti-AIF1 antibody

STJ192269 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to AIF1

Aif1/ Rat Aif1 ELISA Kit

ELI-04139r 96 Tests
EUR 886

Goat Anti Aif1 (C-Terminal) Polyclonal Antibody

CPBT-65002GA 0.1 mg
EUR 840

AIF1 siRNA

20-abx900236
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AIF1 siRNA

20-abx907087
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AIF1 siRNA

20-abx907088
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Aif1 Antibody, HRP conjugated

1-CSB-PA001490HB01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Aif1. Recognizes Aif1 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Aif1 Antibody, HRP conjugated

1-CSB-PA001490HB01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Aif1. Recognizes Aif1 from Rat. This antibody is HRP conjugated. Tested in the following application: ELISA

Aif1 Antibody, FITC conjugated

1-CSB-PA001490HC01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Aif1. Recognizes Aif1 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Aif1 Antibody, FITC conjugated

1-CSB-PA001490HC01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Aif1. Recognizes Aif1 from Rat. This antibody is FITC conjugated. Tested in the following application: ELISA

Aif1 Antibody, Biotin conjugated

1-CSB-PA001490HD01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Aif1. Recognizes Aif1 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

Aif1 Antibody, Biotin conjugated

1-CSB-PA001490HD01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Aif1. Recognizes Aif1 from Rat. This antibody is Biotin conjugated. Tested in the following application: ELISA

AIF1 Antibody, HRP conjugated

1-CSB-PA00667B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AIF1. Recognizes AIF1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

AIF1 Antibody, FITC conjugated

1-CSB-PA00667C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AIF1. Recognizes AIF1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

AIF1 Antibody, Biotin conjugated

1-CSB-PA00667D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AIF1. Recognizes AIF1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-Iba1/AIF1 Antibody

A01394 100ug/vial
EUR 334

Anti-Iba1/AIF1 Antibody

PA1724 100ug/vial
EUR 334

Anti-Iba1/AIF1 Antibody

RP1074 100ug/vial
EUR 334

Polyclonal Goat Anti-AIF1 / IBA1 (isoform 3) Antibody

AMM04873G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-AIF1 / IBA1 (isoform 3) . This antibody is tested and proven to work in the following applications:

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Human)

4-PAC288Hu01
  • EUR 203.00
  • EUR 1823.00
  • EUR 469.00
  • EUR 247.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AIF1 (Met1~Pro147)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Allograft Inflammatory Factor 1 (AIF1)

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Mouse)

4-PAC288Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AIF1 (Pro35~Glu130)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Allograft Inflammatory Factor 1 (AIF1)

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Rat)

4-PAC288Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AIF1 (Met1~Pro147)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Allograft Inflammatory Factor 1 (AIF1)

Polyclonal Goat Anti-AIF1 / IBA1 (isoforms 1 + 3) Antibody

AMM04874G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-AIF1 / IBA1 (isoforms 1 + 3) . This antibody is tested and proven to work in the following applications:

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Guinea pig)

4-PAC288Gu01
  • EUR 268.00
  • EUR 2840.00
  • EUR 700.00
  • EUR 340.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AIF1 (Met1~Pro147)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Guinea pig Allograft Inflammatory Factor 1 (AIF1)

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Human), APC

4-PAC288Hu01-APC
  • EUR 279.00
  • EUR 2339.00
  • EUR 678.00
  • EUR 346.00
  • EUR 191.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AIF1 (Met1~Pro147)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with APC.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Human), Biotinylated

4-PAC288Hu01-Biotin
  • EUR 263.00
  • EUR 1773.00
  • EUR 555.00
  • EUR 312.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AIF1 (Met1~Pro147)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with Biotin.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Human), Cy3

4-PAC288Hu01-Cy3
  • EUR 331.00
  • EUR 3077.00
  • EUR 863.00
  • EUR 420.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AIF1 (Met1~Pro147)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with Cy3.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Human), FITC

4-PAC288Hu01-FITC
  • EUR 243.00
  • EUR 1891.00
  • EUR 562.00
  • EUR 297.00
  • EUR 173.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AIF1 (Met1~Pro147)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with FITC.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Human), HRP

4-PAC288Hu01-HRP
  • EUR 259.00
  • EUR 2043.00
  • EUR 604.00
  • EUR 316.00
  • EUR 182.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AIF1 (Met1~Pro147)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with HRP.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Human), PE

4-PAC288Hu01-PE
  • EUR 243.00
  • EUR 1891.00
  • EUR 562.00
  • EUR 297.00
  • EUR 173.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AIF1 (Met1~Pro147)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with PE.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Mouse), APC

4-PAC288Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AIF1 (Pro35~Glu130)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with APC.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Mouse), Biotinylated

4-PAC288Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AIF1 (Pro35~Glu130)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with Biotin.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Mouse), Cy3

4-PAC288Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AIF1 (Pro35~Glu130)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with Cy3.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Mouse), FITC

4-PAC288Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AIF1 (Pro35~Glu130)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with FITC.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Mouse), HRP

4-PAC288Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AIF1 (Pro35~Glu130)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with HRP.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Mouse), PE

4-PAC288Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AIF1 (Pro35~Glu130)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with PE.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Rat), APC

4-PAC288Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AIF1 (Met1~Pro147)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with APC.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Rat), Biotinylated

4-PAC288Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AIF1 (Met1~Pro147)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with Biotin.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Rat), Cy3

4-PAC288Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AIF1 (Met1~Pro147)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with Cy3.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Rat), FITC

4-PAC288Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AIF1 (Met1~Pro147)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with FITC.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Rat), HRP

4-PAC288Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AIF1 (Met1~Pro147)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with HRP.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Rat), PE

4-PAC288Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AIF1 (Met1~Pro147)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with PE.

AIF1 Blocking Peptide

DF6442-BP 1mg
EUR 195

AIF1 Blocking Peptide

DF7217-BP 1mg
EUR 195

AIF1 cloning plasmid

CSB-CL001490HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 444
  • Sequence: atgagccaaaccagggatttacagggaggaaaagctttcggactgctgaaggcccagcaggaagagaggctggatgagatcaacaagcaattcctagacgatcccaaatatagcagtgatgaggatctgccctccaaactggaaggcttcaaagagaaatacatggagtttgacct
  • Show more
Description: A cloning plasmid for the AIF1 gene.

Rabbit Allograft Inflammatory Factor 1 (AIF1) ELISA Kit

abx362615-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Polyclonal Goat Anti-AIF1 / IBA1 (isoform 1 and 3) Antibody

AMM04872G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-AIF1 / IBA1 (isoform 1 and 3) . This antibody is tested and proven to work in the following applications:

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Guinea pig), APC

4-PAC288Gu01-APC
  • EUR 377.00
  • EUR 3725.00
  • EUR 1025.00
  • EUR 485.00
  • EUR 233.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AIF1 (Met1~Pro147)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Guinea pig Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with APC.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Guinea pig), Biotinylated

4-PAC288Gu01-Biotin
  • EUR 334.00
  • EUR 2790.00
  • EUR 810.00
  • EUR 414.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AIF1 (Met1~Pro147)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Guinea pig Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with Biotin.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Guinea pig), Cy3

4-PAC288Gu01-Cy3
  • EUR 461.00
  • EUR 4925.00
  • EUR 1325.00
  • EUR 605.00
  • EUR 269.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AIF1 (Met1~Pro147)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Guinea pig Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with Cy3.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Guinea pig), FITC

4-PAC288Gu01-FITC
  • EUR 321.00
  • EUR 3000.00
  • EUR 840.00
  • EUR 408.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AIF1 (Met1~Pro147)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Guinea pig Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with FITC.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Guinea pig), HRP

4-PAC288Gu01-HRP
  • EUR 343.00
  • EUR 3245.00
  • EUR 905.00
  • EUR 437.00
  • EUR 218.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AIF1 (Met1~Pro147)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Guinea pig Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with HRP.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Guinea pig), PE

4-PAC288Gu01-PE
  • EUR 321.00
  • EUR 3000.00
  • EUR 840.00
  • EUR 408.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AIF1 (Met1~Pro147)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Guinea pig Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with PE.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Human), APC-Cy7

4-PAC288Hu01-APC-Cy7
  • EUR 439.00
  • EUR 4558.00
  • EUR 1237.00
  • EUR 572.00
  • EUR 263.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AIF1 (Met1~Pro147)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with APC-Cy7.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Mouse), APC-Cy7

4-PAC288Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AIF1 (Pro35~Glu130)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with APC-Cy7.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Rat), APC-Cy7

4-PAC288Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AIF1 (Met1~Pro147)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with APC-Cy7.

AIF1/ Iba1 MonoSpecific Antibody, Unconjugated-20ug

199-MSM1-P0 20ug
EUR 233

AIF1/ Iba1 MonoSpecific Antibody, Unconjugated-100ug

199-MSM1-P1 100ug
EUR 428

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx025719-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx025719-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx214166
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx214538
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx175326
  • EUR 328.00
  • EUR 133.00
  • EUR 899.00
  • EUR 453.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx175327
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx103213
  • EUR 328.00
  • EUR 133.00
  • EUR 899.00
  • EUR 453.00
  • EUR 286.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx103214
  • EUR 300.00
  • EUR 704.00
  • EUR 356.00
  • EUR 154.00
  • EUR 244.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx103215
  • EUR 314.00
  • EUR 133.00
  • EUR 829.00
  • EUR 439.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx103216
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx104925
  • EUR 467.00
  • EUR 133.00
  • EUR 1358.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx110941
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx037687-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx037794-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx131921
  • EUR 356.00
  • EUR 913.00
  • EUR 467.00
  • EUR 154.00
  • EUR 272.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx109254
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx109516
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (Aif1) Antibody

20-abx319635
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx001285
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anti-AIF1 / IBA1 (isoform 3) antibody

STJ70888 100 µg
EUR 359

AIF1 protein (His tag)

80R-1764 100 ug
EUR 305
Description: Purified recombinant Human AIF1 protein

Human AIF1 ELISA Kit

EHA0634 96Tests
EUR 521

Human AIF1 ELISA Kit

ELA-E1251h 96 Tests
EUR 824

Goat AIF1 ELISA Kit

EGTA0634 96Tests
EUR 521

Canine AIF1 ELISA Kit

ECA0634 96Tests
EUR 521

Chicken AIF1 ELISA Kit

ECKA0634 96Tests
EUR 521

Anserini AIF1 ELISA Kit

EAA0634 96Tests
EUR 521

Bovine AIF1 ELISA Kit

EBA0634 96Tests
EUR 521

AIF1 ELISA KIT|Human

EF007245 96 Tests
EUR 689

Rat AIF1 shRNA Plasmid

20-abx985490
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human AIF1 shRNA Plasmid

20-abx950138
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse AIF1 shRNA Plasmid

20-abx969091
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse AIF1 ELISA Kit

EMA0634 96Tests
EUR 521

Rat AIF1 ELISA Kit

ERA0634 96Tests
EUR 521

Sheep AIF1 ELISA Kit

ESA0634 96Tests
EUR 521

Monkey AIF1 ELISA Kit

EMKA0634 96Tests
EUR 521

Porcine AIF1 ELISA Kit

EPA0634 96Tests
EUR 521

AIF1 Recombinant Protein (Human)

RP000835 100 ug Ask for price

AIF1 Rabbit Polyclonal Antibody