DISP1 Rabbit Polyclonal Antibody

DISP1 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

DISP1 Polyclonal Antibody

ABP58376-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human DISP1 protein at amino acid sequence of 270-350
  • Applications tips:
Description: A polyclonal antibody for detection of DISP1 from Human, Mouse. This DISP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DISP1 protein at amino acid sequence of 270-350

DISP1 Polyclonal Antibody

ABP58376-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DISP1 protein at amino acid sequence of 270-350
  • Applications tips:
Description: A polyclonal antibody for detection of DISP1 from Human, Mouse. This DISP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DISP1 protein at amino acid sequence of 270-350

DISP1 Polyclonal Antibody

28772-100ul 100ul
EUR 252

DISP1 Polyclonal Antibody

28772-50ul 50ul
EUR 187

DISP1 Rabbit pAb

A14946-100ul 100 ul
EUR 308

DISP1 Rabbit pAb

A14946-200ul 200 ul
EUR 459

DISP1 Rabbit pAb

A14946-20ul 20 ul
EUR 183

DISP1 Rabbit pAb

A14946-50ul 50 ul
EUR 223

DISP1 Polyclonal Conjugated Antibody

C28772 100ul
EUR 397

DISP1 antibody

70R-6341 50 ug
EUR 467
Description: Rabbit polyclonal DISP1 antibody

DISP1 Antibody

25400-100ul 100ul
EUR 390

DISP1 antibody

70R-16842 50 ul
EUR 435
Description: Rabbit polyclonal DISP1 antibody

DISP1 Antibody

1-CSB-PA006916GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DISP1. Recognizes DISP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal DISP1 antibody - middle region

APR11736G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DISP1 - middle region. This antibody is tested and proven to work in the following applications:

Polyclonal DISPA / DISP1 Antibody (N-Terminus)

APR11737G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DISPA / DISP1 (N-Terminus). This antibody is tested and proven to work in the following applications:

anti- DISP1 antibody

FNab02398 100µg
EUR 585
  • Immunogen: dispatched homolog 1(Drosophila)
  • Uniprot ID: Q96F81
  • Gene ID: 84976
  • Research Area: Neuroscience, Developmental biology
Description: Antibody raised against DISP1

Anti-DISP1 antibody

PAab02398 100 ug
EUR 412

Anti-DISP1 antibody

STJ117145 100 µl
EUR 277
Description: The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A novel segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. This gene is one of two human homologs of Drosophila dispatched and, based on sequence identity to its mouse counterpart, the encoded protein may play an essential role in Hh patterning activities in the early embryo.

Anti-DISP1 antibody

STJ192460 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DISP1

DISP1 siRNA

20-abx914188
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DISP1 siRNA

20-abx914189
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse)

4-PAN612Mu01
  • EUR 266.00
  • EUR 2813.00
  • EUR 694.00
  • EUR 337.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1)

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), APC

4-PAN612Mu01-APC
  • EUR 374.00
  • EUR 3689.00
  • EUR 1016.00
  • EUR 481.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with APC.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), Biotinylated

4-PAN612Mu01-Biotin
  • EUR 332.00
  • EUR 2763.00
  • EUR 803.00
  • EUR 411.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with Biotin.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), Cy3

4-PAN612Mu01-Cy3
  • EUR 457.00
  • EUR 4877.00
  • EUR 1313.00
  • EUR 600.00
  • EUR 267.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with Cy3.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), FITC

4-PAN612Mu01-FITC
  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with FITC.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), HRP

4-PAN612Mu01-HRP
  • EUR 341.00
  • EUR 3213.00
  • EUR 897.00
  • EUR 433.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with HRP.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), PE

4-PAN612Mu01-PE
  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with PE.

DISP1 Blocking Peptide

33R-3115 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DISP1 antibody, catalog no. 70R-6341

DISP1 cloning plasmid

CSB-CL839320HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1629
  • Sequence: atggctatgagcaatggaaacaatgattttgtggttctgagcaacagcagcatcgcaaccagtgctgctaacccgagtcccctcaccccctgtgatggagaccatgcagcccagcagctcacacccaaagaagcaacaagaacaaaagtgagtccaaatggatgcctgcaactta
  • Show more
Description: A cloning plasmid for the DISP1 gene.

DISP1 cloning plasmid

CSB-CL839320HU1-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2754
  • Sequence: atgttcgtcaccagttttaccactgctgctgccttttatgctaactatgttagcaacattacagcaatccgatgctttggggtttatgcggggacagctatattggtgaattacgttttgatggtcacatggcttccagcagttgttgtgctgcatgagcggtatcttcttaata
  • Show more
Description: A cloning plasmid for the DISP1 gene.

pCMV-SPORT6-DISP1

PVT13099 2 ug
EUR 391

Dispatched Homolog 1 (DISP1) Antibody

20-abx112105
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dispatched Homolog 1 (DISP1) Antibody

20-abx102141
  • EUR 467.00
  • EUR 133.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Dispatched Homolog 1 (DISP1) Antibody

abx432607-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), APC-Cy7

4-PAN612Mu01-APC-Cy7
  • EUR 628.00
  • EUR 7258.00
  • EUR 1912.00
  • EUR 842.00
  • EUR 344.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with APC-Cy7.

Mouse DISP1 shRNA Plasmid

20-abx976776
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DISP1 shRNA Plasmid

20-abx963739
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DISP1 ELISA KIT|Human

EF009119 96 Tests
EUR 689

Protein Dispatched Homolog 1 (DISP1) Antibody

abx232398-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

DISP1 ORF Vector (Human) (pORF)

ORF003127 1.0 ug DNA
EUR 95

DISP1 ORF Vector (Human) (pORF)

ORF003128 1.0 ug DNA
EUR 95

Disp1 ORF Vector (Rat) (pORF)

ORF066034 1.0 ug DNA
EUR 2080

Disp1 ORF Vector (Mouse) (pORF)

ORF043040 1.0 ug DNA
EUR 1572

Recombinant Dispatched Homolog 1 (DISP1)

4-RPN612Mu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q3TDN0
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 36.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Dispatched Homolog 1 expressed in: E.coli

DISP1 sgRNA CRISPR Lentivector set (Human)

K0604701 3 x 1.0 ug
EUR 339

Mouse Dispatched Homolog 1 (DISP1) Protein

20-abx066351
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Disp1 sgRNA CRISPR Lentivector set (Mouse)

K3768101 3 x 1.0 ug
EUR 339

Disp1 sgRNA CRISPR Lentivector set (Rat)

K6452601 3 x 1.0 ug
EUR 339

DISP1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0604702 1.0 ug DNA
EUR 154

DISP1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0604703 1.0 ug DNA
EUR 154

DISP1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0604704 1.0 ug DNA
EUR 154

Disp1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3768102 1.0 ug DNA
EUR 154

Disp1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3768103 1.0 ug DNA
EUR 154

Disp1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3768104 1.0 ug DNA
EUR 154

Disp1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6452602 1.0 ug DNA
EUR 154

Disp1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6452603 1.0 ug DNA
EUR 154

Disp1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6452604 1.0 ug DNA
EUR 154

DISP1 Protein Vector (Human) (pPB-C-His)

PV012505 500 ng
EUR 329

DISP1 Protein Vector (Human) (pPB-N-His)

PV012506 500 ng
EUR 329

DISP1 Protein Vector (Human) (pPM-C-HA)

PV012507 500 ng
EUR 329

DISP1 Protein Vector (Human) (pPM-C-His)

PV012508 500 ng
EUR 329

DISP1 Protein Vector (Human) (pPB-C-His)

PV012509 500 ng
EUR 329

DISP1 Protein Vector (Human) (pPB-N-His)

PV012510 500 ng
EUR 329

DISP1 Protein Vector (Human) (pPM-C-HA)

PV012511 500 ng
EUR 329

DISP1 Protein Vector (Human) (pPM-C-His)

PV012512 500 ng
EUR 329

DISP1 Protein Vector (Mouse) (pPB-C-His)

PV172158 500 ng
EUR 2570

DISP1 Protein Vector (Mouse) (pPB-N-His)

PV172159 500 ng
EUR 2570

DISP1 Protein Vector (Mouse) (pPM-C-HA)

PV172160 500 ng
EUR 2570

DISP1 Protein Vector (Mouse) (pPM-C-His)

PV172161 500 ng
EUR 2570

DISP1 Protein Vector (Rat) (pPB-C-His)

PV264134 500 ng
EUR 2571

DISP1 Protein Vector (Rat) (pPB-N-His)

PV264135 500 ng
EUR 2571

DISP1 Protein Vector (Rat) (pPM-C-HA)

PV264136 500 ng
EUR 2571

DISP1 Protein Vector (Rat) (pPM-C-His)

PV264137 500 ng
EUR 2571

Disp1 3'UTR Luciferase Stable Cell Line

TU203429 1.0 ml Ask for price

Disp1 3'UTR GFP Stable Cell Line

TU155165 1.0 ml Ask for price

DISP1 3'UTR Luciferase Stable Cell Line

TU006037 1.0 ml
EUR 1394

Disp1 3'UTR Luciferase Stable Cell Line

TU105165 1.0 ml Ask for price

DISP1 3'UTR GFP Stable Cell Line

TU056037 1.0 ml
EUR 1394

Disp1 3'UTR GFP Stable Cell Line

TU253429 1.0 ml Ask for price

Mouse Protein dispatched homolog 1, Disp1 ELISA KIT

ELI-26868m 96 Tests
EUR 865

Human Protein dispatched homolog 1, DISP1 ELISA KIT

ELI-31941h 96 Tests
EUR 824

Human Protein dispatched homolog 1 (DISP1) ELISA Kit

abx386894-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Protein dispatched homolog 1 (DISP1) ELISA Kit

abx389081-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

DISP1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV653173 1.0 ug DNA
EUR 2402

DISP1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV653177 1.0 ug DNA
EUR 2402

DISP1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV653178 1.0 ug DNA
EUR 2402

DISP1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV709323 1.0 ug DNA
EUR 316

DISP1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV709327 1.0 ug DNA
EUR 316

DISP1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV709328 1.0 ug DNA
EUR 316

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

DISP1 Rabbit Polyclonal Antibody