LAX1 Rabbit Polyclonal Antibody

LAX1 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

LAX1 Polyclonal Antibody
27649-50ul 50ul
EUR 187
LAX1 Polyclonal Antibody
ABP59097-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human LAX1 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of LAX1 from Human, Mouse, Rat. This LAX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LAX1 protein at amino acid sequence of 30-110
LAX1 Polyclonal Antibody
ABP59097-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human LAX1 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of LAX1 from Human, Mouse, Rat. This LAX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LAX1 protein at amino acid sequence of 30-110
LAX1 Polyclonal Antibody
ABP59097-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human LAX1 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of LAX1 from Human, Mouse, Rat. This LAX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LAX1 protein at amino acid sequence of 30-110
LAX1 Polyclonal Antibody
ES11285-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against LAX1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
LAX1 Polyclonal Antibody
ES11285-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LAX1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
LAX1 Rabbit pAb
A12218-100ul 100 ul
EUR 308
LAX1 Rabbit pAb
A12218-200ul 200 ul
EUR 459
LAX1 Rabbit pAb
A12218-20ul 20 ul
EUR 183
LAX1 Rabbit pAb
A12218-50ul 50 ul
EUR 223
LAX1 Polyclonal Conjugated Antibody
C27649 100ul
EUR 397
LAX1 antibody
70R-18223 50 ul
EUR 435
Description: Rabbit polyclonal LAX1 antibody
LAX1 Antibody
1-CSB-PA811614LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LAX1. Recognizes LAX1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200
LAX1 antibody
70R-6590 50 ug
EUR 467
Description: Rabbit polyclonal LAX1 antibody raised against the middle region of LAX1
LAX1 antibody
70R-9683 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal LAX1 antibody
LAX1 Antibody
1-CSB-PA012771GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against LAX1. Recognizes LAX1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
Polyclonal LAX1 Antibody (internal region)
APR17176G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human LAX1 (internal region). This antibody is tested and proven to work in the following applications:
Lax1/ Rat Lax1 ELISA Kit
ELI-14389r 96 Tests
EUR 886
anti- LAX1 antibody
FNab04710 100µg
EUR 505.25
  • Immunogen: lymphocyte transmembrane adaptor 1
  • Uniprot ID: Q8IWV1
  • Gene ID: 54900
  • Research Area: Signal Transduction
Description: Antibody raised against LAX1
Anti-LAX1 antibody
PAab04710 100 ug
EUR 355
Anti-LAX1 antibody
STJ114109 100 µl
EUR 277
Anti-LAX1 antibody
STJ72071 100 µg
EUR 260
Anti-LAX1 antibody
STJ192443 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LAX1
LAX1 siRNA
20-abx902939
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
LAX1 siRNA
20-abx922300
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
LAX1 siRNA
20-abx922301
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-LAX1
YF-PA19440 50 ug
EUR 363
Description: Mouse polyclonal to LAX1
LAX1 Antibody, HRP conjugated
1-CSB-PA811614LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LAX1. Recognizes LAX1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
LAX1 Antibody, FITC conjugated
1-CSB-PA811614LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LAX1. Recognizes LAX1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
LAX1 Antibody, Biotin conjugated
1-CSB-PA811614LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LAX1. Recognizes LAX1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
LAX1 Blocking Peptide
33R-4955 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LAX1 antibody, catalog no. 70R-6590
LAX1 Blocking Peptide
33R-1089 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KCTD11 antibody, catalog no. 70R-1493
LAX1 cloning plasmid
CSB-CL811614HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 969
  • Sequence: atgcccttgctgactttgccacaaaccagacaaagagccaaaaatatttatgacatcttgccttggcgacaggaagacctggggagacatgagtcgaggagtatgcgcattttcagtactgagagcctcctctccagaaattctgagagcccggagcatgtgccctcccaagcagg
  • Show more
Description: A cloning plasmid for the LAX1 gene.
LAX1 ELISA KIT|Human
EF010631 96 Tests
EUR 689
Rat LAX1 shRNA Plasmid
20-abx990851
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human LAX1 shRNA Plasmid
20-abx960308
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse LAX1 shRNA Plasmid
20-abx982472
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
LAX1 Recombinant Protein (Human)
RP017578 100 ug Ask for price
LAX1 Recombinant Protein (Rat)
RP207857 100 ug Ask for price
LAX1 Recombinant Protein (Mouse)
RP146936 100 ug Ask for price
LAX1 Recombinant Protein (Mouse)
RP146939 100 ug Ask for price
Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody
20-abx113547
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody
20-abx126081
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody
abx030461-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody
abx030461-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody
20-abx318746
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody
abx234710-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody
abx432919-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.
Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody (HRP)
20-abx316368
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody (FITC)
20-abx316369
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody (Biotin)
20-abx316370
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Lax1 ORF Vector (Rat) (pORF)
ORF069287 1.0 ug DNA
EUR 506
LAX1 ORF Vector (Human) (pORF)
ORF005860 1.0 ug DNA
EUR 95
Lax1 ORF Vector (Mouse) (pORF)
ORF048980 1.0 ug DNA
EUR 506
Lax1 ORF Vector (Mouse) (pORF)
ORF048981 1.0 ug DNA
EUR 506
Lax1 sgRNA CRISPR Lentivector set (Rat)
K7491701 3 x 1.0 ug
EUR 339
Lax1 sgRNA CRISPR Lentivector set (Mouse)
K3218401 3 x 1.0 ug
EUR 339
LAX1 sgRNA CRISPR Lentivector set (Human)
K1198401 3 x 1.0 ug
EUR 339
Lax1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7491702 1.0 ug DNA
EUR 154
Lax1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7491703 1.0 ug DNA
EUR 154
Lax1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7491704 1.0 ug DNA
EUR 154
Lax1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3218402 1.0 ug DNA
EUR 154
Lax1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3218403 1.0 ug DNA
EUR 154
Lax1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3218404 1.0 ug DNA
EUR 154
LAX1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1198402 1.0 ug DNA
EUR 154
LAX1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1198403 1.0 ug DNA
EUR 154
LAX1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1198404 1.0 ug DNA
EUR 154
LAX1 Protein Vector (Human) (pPB-C-His)
PV023437 500 ng
EUR 329
LAX1 Protein Vector (Human) (pPB-N-His)
PV023438 500 ng
EUR 329
LAX1 Protein Vector (Human) (pPM-C-HA)
PV023439 500 ng
EUR 329
LAX1 Protein Vector (Human) (pPM-C-His)
PV023440 500 ng
EUR 329
LAX1 Protein Vector (Rat) (pPB-C-His)
PV277146 500 ng
EUR 603
LAX1 Protein Vector (Rat) (pPB-N-His)
PV277147 500 ng
EUR 603
LAX1 Protein Vector (Rat) (pPM-C-HA)
PV277148 500 ng
EUR 603
LAX1 Protein Vector (Rat) (pPM-C-His)
PV277149 500 ng
EUR 603
LAX1 Protein Vector (Mouse) (pPB-C-His)
PV195918 500 ng
EUR 603
LAX1 Protein Vector (Mouse) (pPB-N-His)
PV195919 500 ng
EUR 603
LAX1 Protein Vector (Mouse) (pPM-C-HA)
PV195920 500 ng
EUR 603
LAX1 Protein Vector (Mouse) (pPM-C-His)
PV195921 500 ng
EUR 603
LAX1 Protein Vector (Mouse) (pPB-C-His)
PV195922 500 ng
EUR 603
LAX1 Protein Vector (Mouse) (pPB-N-His)
PV195923 500 ng
EUR 603
LAX1 Protein Vector (Mouse) (pPM-C-HA)
PV195924 500 ng
EUR 603
LAX1 Protein Vector (Mouse) (pPM-C-His)
PV195925 500 ng
EUR 603
Lax1 3'UTR Luciferase Stable Cell Line
TU110921 1.0 ml Ask for price
Lax1 3'UTR GFP Stable Cell Line
TU160921 1.0 ml Ask for price
Lax1 3'UTR Luciferase Stable Cell Line
TU206959 1.0 ml Ask for price
Lax1 3'UTR GFP Stable Cell Line
TU256959 1.0 ml Ask for price
LAX1 3'UTR GFP Stable Cell Line
TU062289 1.0 ml
EUR 1521
LAX1 3'UTR Luciferase Stable Cell Line
TU012289 1.0 ml
EUR 1521
Human Lymphocyte transmembrane adapter 1, LAX1 ELISA KIT
ELI-19284h 96 Tests
EUR 824
Bovine Lymphocyte transmembrane adapter 1, LAX1 ELISA KIT
ELI-21100b 96 Tests
EUR 928
Human Lymphocyte transmembrane adapter 1 (LAX1) ELISA Kit
abx388235-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse Lymphocyte transmembrane adapter 1, Lax1 ELISA KIT
ELI-37755m 96 Tests
EUR 865
LAX1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV679417 1.0 ug DNA
EUR 682
LAX1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV679421 1.0 ug DNA
EUR 682
LAX1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV679422 1.0 ug DNA
EUR 682
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

LAX1 Rabbit Polyclonal Antibody