HAND2 Rabbit Polyclonal Antibody
HAND2 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
HAND2 Polyclonal Antibody |
ABP58744-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human HAND2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of HAND2 from Human, Mouse, Rat. This HAND2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HAND2 protein |
HAND2 Polyclonal Antibody |
ABP58744-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human HAND2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of HAND2 from Human, Mouse, Rat. This HAND2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HAND2 protein |
HAND2 Polyclonal Antibody |
30800-100ul |
SAB |
100ul |
EUR 252 |
HAND2 Polyclonal Antibody |
30800-50ul |
SAB |
50ul |
EUR 187 |
HAND2 Rabbit pAb |
A7044-100ul |
Abclonal |
100 ul |
EUR 308 |
HAND2 Rabbit pAb |
A7044-200ul |
Abclonal |
200 ul |
EUR 459 |
HAND2 Rabbit pAb |
A7044-20ul |
Abclonal |
20 ul |
EUR 183 |
HAND2 Rabbit pAb |
A7044-50ul |
Abclonal |
50 ul |
EUR 223 |
HAND2 Polyclonal Conjugated Antibody |
C30800 |
SAB |
100ul |
EUR 397 |
Hand2 antibody |
70R-7837 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal Hand2 antibody |
HAND2 antibody |
10R-1600 |
Fitzgerald |
100 ug |
EUR 512 |
Description: Mouse monoclonal HAND2 antibody |
HAND2 Antibody |
1-CSB-PA010126ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against HAND2. Recognizes HAND2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Polyclonal DHAND / HAND2 Antibody (aa194-207) |
APR11718G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DHAND / HAND2 (aa194-207). This antibody is tested and proven to work in the following applications: |
Polyclonal Hand2 antibody - C-terminal region |
AMM06000G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Hand2 - C-terminal region. This antibody is tested and proven to work in the following applications: |
Anti-HAND2 antibody |
STJ29124 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene belongs to the basic helix-loop-helix family of transcription factors. This gene product is one of two closely related family members, the HAND proteins, which are asymmetrically expressed in the developing ventricular chambers and play an essential role in cardiac morphogenesis. Working in a complementary fashion, they function in the formation of the right ventricle and aortic arch arteries, implicating them as mediators of congenital heart disease. In addition, this transcription factor plays an important role in limb and branchial arch development. |
Anti-HAND2 antibody |
STJ192196 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to HAND2 |
HAND2 siRNA |
20-abx902408 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HAND2 siRNA |
20-abx919065 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HAND2 siRNA |
20-abx919066 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HAND2 cloning plasmid |
CSB-CL010126HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 543
- Sequence: ATGAGTCTGGTAGGTGGTTTTCCCCACCACCCGGTGGTGCACCACGAGGGCTACCCGTTTGCCGCCGCCGCCGCCGCCAGCCGCTGCAGCCATGAGGAGAACCCCTACTTCCATGGCTGGCTCATCGGCCACCCCGAGATGTCGCCCCCCGACTACAGCATGGCCCTGTCCTACAG
- Show more
|
Description: A cloning plasmid for the HAND2 gene. |
Hand2 Blocking Peptide |
33R-2133 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Hand2 antibody, catalog no. 70R-7837 |
Anti-HAND2 (4D11) |
YF-MA16846 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HAND2 |
Anti-HAND2 (3E3) |
YF-MA16847 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HAND2 |
Anti-HAND2 (4E12) |
YF-MA16848 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HAND2 |
Anti-HAND2 (4D9) |
YF-MA16849 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HAND2 |
Anti-HAND2 (3D5) |
YF-MA16850 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HAND2 |
Anti-HAND2 (1C7) |
YF-MA16851 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HAND2 |
Anti-HAND2 (4B11) |
YF-MA16852 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HAND2 |
Anti-HAND2 (2C10) |
YF-MA16853 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HAND2 |
Anti-HAND2 (3F10) |
YF-MA16854 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HAND2 |
Anti-HAND2 (4H8) |
YF-MA11179 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HAND2 |
Rat HAND2 shRNA Plasmid |
20-abx986324 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human HAND2 shRNA Plasmid |
20-abx956279 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse HAND2 shRNA Plasmid |
20-abx970746 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
HAND2 Recombinant Protein (Human) |
RP039712 |
ABM |
100 ug |
Ask for price |
HAND2 Recombinant Protein (Rat) |
RP204176 |
ABM |
100 ug |
Ask for price |
HAND2 Recombinant Protein (Mouse) |
RP140897 |
ABM |
100 ug |
Ask for price |
Heart and neural crest derivatives expressed 2 (HAND2) polyclonal antibody |
ABP-PAB-10481 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Genetic Disease Markers
- Brand:
|
Monoclonal HAND2 Antibody (monoclonal) (M06), Clone: 3D5 |
APG03379G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human HAND2 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 3D5. This antibody is applicable in WB |
Monoclonal HAND2 Antibody (monoclonal) (M05), Clone: 4D9 |
APR12324G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human HAND2 (monoclonal) (M05). The antibodies are raised in mouse and are from clone 4D9. This antibody is applicable in WB and IF |
Hand2 ORF Vector (Rat) (pORF) |
ORF068060 |
ABM |
1.0 ug DNA |
EUR 506 |
Hand2 ORF Vector (Mouse) (pORF) |
ORF046967 |
ABM |
1.0 ug DNA |
EUR 506 |
HAND2 ORF Vector (Human) (pORF) |
ORF013238 |
ABM |
1.0 ug DNA |
EUR 95 |
HAND2 ELISA Kit (Human) (OKCD01870) |
OKCD01870 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Essential for cardiac morphogenesis, particularly for the formation of the right ventricle and of the aortic arch arteries. Required for vascular development and regulation of angiogenesis, possibly through a VEGF signaling pathway. Plays also an important role in limb development, particularly in the establishment of anterior-posterior polarization, acting as an upstream regulator of sonic hedgehog (SHH) induction in the limb bud. Is involved in the development of branchial arches, which give rise to unique structures in the head and neck. Binds DNA on E-box consensus sequence 5'-CANNTG-3'.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.054 ng/mL |
HAND2 sgRNA CRISPR Lentivector set (Human) |
K0928401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Hand2 sgRNA CRISPR Lentivector set (Mouse) |
K3919401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Hand2 sgRNA CRISPR Lentivector set (Rat) |
K7606701 |
ABM |
3 x 1.0 ug |
EUR 339 |
HAND2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0928402 |
ABM |
1.0 ug DNA |
EUR 154 |
HAND2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0928403 |
ABM |
1.0 ug DNA |
EUR 154 |
HAND2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0928404 |
ABM |
1.0 ug DNA |
EUR 154 |
Hand2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3919402 |
ABM |
1.0 ug DNA |
EUR 154 |
Hand2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3919403 |
ABM |
1.0 ug DNA |
EUR 154 |
Hand2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3919404 |
ABM |
1.0 ug DNA |
EUR 154 |
Hand2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7606702 |
ABM |
1.0 ug DNA |
EUR 154 |
Hand2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7606703 |
ABM |
1.0 ug DNA |
EUR 154 |
Hand2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7606704 |
ABM |
1.0 ug DNA |
EUR 154 |
HAND2 Protein Vector (Human) (pPB-C-His) |
PV052949 |
ABM |
500 ng |
EUR 481 |
HAND2 Protein Vector (Human) (pPB-N-His) |
PV052950 |
ABM |
500 ng |
EUR 481 |
HAND2 Protein Vector (Human) (pPM-C-HA) |
PV052951 |
ABM |
500 ng |
EUR 481 |
HAND2 Protein Vector (Human) (pPM-C-His) |
PV052952 |
ABM |
500 ng |
EUR 481 |
HAND2 Protein Vector (Rat) (pPB-C-His) |
PV272238 |
ABM |
500 ng |
EUR 603 |
HAND2 Protein Vector (Rat) (pPB-N-His) |
PV272239 |
ABM |
500 ng |
EUR 603 |
HAND2 Protein Vector (Rat) (pPM-C-HA) |
PV272240 |
ABM |
500 ng |
EUR 603 |
HAND2 Protein Vector (Rat) (pPM-C-His) |
PV272241 |
ABM |
500 ng |
EUR 603 |
Recombinant Human HAND2 Protein, GST, E.coli-100ug |
QP6142-ec-100ug |
EnQuireBio |
100ug |
EUR 571 |
Recombinant Human HAND2 Protein, GST, E.coli-10ug |
QP6142-ec-10ug |
EnQuireBio |
10ug |
EUR 272 |
Recombinant Human HAND2 Protein, GST, E.coli-1mg |
QP6142-ec-1mg |
EnQuireBio |
1mg |
EUR 2303 |
Recombinant Human HAND2 Protein, GST, E.coli-200ug |
QP6142-ec-200ug |
EnQuireBio |
200ug |
EUR 898 |
Recombinant Human HAND2 Protein, GST, E.coli-500ug |
QP6142-ec-500ug |
EnQuireBio |
500ug |
EUR 1514 |
Recombinant Human HAND2 Protein, GST, E.coli-50ug |
QP6142-ec-50ug |
EnQuireBio |
50ug |
EUR 362 |
HAND2 Protein Vector (Mouse) (pPB-C-His) |
PV187866 |
ABM |
500 ng |
EUR 603 |
HAND2 Protein Vector (Mouse) (pPB-N-His) |
PV187867 |
ABM |
500 ng |
EUR 603 |
HAND2 Protein Vector (Mouse) (pPM-C-HA) |
PV187868 |
ABM |
500 ng |
EUR 603 |
HAND2 Protein Vector (Mouse) (pPM-C-His) |
PV187869 |
ABM |
500 ng |
EUR 603 |
Hand2 3'UTR Luciferase Stable Cell Line |
TU205628 |
ABM |
1.0 ml |
Ask for price |
Hand2 3'UTR GFP Stable Cell Line |
TU159349 |
ABM |
1.0 ml |
Ask for price |
HAND2 3'UTR Luciferase Stable Cell Line |
TU009547 |
ABM |
1.0 ml |
EUR 1394 |
Hand2 3'UTR Luciferase Stable Cell Line |
TU109349 |
ABM |
1.0 ml |
Ask for price |
HAND2 3'UTR GFP Stable Cell Line |
TU059547 |
ABM |
1.0 ml |
EUR 1394 |
Hand2 3'UTR GFP Stable Cell Line |
TU255628 |
ABM |
1.0 ml |
Ask for price |
HAND2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV672607 |
ABM |
1.0 ug DNA |
EUR 514 |
HAND2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV672611 |
ABM |
1.0 ug DNA |
EUR 514 |
HAND2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV672612 |
ABM |
1.0 ug DNA |
EUR 514 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HAND2 Rabbit Polyclonal Antibody