DKK4 Rabbit Polyclonal Antibody
DKK4 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
DKK4 Polyclonal Antibody |
ABP58378-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human DKK4 protein at amino acid sequence of 150-230
- Applications tips:
|
Description: A polyclonal antibody for detection of DKK4 from Human, Mouse. This DKK4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DKK4 protein at amino acid sequence of 150-230 |
DKK4 Polyclonal Antibody |
ABP58378-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human DKK4 protein at amino acid sequence of 150-230
- Applications tips:
|
Description: A polyclonal antibody for detection of DKK4 from Human, Mouse. This DKK4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DKK4 protein at amino acid sequence of 150-230 |
DKK4 Polyclonal Antibody |
ES11247-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against DKK4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
DKK4 Polyclonal Antibody |
ES11247-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against DKK4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
DKK4 Rabbit pAb |
A7797-100ul |
Abclonal |
100 ul |
EUR 308 |
DKK4 Rabbit pAb |
A7797-200ul |
Abclonal |
200 ul |
EUR 459 |
DKK4 Rabbit pAb |
A7797-20ul |
Abclonal |
20 ul |
EUR 183 |
DKK4 Rabbit pAb |
A7797-50ul |
Abclonal |
50 ul |
EUR 223 |
Human Dickkopf Related Protein 4 (DKK4) ELISA Kit |
DLR-DKK4-Hu-48T |
DL Develop |
48T |
EUR 554 |
- Should the Human Dickkopf Related Protein 4 (DKK4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Dickkopf Related Protein 4 (DKK4) in samples from serum, plasma or other biological fluids. |
Human Dickkopf Related Protein 4 (DKK4) ELISA Kit |
DLR-DKK4-Hu-96T |
DL Develop |
96T |
EUR 725 |
- Should the Human Dickkopf Related Protein 4 (DKK4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Dickkopf Related Protein 4 (DKK4) in samples from serum, plasma or other biological fluids. |
Mouse Dickkopf Related Protein 4 (DKK4) ELISA Kit |
DLR-DKK4-Mu-48T |
DL Develop |
48T |
EUR 566 |
- Should the Mouse Dickkopf Related Protein 4 (DKK4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Dickkopf Related Protein 4 (DKK4) in samples from serum, plasma or other biological fluids. |
Mouse Dickkopf Related Protein 4 (DKK4) ELISA Kit |
DLR-DKK4-Mu-96T |
DL Develop |
96T |
EUR 741 |
- Should the Mouse Dickkopf Related Protein 4 (DKK4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Dickkopf Related Protein 4 (DKK4) in samples from serum, plasma or other biological fluids. |
Human Dickkopf Related Protein 4 (DKK4) ELISA Kit |
RDR-DKK4-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 589 |
Human Dickkopf Related Protein 4 (DKK4) ELISA Kit |
RDR-DKK4-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 820 |
Mouse Dickkopf Related Protein 4 (DKK4) ELISA Kit |
RDR-DKK4-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 603 |
Mouse Dickkopf Related Protein 4 (DKK4) ELISA Kit |
RDR-DKK4-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 840 |
Human Dickkopf Related Protein 4 (DKK4) ELISA Kit |
RD-DKK4-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 563 |
Human Dickkopf Related Protein 4 (DKK4) ELISA Kit |
RD-DKK4-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 783 |
Mouse Dickkopf Related Protein 4 (DKK4) ELISA Kit |
RD-DKK4-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 577 |
Mouse Dickkopf Related Protein 4 (DKK4) ELISA Kit |
RD-DKK4-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 802 |
DKK4 antibody |
20R-1754 |
Fitzgerald |
100 ug |
EUR 673 |
Description: Rabbit polyclonal DKK4 antibody |
DKK4 antibody |
70R-12171 |
Fitzgerald |
100 ug |
EUR 403 |
Description: Rabbit polyclonal DKK4 antibody |
DKK4 Antibody |
35713-100ul |
SAB |
100ul |
EUR 252 |
DKK4 Antibody |
1-CSB-PA883367ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against DKK4. Recognizes DKK4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
DKK4 Antibody |
1-CSB-PA883367ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against DKK4. Recognizes DKK4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
DKK4 Antibody |
1-CSB-PA153505 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against DKK4. Recognizes DKK4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
Polyclonal DKK4 Antibody (C-term) |
APR15747G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DKK4 (C-term). This antibody is tested and proven to work in the following applications: |
Polyclonal Goat Anti-DKK4 Antibody |
APR16265G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-DKK4 . This antibody is tested and proven to work in the following applications: |
Polyclonal DKK4 Antibody (N-term) |
APR14289G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DKK4 (N-term). This antibody is tested and proven to work in the following applications: |
Polyclonal Dkk4 antibody - C-terminal region |
APC00105G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Dkk4 - C-terminal region. This antibody is tested and proven to work in the following applications: |
DKK4 Conjugated Antibody |
C35713 |
SAB |
100ul |
EUR 397 |
Anti-DKK4 antibody |
STJ110107 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein that is a member of the dickkopf family. The secreted protein contains two cysteine rich regions and is involved in embryonic development through its interactions with the Wnt signaling pathway. Activity of this protein is modulated by binding to the Wnt co-receptor and the co-factor kremen 2. |
Anti-DKK4 antibody |
STJ192405 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to DKK4 |
DKK4 siRNA |
20-abx914202 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DKK4 siRNA |
20-abx914203 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-DKK4 |
YF-PA18381 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to DKK4 |
anti-DKK4 |
YF-PA18382 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to DKK4 |
Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Human) |
4-PAQ088Hu01 |
Cloud-Clone |
-
EUR 262.00
-
EUR 2747.00
-
EUR 679.00
-
EUR 331.00
-
EUR 220.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKK4 (Gln107~His212)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 4 (DKK4) |
Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Mouse) |
4-PAQ088Mu01 |
Cloud-Clone |
-
EUR 266.00
-
EUR 2813.00
-
EUR 694.00
-
EUR 337.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKK4 (Lys37~Glu141)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Dickkopf Related Protein 4 (DKK4) |
DKK4 Blocking Peptide |
33R-10566 |
Fitzgerald |
50 ug |
EUR 349 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DKK4 antibody, catalog no. 20R-1754 |
DKK4 Blocking Peptide |
33R-10983 |
Fitzgerald |
50 ug |
EUR 191 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DKK4 antibody, catalog no. 70R-12171 |
DKK4 Blocking Peptide |
3894BP-50 |
Biovision |
|
EUR 153 |
DKK4 cloning plasmid |
CSB-CL883367HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 675
- Sequence: ATGGTGGCGGCCGTCCTGCTGGGGCTGAGCTGGCTCTGCTCTCCCCTGGGAGCTCTGGTCCTGGACTTCAACAACATCAGGAGCTCTGCTGACCTGCATGGGGCCCGGAAGGGCTCACAGTGCCTGTCTGACACGGACTGCAATACCAGAAAGTTCTGCCTCCAGCCCCGCGATGA
- Show more
|
Description: A cloning plasmid for the DKK4 gene. |
Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Human), APC |
4-PAQ088Hu01-APC |
Cloud-Clone |
-
EUR 368.00
-
EUR 3599.00
-
EUR 993.00
-
EUR 472.00
-
EUR 229.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKK4 (Gln107~His212)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 4 (DKK4). This antibody is labeled with APC. |
Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Human), Biotinylated |
4-PAQ088Hu01-Biotin |
Cloud-Clone |
-
EUR 328.00
-
EUR 2697.00
-
EUR 786.00
-
EUR 404.00
-
EUR 226.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKK4 (Gln107~His212)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 4 (DKK4). This antibody is labeled with Biotin. |
Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Human), Cy3 |
4-PAQ088Hu01-Cy3 |
Cloud-Clone |
-
EUR 449.00
-
EUR 4757.00
-
EUR 1283.00
-
EUR 588.00
-
EUR 264.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKK4 (Gln107~His212)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 4 (DKK4). This antibody is labeled with Cy3. |
Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Human), FITC |
4-PAQ088Hu01-FITC |
Cloud-Clone |
-
EUR 314.00
-
EUR 2899.00
-
EUR 814.00
-
EUR 397.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKK4 (Gln107~His212)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 4 (DKK4). This antibody is labeled with FITC. |
Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Human), HRP |
4-PAQ088Hu01-HRP |
Cloud-Clone |
-
EUR 335.00
-
EUR 3135.00
-
EUR 877.00
-
EUR 426.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKK4 (Gln107~His212)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 4 (DKK4). This antibody is labeled with HRP. |
Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Human), PE |
4-PAQ088Hu01-PE |
Cloud-Clone |
-
EUR 314.00
-
EUR 2899.00
-
EUR 814.00
-
EUR 397.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKK4 (Gln107~His212)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 4 (DKK4). This antibody is labeled with PE. |
Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Mouse), APC |
4-PAQ088Mu01-APC |
Cloud-Clone |
-
EUR 374.00
-
EUR 3689.00
-
EUR 1016.00
-
EUR 481.00
-
EUR 232.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKK4 (Lys37~Glu141)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Dickkopf Related Protein 4 (DKK4). This antibody is labeled with APC. |
Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Mouse), Biotinylated |
4-PAQ088Mu01-Biotin |
Cloud-Clone |
-
EUR 332.00
-
EUR 2763.00
-
EUR 803.00
-
EUR 411.00
-
EUR 228.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKK4 (Lys37~Glu141)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Dickkopf Related Protein 4 (DKK4). This antibody is labeled with Biotin. |
Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Mouse), Cy3 |
4-PAQ088Mu01-Cy3 |
Cloud-Clone |
-
EUR 457.00
-
EUR 4877.00
-
EUR 1313.00
-
EUR 600.00
-
EUR 267.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKK4 (Lys37~Glu141)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Dickkopf Related Protein 4 (DKK4). This antibody is labeled with Cy3. |
Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Mouse), FITC |
4-PAQ088Mu01-FITC |
Cloud-Clone |
-
EUR 319.00
-
EUR 2971.00
-
EUR 832.00
-
EUR 405.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKK4 (Lys37~Glu141)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Dickkopf Related Protein 4 (DKK4). This antibody is labeled with FITC. |
Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Mouse), HRP |
4-PAQ088Mu01-HRP |
Cloud-Clone |
-
EUR 341.00
-
EUR 3213.00
-
EUR 897.00
-
EUR 433.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKK4 (Lys37~Glu141)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Dickkopf Related Protein 4 (DKK4). This antibody is labeled with HRP. |
Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Mouse), PE |
4-PAQ088Mu01-PE |
Cloud-Clone |
-
EUR 319.00
-
EUR 2971.00
-
EUR 832.00
-
EUR 405.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKK4 (Lys37~Glu141)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Dickkopf Related Protein 4 (DKK4). This antibody is labeled with PE. |
Dickkopf Related Protein 4 (DKK4) Antibody |
20-abx176166 |
Abbexa |
|
|
|
Dickkopf Related Protein 4 (DKK4) Antibody |
20-abx210812 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dickkopf Related Protein 4 (DKK4) Antibody |
20-abx102611 |
Abbexa |
-
EUR 467.00
-
EUR 133.00
-
EUR 1344.00
-
EUR 634.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Dickkopf Related Protein 4 (DKK4) Antibody |
20-abx129067 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Dickkopf Related Protein 4 (DKK4) Antibody |
20-abx172117 |
Abbexa |
|
|
|
Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Human), APC-Cy7 |
4-PAQ088Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 616.00
-
EUR 7078.00
-
EUR 1867.00
-
EUR 824.00
-
EUR 338.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKK4 (Gln107~His212)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 4 (DKK4). This antibody is labeled with APC-Cy7. |
Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAQ088Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 628.00
-
EUR 7258.00
-
EUR 1912.00
-
EUR 842.00
-
EUR 344.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKK4 (Lys37~Glu141)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Dickkopf Related Protein 4 (DKK4). This antibody is labeled with APC-Cy7. |
Human DKK4 shRNA Plasmid |
20-abx958975 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse DKK4 shRNA Plasmid |
20-abx982107 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
DKK4 Recombinant Protein (Human) |
RP038536 |
ABM |
100 ug |
Ask for price |
DKK4 Recombinant Protein (Rat) |
RP198119 |
ABM |
100 ug |
Ask for price |
DKK4 Recombinant Protein (Mouse) |
RP129137 |
ABM |
100 ug |
Ask for price |
Rabbit Dickkopf 4 Homolog (Xenopus Laevis) (DKK4) ELISA Kit |
abx363554-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Dickkopf 4 Homolog (Xenopus Laevis) (DKK4) Antibody |
abx026362-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Dickkopf 4 Homolog (Xenopus Laevis) (DKK4) Antibody |
abx026362-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Dickkopf 4 Homolog (Xenopus Laevis) (DKK4) Antibody |
20-abx005655 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Dickkopf 4 Homolog (Xenopus Laevis) (DKK4) Antibody |
abx028491-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Dickkopf 4 Homolog (Xenopus Laevis) (DKK4) Antibody |
abx028491-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Dickkopf Related Protein 4 (DKK4) Antibody (FITC) |
20-abx271154 |
Abbexa |
-
EUR 523.00
-
EUR 258.00
-
EUR 1581.00
-
EUR 732.00
-
EUR 411.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Dickkopf Related Protein 4 (DKK4) Antibody (Biotin) |
20-abx271420 |
Abbexa |
-
EUR 495.00
-
EUR 258.00
-
EUR 1469.00
-
EUR 690.00
-
EUR 398.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Dickkopf 4 Homolog (Xenopus Laevis) (DKK4) Antibody |
20-abx320423 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dickkopf 4 Homolog (Xenopus Laevis) (DKK4) Antibody |
20-abx321606 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dickkopf 4 Homolog (Xenopus Laevis) (DKK4) Antibody |
abx432610-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Dickkopf 4 Homolog (Xenopus Laevis) (DKK4) Antibody |
20-abx225146 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
ELISA kit for Mouse DKK4 |
EK5754 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse DKK4 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Mouse DKK4 PicoKine ELISA Kit |
EK1578 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of mouse DKK4 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA). |
Dkk4 ORF Vector (Rat) (pORF) |
ORF066041 |
ABM |
1.0 ug DNA |
EUR 506 |
DKK4 ORF Vector (Human) (pORF) |
ORF012846 |
ABM |
1.0 ug DNA |
EUR 354 |
Dkk4 ORF Vector (Mouse) (pORF) |
ORF043047 |
ABM |
1.0 ug DNA |
EUR 506 |
DKK4 ELISA Kit (Mouse) (OKCD00636) |
OKCD00636 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
Description: Description of target: Antagonizes canonical Wnt signaling by inhibiting LRP5/6 interaction with Wnt and by forming a ternary complex with the transmembrane protein KREMEN that promotes internalization of LRP5/6. DKKs play an important role in vertebrate development, where they locally inhibit Wnt regulated processes such as antero-posterior axial patterning, limb development, somitogenesis and eye formation. In the adult, Dkks are implicated in bone formation and bone disease, cancer and Alzheimer disease (By similarity).By similarity ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.051 ng/mL |
DKK4 ELISA Kit (Human) (OKBB00835) |
OKBB00835 |
Aviva Systems Biology |
96 Wells |
EUR 544 |
Description: Description of target: DKK4 is a membersof the Dickkopf family which are negative regulators of the growth-promoting Wnt / beta-catenin signaling pathway. By FISH, the DKK4 gene was mapped to chromosome 8p11.2-p11.1. The secreted protein contains two cysteine rich regions and is involved in embryonic development through its interactions with the Wnt signaling pathway. Activity of this protein is modulated by binding to the Wnt co-receptor and the co-factor kremen 2. The expression of DKK4 was significantly reduced in hepatocellular carcinomas (HCCs), particularly in HCCs that showed cytoplasmic beta- catenin accumulation. DKK4 expression was also reduced in HCC cell lines. Ectopic expression of DKK4 in 2 HCC cell lines reduced beta-catenin and cyclin D1 protein levels and attenuated beta-catenin activity in reporter gene assays.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml |
Dkk4 ELISA Kit (Mouse) (OKBB01103) |
OKBB01103 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: DKK4 is a membersof the Dickkopf family which are negative regulators of the growth-promoting Wnt / beta-catenin signaling pathway. By FISH, the DKK4 gene was mapped to chromosome 8p11.2-p11.1. The secreted protein contains two cysteine rich regions and is involved in embryonic development through its interactions with the Wnt signaling pathway. Activity of this protein is modulated by binding to the Wnt co-receptor and the co-factor kremen 2. The expression of DKK4 was significantly reduced in hepatocellular carcinomas (HCCs), particularly in HCCs that showed cytoplasmic beta- catenin accumulation. DKK4 expression was also reduced in HCC cell lines. Ectopic expression of DKK4 in 2 HCC cell lines reduced beta-catenin and cyclin D1 protein levels and attenuated beta-catenin activity in reporter gene assays.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml |
DKK4 ELISA Kit (Human) (OKCD09444) |
OKCD09444 |
Aviva Systems Biology |
96 Wells |
EUR 909 |
Description: Description of target: This gene encodes a protein that is a member of the dickkopf family. The secreted protein contains two cysteine rich regions and is involved in embryonic development through its interactions with the Wnt signaling pathway. Activity of this protein is modulated by binding to the Wnt co-receptor and the co-factor kremen 2.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.067ng/mL |
DKK4 ELISA Kit (Human) (OKEH01777) |
OKEH01777 |
Aviva Systems Biology |
96 Wells |
EUR 596 |
Description: Description of target: This gene encodes a protein that is a member of the dickkopf family. The secreted protein contains two cysteine rich regions and is involved in embryonic development through its interactions with the Wnt signaling pathway. Activity of this protein is modulated by binding to the Wnt co-receptor and the co-factor kremen 2.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.054 ng/mL |
DKK4 sgRNA CRISPR Lentivector set (Human) |
K0605401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Dkk4 sgRNA CRISPR Lentivector set (Rat) |
K6707001 |
ABM |
3 x 1.0 ug |
EUR 339 |
DKK4 Rabbit Polyclonal Antibody