CDO1 Rabbit Polyclonal Antibody

CDO1 Rabbit Polyclonal Antibody

To Order Now:

CDO1 Polyclonal Antibody

ABP58095-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CDO1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of CDO1 from Human, Mouse, Rat. This CDO1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CDO1 protein

CDO1 Polyclonal Antibody

ES10948-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CDO1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CDO1 Polyclonal Antibody

ES10948-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CDO1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CDO1 Rabbit pAb

A8402-100ul 100 ul
EUR 308

CDO1 Rabbit pAb

A8402-200ul 200 ul
EUR 459

CDO1 Rabbit pAb

A8402-20ul 20 ul
EUR 183

CDO1 Rabbit pAb

A8402-50ul 50 ul
EUR 223

CDO1 antibody

70R-16337 50 ul
EUR 435
Description: Rabbit polyclonal CDO1 antibody

CDO1 Antibody

36337-100ul 100ul
EUR 252

CDO1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CDO1. Recognizes CDO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CDO1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CDO1. Recognizes CDO1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CDO1 Antibody

DF10174 200ul
EUR 304
Description: CDO1 Antibody detects endogenous levels of total CDO1.

CDO1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CDO1. Recognizes CDO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

CDO1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CDO1. Recognizes CDO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

CDO1 Antibody

ABD10174 100 ug
EUR 438

CDO1 Conjugated Antibody

C36337 100ul
EUR 397

Anti-CDO1 antibody

STJ110700 100 µl
EUR 277

Anti-CDO1 antibody

STJ192106 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CDO1

Polyclonal Cysteine Dioxygenase / CDO1 Antibody (N-Terminus)

APR07473G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Cysteine Dioxygenase / CDO1 (N-Terminus). This antibody is tested and proven to work in the following applications:

Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDO1 (Met1~Asn200)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1)


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDO1 (Met1~Asn200)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1). This antibody is labeled with APC.

Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDO1 (Met1~Asn200)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1). This antibody is labeled with Biotin.

Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDO1 (Met1~Asn200)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1). This antibody is labeled with Cy3.

Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDO1 (Met1~Asn200)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1). This antibody is labeled with FITC.

Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDO1 (Met1~Asn200)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1). This antibody is labeled with HRP.

Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDO1 (Met1~Asn200)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1). This antibody is labeled with PE.

CDO1 Blocking Peptide

DF10174-BP 1mg
EUR 195

CDO1 cloning plasmid

CSB-CL621975HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 603
  • Sequence: atggaacagaccgaagtgctgaagccacggaccctggctgatctgatccgcatcctgcaccagctctttgccggcgatgaggtcaatgtagaggaggtgcaggccatcatggaagcctacgagagcgaccccaccgagtgggcaatgtacgccaagttcgaccagtacaggtatac
  • Show more
Description: A cloning plasmid for the CDO1 gene.

CDO1 Rabbit Polyclonal Antibody