WNT2 Rabbit Polyclonal Antibody

WNT2 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

WNT2 Polyclonal Antibody

ABP60923-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human WNT2 protein at amino acid sequence of 200-280
  • Applications tips:
Description: A polyclonal antibody for detection of WNT2 from Human, Mouse. This WNT2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human WNT2 protein at amino acid sequence of 200-280

WNT2 Polyclonal Antibody

ES11300-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WNT2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

WNT2 Polyclonal Antibody

ES11300-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WNT2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

WNT2 Rabbit pAb

A13562-100ul 100 ul
EUR 308

WNT2 Rabbit pAb

A13562-200ul 200 ul
EUR 459

WNT2 Rabbit pAb

A13562-20ul 20 ul
EUR 183

WNT2 Rabbit pAb

A13562-50ul 50 ul
EUR 223

WNT2 Rabbit pAb

A5864-100ul 100 ul
EUR 308

WNT2 Rabbit pAb

A5864-200ul 200 ul
EUR 459

WNT2 Rabbit pAb

A5864-20ul 20 ul
EUR 183

WNT2 Rabbit pAb

A5864-50ul 50 ul
EUR 223

Anti-WNT2 Rabbit Monoclonal Antibody

M03226 100ug/vial
EUR 397
Description: Rabbit Monoclonal WNT2 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Wnt2 antibody

70R-11919 100 ug
EUR 460
Description: Rabbit polyclonal Wnt2 antibody

WNT2 antibody

70R-21324 50 ul
EUR 435
Description: Rabbit polyclonal WNT2 antibody

WNT2 antibody

38699-100ul 100ul
EUR 252

WNT2 Antibody

43192-100ul 100ul
EUR 252

WNT2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against WNT2. Recognizes WNT2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

WNT2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against WNT2. Recognizes WNT2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:30-1:150

WNT2 Antibody

DF8067 200ul
EUR 304
Description: WNT2 Antibody detects endogenous levels of total WNT2.

WNT2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against WNT2. Recognizes WNT2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

WNT2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against WNT2. Recognizes WNT2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

WNT2 antibody

70R-5380 50 ug
EUR 467
Description: Rabbit polyclonal WNT2 antibody raised against the middle region of WNT2

WNT2 Antibody

ABD8067 100 ug
EUR 438

Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2) ELISA Kit

DLR-WNT2-Hu-48T 48T
EUR 554
  • Should the Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2) ELISA Kit

DLR-WNT2-Hu-96T 96T
EUR 725
  • Should the Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2) ELISA Kit

RDR-WNT2-Hu-48Tests 48 Tests
EUR 589

Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2) ELISA Kit

RDR-WNT2-Hu-96Tests 96 Tests
EUR 820

Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2) ELISA Kit

RD-WNT2-Hu-48Tests 48 Tests
EUR 563

Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2) ELISA Kit

RD-WNT2-Hu-96Tests 96 Tests
EUR 783

Polyclonal Wnt2 antibody - C-terminal region

APR00601G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Wnt2 - C-terminal region. This antibody is tested and proven to work in the following applications:

WNT2 Conjugated Antibody

C43192 100ul
EUR 397

WNT2 Conjugated Antibody

C38699 100ul
EUR 397

anti- WNT2 antibody

FNab09517 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: wingless-type MMTV integration site family member 2
  • Uniprot ID: P09544
  • Gene ID: 7472
  • Research Area: Cardiovascular, Developmental biology, Signal Transduction
Description: Antibody raised against WNT2

Anti-WNT2 antibody

PAab09517 100 ug
EUR 386

Anti-Wnt2 Antibody

PB9461 100ug/vial
EUR 294

Anti-WNT2 antibody

STJ28427 100 µl
EUR 277
Description: This gene is a member of the WNT gene family. The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. Alternatively spliced transcript variants have been identified for this gene.

Anti-WNT2 antibody

STJ115523 100 µl
EUR 277
Description: This gene is a member of the WNT gene family. The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. Alternatively spliced transcript variants have been identified for this gene.

Anti-WNT2 antibody

STJ192458 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to WNT2


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Rabbit Protein Wnt- 2, WNT2 ELISA KIT

ELI-07463Ra 96 Tests
EUR 928

WNT2 Blocking Peptide

33R-3548 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of WNT2 antibody, catalog no. 70R-5380

Wnt2 Blocking Peptide

33R-10810 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Wnt2 antibody, catalog no. 70R-11919

WNT2 Blocking Peptide

DF8067-BP 1mg
EUR 195

WNT2 cloning plasmid

CSB-CL026133HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1083
  • Sequence: atgaacgcccctctcggtggaatctggctctggctccctctgctcttgacctggctcacccccgaggtcaactcttcatggtggtacatgagagctacaggtggctcctccagggtgatgtgcgataatgtgccaggcctggtgagcagccagcggcagctgtgtcaccgacatc
  • Show more
Description: A cloning plasmid for the WNT2 gene.

Protein Wnt-2 (WNT2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein Wnt-2 (WNT2) Antibody

abx219361-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Protein Wnt-2 (WNT2) Antibody

abx122394-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Protein Wnt-2 (WNT2) Antibody

abx239517-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Protein Wnt-2 (WNT2) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Wnt Family Member 2 (WNT2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Wnt Family Member 2 (WNT2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human WNT2 ELISA Kit

ELA-E2980h 96 Tests
EUR 824


EF006316 96 Tests
EUR 689

Mouse WNT2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human WNT2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6-WNT2 Plasmid

PVTB00820 2 ug
EUR 356

pcDNA3.1-FLAG-WNT2 Plasmid

PVTB00820-2a 2 ug
EUR 356

WNT2 Recombinant Protein (Human)

RP034819 100 ug Ask for price

WNT2 Recombinant Protein (Mouse)

RP185666 100 ug Ask for price

Human Protein Wnt-2 (WNT2)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 41.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Protein Wnt-2(WNT2) expressed in E.coli

Human Protein Wnt-2 (WNT2)

  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 39.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Protein Wnt-2(WNT2) expressed in Yeast

Wnt2 ORF Vector (Mouse) (pORF)

ORF061890 1.0 ug DNA
EUR 506

WNT2 ORF Vector (Human) (pORF)

ORF011607 1.0 ug DNA
EUR 95

pCMV-SPORT6-WNT2(NM_003391.2) Plasmid

PVT16507 2 ug
EUR 325

WNT2 ELISA Kit (Mouse) (OKCA02439)

OKCA02439 96 Wells
EUR 846
Description: Description of target: Ligand for members of the frizzled family of seven transmembrane receptors. Probable developmental protein. May be a signaling molecule which affects the development of discrete regions of tissues. Is likely to signal over only few cell diameters. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 3.9 pg/mL

WNT2 ELISA Kit (Mouse) (OKEH05141)

OKEH05141 96 Wells
EUR 662
Description: Description of target: Ligand for members of the frizzled family of seven transmembrane receptors. Probable developmental protein. May be a signaling molecule which affects the development of discrete regions of tissues. Is likely to signal over only few cell diameters. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.089 ng/mL

Wingless Type MMTV Integration Site Family, Member 2 (WNT2) Polyclonal Antibody (Human)

  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: WNT2 (Ser26~Thr360)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2)

WNT2 sgRNA CRISPR Lentivector set (Human)

K2641601 3 x 1.0 ug
EUR 339

Wnt2 sgRNA CRISPR Lentivector set (Mouse)

K3934701 3 x 1.0 ug
EUR 339

Wingless Type MMTV Integration Site Family, Member 2 (WNT2) Polyclonal Antibody (Human), APC

  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: WNT2 (Ser26~Thr360)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2). This antibody is labeled with APC.

Wingless Type MMTV Integration Site Family, Member 2 (WNT2) Polyclonal Antibody (Human), Biotinylated

  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: WNT2 (Ser26~Thr360)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2). This antibody is labeled with Biotin.

Wingless Type MMTV Integration Site Family, Member 2 (WNT2) Polyclonal Antibody (Human), Cy3

  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: WNT2 (Ser26~Thr360)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2). This antibody is labeled with Cy3.

Wingless Type MMTV Integration Site Family, Member 2 (WNT2) Polyclonal Antibody (Human), FITC

  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: WNT2 (Ser26~Thr360)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2). This antibody is labeled with FITC.

Wingless Type MMTV Integration Site Family, Member 2 (WNT2) Polyclonal Antibody (Human), HRP

  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: WNT2 (Ser26~Thr360)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2). This antibody is labeled with HRP.

Wingless Type MMTV Integration Site Family, Member 2 (WNT2) Polyclonal Antibody (Human), PE

  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: WNT2 (Ser26~Thr360)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2). This antibody is labeled with PE.

Wingless Type MMTV Integration Site Family, Member 2 (WNT2) Polyclonal Antibody (Human), APC-Cy7

  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: WNT2 (Ser26~Thr360)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2). This antibody is labeled with APC-Cy7.

Human Protein Wnt-2(WNT2) ELISA kit

CSB-EL026133HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein Wnt-2 (WNT2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Protein Wnt-2(WNT2) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein Wnt-2(WNT2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Protein Wnt-2(WNT2) ELISA kit

CSB-EL026133MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Protein Wnt-2 (WNT2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Protein Wnt-2(WNT2) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Protein Wnt-2(WNT2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Protein Wnt-2 (WNT2) ELISA Kit

abx251598-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human WNT2(Protein Wnt-2) ELISA Kit

EH2251 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P09544
  • Alias: WNT2/NT1L1/IRP/Int-1-like protein 1/Int-1-related protein/secreted growth factor/Int-1-like protein 1/Int-1-related protein/IRPprotein Wnt-2/wingless-type MMTV integration site family member 2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Mouse Wnt2/ Protein Wnt-2 ELISA Kit

E1593Mo 1 Kit
EUR 571

Human WNT2/ Protein Wnt-2 ELISA Kit

E2686Hu 1 Kit
EUR 571

Bovine Protein Wnt- 2, WNT2 ELISA KIT

ELI-07462b 96 Tests
EUR 928

Mouse Protein Wnt- 2, Wnt2 ELISA KIT

ELI-07464m 96 Tests
EUR 865

Human Protein Wnt- 2, WNT2 ELISA KIT

ELI-07465h 96 Tests
EUR 824

Cow Protein Wnt-2 (WNT2) ELISA Kit

abx520188-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Protein Wnt-2 (WNT2) ELISA Kit

abx520190-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

WNT2 sgRNA CRISPR Lentivector (Human) (Target 1)

K2641602 1.0 ug DNA
EUR 154

WNT2 sgRNA CRISPR Lentivector (Human) (Target 2)

K2641603 1.0 ug DNA
EUR 154

WNT2 sgRNA CRISPR Lentivector (Human) (Target 3)

K2641604 1.0 ug DNA
EUR 154

Wnt2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3934702 1.0 ug DNA
EUR 154

Wnt2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3934703 1.0 ug DNA
EUR 154

Wnt2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3934704 1.0 ug DNA
EUR 154

WNT2 Protein Vector (Mouse) (pPB-C-His)

PV247558 500 ng
EUR 603

WNT2 Protein Vector (Mouse) (pPB-N-His)

PV247559 500 ng
EUR 603

WNT2 Protein Vector (Mouse) (pPM-C-HA)

PV247560 500 ng
EUR 603

WNT2 Protein Vector (Mouse) (pPM-C-His)

PV247561 500 ng
EUR 603

WNT2 Protein Vector (Human) (pPB-C-His)

PV046425 500 ng
EUR 329

WNT2 Protein Vector (Human) (pPB-N-His)

PV046426 500 ng
EUR 329

WNT2 Protein Vector (Human) (pPM-C-HA)

PV046427 500 ng
EUR 329

WNT2 Protein Vector (Human) (pPM-C-His)

PV046428 500 ng
EUR 329

Wnt2 3'UTR Luciferase Stable Cell Line

TU122326 1.0 ml Ask for price

WNT2 3'UTR GFP Stable Cell Line

TU078510 1.0 ml
EUR 1521

Wnt2 3'UTR GFP Stable Cell Line

TU172326 1.0 ml Ask for price

Wnt2 3'UTR Luciferase Stable Cell Line

TU223426 1.0 ml Ask for price

WNT2 3'UTR Luciferase Stable Cell Line

TU028510 1.0 ml
EUR 1521

Wnt2 3'UTR GFP Stable Cell Line

TU273426 1.0 ml Ask for price

WNT2 ELISA Kit (Human) : 96 Wells (OKEH01684)

OKEH01684 96 Wells
EUR 662
Description: Description of target: This gene is a member of the WNT gene family. The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. Alternatively spliced transcript variants have been identified for this gene.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.098 ng/mL

Wingless-Type Mmtv Integration Site Family Member 2 (WNT2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Wingless Type MMTV Integration Site Family, Member 2 (WNT2) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Wingless Type MMTV Integration Site Family, Member 2 (WNT2) Antibody

  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

WNT2 Rabbit Polyclonal Antibody