GNS Rabbit Polyclonal Antibody

GNS Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

GNS Polyclonal Antibody

ABP58661-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GNS protein at amino acid sequence of 190-270
  • Applications tips:
Description: A polyclonal antibody for detection of GNS from Human, Mouse. This GNS antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNS protein at amino acid sequence of 190-270

GNS Polyclonal Antibody

ES11185-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GNS from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

GNS Polyclonal Antibody

ES11185-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GNS from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

GNS Rabbit pAb

A3891-100ul 100 ul
EUR 308

GNS Rabbit pAb

A3891-200ul 200 ul
EUR 459

GNS Rabbit pAb

A3891-20ul 20 ul Ask for price

GNS Rabbit pAb

A3891-50ul 50 ul Ask for price

GNS Rabbit pAb

A7489-100ul 100 ul
EUR 308

GNS Rabbit pAb

A7489-200ul 200 ul
EUR 459

GNS Rabbit pAb

A7489-20ul 20 ul
EUR 183

GNS Rabbit pAb

A7489-50ul 50 ul
EUR 223

GNS Polyclonal Conjugated Antibody

C30947 100ul
EUR 397

GNS antibody

70R-17542 50 ul
EUR 435
Description: Rabbit polyclonal GNS antibody

GNS antibody

70R-7202 50 ug
EUR 467
Description: Rabbit polyclonal GNS antibody raised against the C terminal of GNS

Gns antibody

70R-8622 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Gns antibody

GNS Antibody

1-CSB-PA009639ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GNS. Recognizes GNS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GNS Antibody

1-CSB-PA009639ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GNS. Recognizes GNS from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

GNS Antibody

1-CSB-PA009639GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GNS. Recognizes GNS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Polyclonal GNS Antibody (Center S298)

AMM04845G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNS (Center S298). This antibody is tested and proven to work in the following applications:

Anti-GNS Antibody

A00999-1 100ug/vial
EUR 294

anti- GNS antibody

FNab03557 100µg
EUR 548.75
  • Immunogen: glucosamine(N-acetyl)-6-sulfatase
  • Uniprot ID: P15586
  • Gene ID: 2799
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against GNS

Anti-GNS antibody

PAab03557 100 ug
EUR 386

Anti-GNS antibody

STJ29625 100 µl
EUR 277
Description: The product of this gene is a lysosomal enzyme found in all cells. It is involved in the catabolism of heparin, heparan sulphate, and keratan sulphate. Deficiency of this enzyme results in the accumulation of undegraded substrate and the lysosomal storage disorder mucopolysaccharidosis type IIID (Sanfilippo D syndrome). Mucopolysaccharidosis type IIID is the least common of the four subtypes of Sanfilippo syndrome.

Anti-GNS antibody

STJ23828 100 µl
EUR 277
Description: The product of this gene is a lysosomal enzyme found in all cells. It is involved in the catabolism of heparin, heparan sulphate, and keratan sulphate. Deficiency of this enzyme results in the accumulation of undegraded substrate and the lysosomal storage disorder mucopolysaccharidosis type IIID (Sanfilippo D syndrome). Mucopolysaccharidosis type IIID is the least common of the four subtypes of Sanfilippo syndrome.

Anti-GNS antibody

STJ192343 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GNS

GNS siRNA

20-abx918239
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNS siRNA

20-abx918240
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-GNS

YF-PA12077 50 ug
EUR 363
Description: Mouse polyclonal to GNS

anti-GNS

YF-PA12078 100 ug
EUR 403
Description: Rabbit polyclonal to GNS

Gns Blocking Peptide

33R-10135 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Gns antibody, catalog no. 70R-8622

GNS Blocking Peptide

33R-7159 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNS antibody, catalog no. 70R-7202

GNS cloning plasmid

CSB-CL009639HU-10ug 10ug
EUR 574
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1659
  • Sequence: atgcggctcctgcctctagccccaggtcggctccggcggggcagcccccgccacctgccctcctgcagcccagcgctgctactgctggtgctgggcggctgcctgggggtcttcggggtggctgcgggaacccggaggcccaacgtggtgctgctcctcacggacgaccaggacg
  • Show more
Description: A cloning plasmid for the GNS gene.

GNS ELISA KIT|Human

EF009927 96 Tests
EUR 689

Mouse GNS shRNA Plasmid

20-abx978444
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GNS Rabbit Polyclonal Antibody