GNS Rabbit Polyclonal Antibody
GNS Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
GNS Polyclonal Antibody |
ABP58661-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human GNS protein at amino acid sequence of 190-270
- Applications tips:
|
Description: A polyclonal antibody for detection of GNS from Human, Mouse. This GNS antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNS protein at amino acid sequence of 190-270 |
GNS Polyclonal Antibody |
ES11185-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against GNS from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
GNS Polyclonal Antibody |
ES11185-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against GNS from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
GNS Rabbit pAb |
A3891-100ul |
Abclonal |
100 ul |
EUR 308 |
GNS Rabbit pAb |
A3891-200ul |
Abclonal |
200 ul |
EUR 459 |
GNS Rabbit pAb |
A3891-20ul |
Abclonal |
20 ul |
Ask for price |
GNS Rabbit pAb |
A3891-50ul |
Abclonal |
50 ul |
Ask for price |
GNS Rabbit pAb |
A7489-100ul |
Abclonal |
100 ul |
EUR 308 |
GNS Rabbit pAb |
A7489-200ul |
Abclonal |
200 ul |
EUR 459 |
GNS Rabbit pAb |
A7489-20ul |
Abclonal |
20 ul |
EUR 183 |
GNS Rabbit pAb |
A7489-50ul |
Abclonal |
50 ul |
EUR 223 |
GNS Polyclonal Conjugated Antibody |
C30947 |
SAB |
100ul |
EUR 397 |
GNS antibody |
70R-17542 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal GNS antibody |
GNS antibody |
70R-7202 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal GNS antibody raised against the C terminal of GNS |
Gns antibody |
70R-8622 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal Gns antibody |
GNS Antibody |
1-CSB-PA009639ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against GNS. Recognizes GNS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
GNS Antibody |
1-CSB-PA009639ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against GNS. Recognizes GNS from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
GNS Antibody |
1-CSB-PA009639GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against GNS. Recognizes GNS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
Polyclonal GNS Antibody (Center S298) |
AMM04845G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNS (Center S298). This antibody is tested and proven to work in the following applications: |
Anti-GNS Antibody |
A00999-1 |
BosterBio |
100ug/vial |
EUR 294 |
anti- GNS antibody |
FNab03557 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: glucosamine(N-acetyl)-6-sulfatase
- Uniprot ID: P15586
- Gene ID: 2799
- Research Area: Cardiovascular, Metabolism
|
Description: Antibody raised against GNS |
Anti-GNS antibody |
STJ29625 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The product of this gene is a lysosomal enzyme found in all cells. It is involved in the catabolism of heparin, heparan sulphate, and keratan sulphate. Deficiency of this enzyme results in the accumulation of undegraded substrate and the lysosomal storage disorder mucopolysaccharidosis type IIID (Sanfilippo D syndrome). Mucopolysaccharidosis type IIID is the least common of the four subtypes of Sanfilippo syndrome. |
Anti-GNS antibody |
STJ23828 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The product of this gene is a lysosomal enzyme found in all cells. It is involved in the catabolism of heparin, heparan sulphate, and keratan sulphate. Deficiency of this enzyme results in the accumulation of undegraded substrate and the lysosomal storage disorder mucopolysaccharidosis type IIID (Sanfilippo D syndrome). Mucopolysaccharidosis type IIID is the least common of the four subtypes of Sanfilippo syndrome. |
Anti-GNS antibody |
STJ192343 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to GNS |
GNS siRNA |
20-abx918239 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GNS siRNA |
20-abx918240 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-GNS |
YF-PA12077 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to GNS |
anti-GNS |
YF-PA12078 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to GNS |
Gns Blocking Peptide |
33R-10135 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Gns antibody, catalog no. 70R-8622 |
GNS Blocking Peptide |
33R-7159 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNS antibody, catalog no. 70R-7202 |
GNS cloning plasmid |
CSB-CL009639HU-10ug |
Cusabio |
10ug |
EUR 574 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1659
- Sequence: atgcggctcctgcctctagccccaggtcggctccggcggggcagcccccgccacctgccctcctgcagcccagcgctgctactgctggtgctgggcggctgcctgggggtcttcggggtggctgcgggaacccggaggcccaacgtggtgctgctcctcacggacgaccaggacg
- Show more
|
Description: A cloning plasmid for the GNS gene. |
Mouse GNS shRNA Plasmid |
20-abx978444 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
GNS Rabbit Polyclonal Antibody