FOXC2 Rabbit Polyclonal Antibody
FOXC2 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
FOXC2 Polyclonal Antibody |
ABP58584-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human FOXC2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of FOXC2 from Human, Mouse, Rat. This FOXC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FOXC2 protein |
FOXC2 Polyclonal Antibody |
ES10997-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against FOXC2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
FOXC2 Polyclonal Antibody |
ES10997-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against FOXC2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
FOXC2 Antibody |
36862-100ul |
SAB |
100ul |
EUR 252 |
FOXC2 Antibody |
1-CSB-PA955638 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against FOXC2. Recognizes FOXC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000 |
FOXC2 Antibody |
1-CSB-PA975779 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against FOXC2. Recognizes FOXC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000 |
FOXC2 Antibody |
1-CSB-PA857880LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against FOXC2. Recognizes FOXC2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Rabbit FoxC2 ELISA Kit |
ERTF0027 |
Abclonal |
96Tests |
EUR 521 |
Polyclonal Goat Anti-FOXC2 Antibody |
AMM04978G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-FOXC2 . This antibody is tested and proven to work in the following applications: |
Polyclonal Foxc2 antibody - N-terminal region |
APR00773G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Foxc2 - N-terminal region. This antibody is tested and proven to work in the following applications: |
Polyclonal FOXC2 antibody - C-terminal region |
AMM04599G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FOXC2 - C-terminal region. This antibody is tested and proven to work in the following applications: |
FOXC2 Conjugated Antibody |
C36862 |
SAB |
100ul |
EUR 397 |
FOXC1/FOXC2 Antibody |
1-CSB-PA008290 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against FOXC1/FOXC2. Recognizes FOXC1/FOXC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000 |
FOXC1 / FOXC2 Antibody |
20-abx329537 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti- FOXC2 antibody |
FNab03191 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: forkhead box C2(MFH-1, mesenchyme forkhead 1)
- Uniprot ID: Q99958
- Gene ID: 2303
- Research Area: Epigenetics, Signal Transduction, Metabolism, Developmental biology, Neuroscience
|
Description: Antibody raised against FOXC2 |
Anti-FOXC2 antibody |
STJ192155 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to FOXC2 |
FOXC2 siRNA |
20-abx902004 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FOXC2 siRNA |
20-abx917093 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FOXC2 siRNA |
20-abx917094 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FOXC2 Antibody, HRP conjugated |
1-CSB-PA857880LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against FOXC2. Recognizes FOXC2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
FOXC2 Antibody, FITC conjugated |
1-CSB-PA857880LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against FOXC2. Recognizes FOXC2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
FOXC2 Antibody, Biotin conjugated |
1-CSB-PA857880LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against FOXC2. Recognizes FOXC2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Goat Anti Human Foxc2 (C-Terminal) Polyclonal Antibody |
CPBT-67491GH |
Creative Diagnostics |
0.1 mg |
EUR 840 |
FOXC2 cloning plasmid |
CSB-CL857880HU-10ug |
Cusabio |
10ug |
EUR 531 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1506
- Sequence: ATGCAGGCGCGCTACTCCGTGTCCGACCCCAACGCCCTGGGAGTGGTGCCCTACCTGAGCGAGCAGAATTACTACCGGGCTGCGGGCAGCTACGGCGGCATGGCCAGCCCCATGGGCGTCTATTCCGGCCACCCGGAGCAGTACAGCGCGGGGATGGGCCGCTCCTACGCGCCCT
- Show more
|
Description: A cloning plasmid for the FOXC2 gene. |
Anti-FOXC2 (3H3) |
YF-MA13050 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to FOXC2 |
Anti-FOXC2 (3H3) |
YF-MA13051 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to FOXC2 |
Anti-FOXC2 (2H3) |
YF-MA13052 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to FOXC2 |
Anti-FOXC2 (4B3) |
YF-MA13053 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to FOXC2 |
Anti-FOXC2 (1A8) |
YF-MA13054 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to FOXC2 |
Anti-FOXC2 (3H5) |
YF-MA13055 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to FOXC2 |
Anti-FOXC2 (3E6) |
YF-MA13056 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to FOXC2 |
Anti-FOXC2 (4A5) |
YF-MA13057 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to FOXC2 |
Anti-FOXC2 (4A3) |
YF-MA13058 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to FOXC2 |
Anti-FOXC2 (1D4) |
YF-MA13059 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to FOXC2 |
Anti-FOXC2 (3D6) |
YF-MA20189 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to FOXC2 |
Monoclonal FOXC2 Antibody, Clone: 1D11C8 |
AMM04595G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human FOXC2. The antibodies are raised in Mouse and are from clone 1D11C8. This antibody is applicable in WB, E |
Monoclonal FOXC2 Antibody, Clone: 1D11C8 |
AMM04596G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human FOXC2. The antibodies are raised in Mouse and are from clone 1D11C8. This antibody is applicable in WB, E |
Forkhead Box Protein C2 (FOXC2) Antibody |
abx015862-100ul |
Abbexa |
100 ul |
EUR 411 |
- Shipped within 5-10 working days.
|
Forkhead Box Protein C2 (FOXC2) Antibody |
abx015863-100ug |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
Forkhead Box Protein C2 (FOXC2) Antibody |
20-abx242341 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Forkhead Box Protein C2 (FOXC2) Antibody |
20-abx242342 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Forkhead Box Protein C2 (FOXC2) Antibody |
abx233191-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Forkhead Box Protein C2 (FOXC2) Antibody |
abx431254-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Forkhead Box Protein C2 (FOXC2) Antibody |
20-abx301856 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human FoxC2 ELISA Kit |
EHF0027 |
Abclonal |
96Tests |
EUR 521 |
Goat FoxC2 ELISA Kit |
EGTF0027 |
Abclonal |
96Tests |
EUR 521 |
Bovine FoxC2 ELISA Kit |
EBF0027 |
Abclonal |
96Tests |
EUR 521 |
Canine FoxC2 ELISA Kit |
ECF0027 |
Abclonal |
96Tests |
EUR 521 |
Anserini FoxC2 ELISA Kit |
EAF0027 |
Abclonal |
96Tests |
EUR 521 |
Rat FOXC2 shRNA Plasmid |
20-abx987740 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse FOXC2 shRNA Plasmid |
20-abx970357 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human FOXC2 shRNA Plasmid |
20-abx951610 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse FoxC2 ELISA Kit |
EMF0027 |
Abclonal |
96Tests |
EUR 521 |
Rat FoxC2 ELISA Kit |
ERF0027 |
Abclonal |
96Tests |
EUR 521 |
Porcine FoxC2 ELISA Kit |
EPF0027 |
Abclonal |
96Tests |
EUR 521 |
FOXC2 Recombinant Protein (Human) |
RP039259 |
ABM |
100 ug |
Ask for price |
FOXC2 Recombinant Protein (Rat) |
RP201671 |
ABM |
100 ug |
Ask for price |
FOXC2 Recombinant Protein (Mouse) |
RP135026 |
ABM |
100 ug |
Ask for price |
Forkhead Box Protein C2 (FOXC2) Antibody (HRP) |
20-abx316492 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Forkhead Box Protein C2 (FOXC2) Antibody (FITC) |
20-abx316493 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Forkhead Box Protein C2 (FOXC2) Antibody (Biotin) |
20-abx316494 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Monoclonal FOXC2 Antibody (monoclonal) (M02), Clone: 2H3 |
AMM04597G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human FOXC2 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 2H3. This antibody is applicable in WB, IHC and IF, E |
Monoclonal FOXC2 Antibody (monoclonal) (M03), Clone: 4B3 |
AMM04598G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human FOXC2 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 4B3. This antibody is applicable in WB, E |
Guinea Pig FoxC2 ELISA Kit |
EGF0027 |
Abclonal |
96Tests |
EUR 521 |
Foxc2 ORF Vector (Rat) (pORF) |
ORF067225 |
ABM |
1.0 ug DNA |
EUR 506 |
FOXC2 ORF Vector (Human) (pORF) |
ORF013087 |
ABM |
1.0 ug DNA |
EUR 95 |
Foxc2 ORF Vector (Mouse) (pORF) |
ORF045010 |
ABM |
1.0 ug DNA |
EUR 506 |
FOXC2 ELISA Kit (Mouse) (OKEH05599) |
OKEH05599 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: Transcriptional activator. Might be involved in the formation of special mesenchymal tissues.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.09 ng/mL |
Foxc2 sgRNA CRISPR Lentivector set (Mouse) |
K5011901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Foxc2 sgRNA CRISPR Lentivector set (Rat) |
K7110801 |
ABM |
3 x 1.0 ug |
EUR 339 |
FOXC2 sgRNA CRISPR Lentivector set (Human) |
K0795201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Foxc2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K5011902 |
ABM |
1.0 ug DNA |
EUR 154 |
Foxc2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K5011903 |
ABM |
1.0 ug DNA |
EUR 154 |
FOXC2 Rabbit Polyclonal Antibody